Dataset for CDS BAX-like of Organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

U3BU97_BAX-04       atggacg-ggtccggggagcaacc-----------cagaggcgaggg-gcccaccagctc
U3BU97_BAX-02       atggacg-ggtccggggagcaacc-----------cagaggcgaggg-------------
U3BU97_BAX-03       atggacg-ggtccggggagcaacc-----------cagaggcgaggg-gcccaccagctc
U3BU97_BAX-01       atggacg-ggtccggggagcaacc-----------cagaggcgaggg-gcccaccagctc
F6SBR3_BOK-01       atggaggtgctgcggcgctcctccgtcttcgccgccgagatcatggacgcctttgaccgc
F7ICC2_BAK1-01      atggcatcggggcaaggcccag--gtcctcccaggcaggagtgcgga-gagcctgaccca
                    ****    *   *   *  *               *        **              

U3BU97_BAX-04       tgagcagatcatgaagacaggggcccttttgcttc-----agggtttcatccaggatcga
U3BU97_BAX-02       -----------tgaggcgggaggcagtcgggcggg-----aga-----------------
U3BU97_BAX-03       tgagcagatcatgaagacaggggcccttttgcttc-----agg-----------------
U3BU97_BAX-01       tgagcagatcatgaagacaggggcccttttgcttc-----agggtttcatccaggatcga
F6SBR3_BOK-01       tcgcccaccgacaaggagctggtggcccaggcca------aggcgctcggcagggagtac
F7ICC2_BAK1-01      ccctctgcttctgaggagcaggtagcccgggacacagaggaggttttccacag---ctac
                                 * *     *        *         **                  

U3BU97_BAX-04       gc----------------------agggagaatcgcgggggagacacccgagctggccc-
U3BU97_BAX-02       ------------------------------------agggcgaacacccgagctggccc-
U3BU97_BAX-03       ------------------------------------------------------------
U3BU97_BAX-01       gc----------------------agggagaatcgcgggggagacacccgagctggccc-
F6SBR3_BOK-01       gt-------------------gcacgcgcggct-actgcgcgccggcctctcctgg---a
F7ICC2_BAK1-01      gttttttaccgccatcggcaggaacaggaggctgaaggggcggctgcccctgctgaccca

U3BU97_BAX-04       -------tggacccggtgccccaggatgcgtccaccaaga---agctgagcgagtgtctc
U3BU97_BAX-02       -------tggacccggtgccccaggatgcgtccaccaaga---agctgagcgagtgtctc
U3BU97_BAX-03       ------------------------------------------------------------
U3BU97_BAX-01       -------tggacccggtgccccaggatgcgtccaccaaga---agctgagcgagtgtctc
F6SBR3_BOK-01       gcgcgcccgagcgcgccgcgccgttcccggggcgcc-tggccgaggtgtgcgcggtgctg
F7ICC2_BAK1-01      gagatggttagcttgtctctccaacctagcagcaccatggggcaggtgggacggcagctc

U3BU97_BAX-04       aagcgcatcggggacgagctgga-----------------------cagtaacatggagc
U3BU97_BAX-02       aagcgcatcggggacgagctgga-----------------------cagtaacatggagc
U3BU97_BAX-03       ------------------------------------------------------------
U3BU97_BAX-01       aagcgcatcggggacgagctgga-----------------------cagtaacatggagc
F6SBR3_BOK-01       ctgcgcctgggggatgagctgga--gatgatccgccccagcgtttaccgcaacgtggcgc
F7ICC2_BAK1-01      gctatcattggggatgacatcaaccggcgctatgactcggagtt--ccagaccatgctgc

U3BU97_BAX-04       tgcagaggatgat-----tgctgctgtggatacagactccccacgagaggtcttttttcg
U3BU97_BAX-02       tgcagaggatgat-----tgctgctgtggatacagactccccacgagaggtcttttttcg
U3BU97_BAX-03       ------ggatgat-----tgctgctgtggatacagactccccacgagaggtcttttttcg
U3BU97_BAX-01       tgcagaggatgat-----tgctgctgtggatacagactccccacgagaggtcttttttcg
F6SBR3_BOK-01       gccagctgcacatctccctacagtccgagcctgtggtgaccgatgca-----ttcttggc
F7ICC2_BAK1-01      agca------------cctgcagcccacggcagagaacgcctacgag-----tacttcac
                                      * * *     *     *    ** * *       *  **   

