Dataset for CDS BAK1 of Organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F6PMP8_BAK1-01      atggcatccgggcaaggcccagggcctcccaggcgggagtgtggagaggctgccccgtct
Q52HB2_BAK1-01      atggcatccgggcaaggcccagggcctcccaggcgggagtgtggagaggctgccccgtct

F6PMP8_BAK1-01      tctacttctgaggagcaggtagcccgggacaccgaggaggttttccgcagctatgttttt
Q52HB2_BAK1-01      tctacttctgaggagcaggtagcccgggacaccgaggaggttttccgcagctatgttttt

F6PMP8_BAK1-01      taccgccatcggcaggagcaggaggctgagggggcggctgtgccagctgacccagaaatg
Q52HB2_BAK1-01      taccgccatcggcaggagcaggaggctgagggggcggctgtgccagctgacccagaaatg

F6PMP8_BAK1-01      gtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctcgctatc
Q52HB2_BAK1-01      gtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctcgctatc

F6PMP8_BAK1-01      attggggacgacatcaaccagcgctatgactcggagttccaggccatgctgcagcaccta
Q52HB2_BAK1-01      attggggacgacatcaaccagcgctatgactcggagttccaggccatgctgcagcaccta

F6PMP8_BAK1-01      cagccgacagcagagaatgcctatgagtacttcaccaagattgcctcgagcctatttgag
Q52HB2_BAK1-01      cagccgacagcagagaatgcctatgagtacttcaccaagattgcctcgagcctatttgag

F6PMP8_BAK1-01      agcggcatcaactggggccgagtggtggctctcctgggctttggctaccgcctggccctg
Q52HB2_BAK1-01      agcggcatcaactggggccgagtggtggctctcctgggctttggctaccgcctggccctg

F6PMP8_BAK1-01      catgtctaccaacgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
Q52HB2_BAK1-01      catgtctaccaacgcggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac

F6PMP8_BAK1-01      ttcatgctgcatcattgcattgcccggtggatcgcgcagaggggtggctgggtggcagcc
Q52HB2_BAK1-01      ttcatgctgcatcattgcattgcccggtggatcgcgcagaggggtggctgggtggcagcc

F6PMP8_BAK1-01      ctgaacttgggaaacggccccatcctgaacgtgctgatagtgctgtctgtggttctgttg
Q52HB2_BAK1-01      ctgaacttgggaaacggccccatcctgaacgtgctgatagtgctgtctgtggttctgttg

F6PMP8_BAK1-01      ggccagtttgtgcctacaggtctgggggaaaggagagagaagttcatgattaagccaaat
Q52HB2_BAK1-01      ggccagtttgtg------------------------------------------------

F6PMP8_BAK1-01      gcagggagcggatgcagatggagcccgctgaccagcccccaccctctgagtgtgtctgaa
Q52HB2_BAK1-01      ---------gtacgaagat----------------------tcttc--------------
                             * * * ****                       * **              

F6PMP8_BAK1-01      aataaactgtaa
Q52HB2_BAK1-01      ---aaatcatga
                       ***   * *

© 1998-2019