U3BU97_BAX-04       agtggcagctgacatgttctctgacggcaacttcaactggggccgggttgtcgccctttt
U3BU97_BAX-02       agtggcagctgacatgttctctgacggcaacttcaactggggccgggttgtcgccctttt
U3BU97_BAX-03       agtggcagctgacatgttctctgacggcaacttcaactggggccgggttgtcgccctttt
U3BU97_BAX-01       agtggcagctgacatgttctctgacggcaacttcaactggggccgggttgtcgccctttt
F6SBR3_BOK-01       cgtggccggccacatcttctctgca---ggcatcacgtggggcaaggtggtgtc-cttgt
F7ICC2_BAK1-01      caagatcgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctctcct
                       *   *    **   * * **       * ***  ******   ** **  * **  *

U3BU97_BAX-04       ctactttgccagca-aactggtgctcaa------------ggccctgtgtgccaaggtgc
U3BU97_BAX-02       ctactttgccagca-aactggtgctcaa------------ggccctgtgtgccaaggtgc
U3BU97_BAX-03       ctactttgccagca-aactggtgctcaa------------ggccctgtgtgccaaggtgc
U3BU97_BAX-01       ctactttgccagca-aactggtgctcaa------------ggccctgtgtgccaaggtgc
F6SBR3_BOK-01       atgcggtggccgcagggctggccgtggactgcgtgaggcaggcccagcctgccatggtcc
F7ICC2_BAK1-01      gggctttggctacc-gtctggccctacac-----------------gtctaccag----c
                       *  ** *  *    ****   *  *                  *  * ***     *

U3BU97_BAX-04       ccgagctgatcagaaccatcatgg------------gctggactttggacttc---ctcc
U3BU97_BAX-02       ccgagctgatcagaaccatcatgg------------gctggactttggacttc---ctcc
U3BU97_BAX-03       ccgagctgatcagaaccatcatgg------------gctggactttggacttc---ctcc
U3BU97_BAX-01       ccgagctgatcagaaccatcatgg------------gctggactttggacttc---ctcc
F6SBR3_BOK-01       acgcccttgttga---ctgcctgggagagtttgtgcgcaagaccctggccacctggctgc
F7ICC2_BAK1-01      gcggcctgactgg---cttcctgggccaggtgacccgcttcgtggtggacttcatgctgc
                     **  **         *  * ***            **       *** *  *   ** *

U3BU97_BAX-04       gggagcggctgttgggctggatccaagaccagggtggt------tgggtgagacccctct
U3BU97_BAX-02       gggagcggctgttgggctggatccaagaccagggtggt------tgggatggcctcctct
U3BU97_BAX-03       gggagcggctgttgggctggatccaagaccagggtggt------tgggatggcctcctct
U3BU97_BAX-01       gggagcggctgttgggctggatccaagaccagggtggt------tgggatggcctcctct
F6SBR3_BOK-01       ggag-------gcgcggtggat-----ggactgatgtcctcaagtgtgtggtcaac----
F7ICC2_BAK1-01      atcactgcatcgcccggtggatcgcacagaggggtggc------tgggtgg-cagc----
                                   * *****          * **        ** *       *    

U3BU97_BAX-04       acccttcctgcccagcctcccctgactcctctgggaccctgggccttccaagcaggtcac
U3BU97_BAX-02       ---------------------cctacttctttgggacc-----cccacatggcagacagt
U3BU97_BAX-03       ---------------------cctacttctttgggacc-----cccacatggcagacagt
U3BU97_BAX-01       ---------------------cctacttctttgggacc-----cccacatggcagacagt
F6SBR3_BOK-01       ---------------------acagaccct---ggcctccgctccca--ctggc--tgct
F7ICC2_BAK1-01      ---------------------cctggacct---gggcaatggacccatcctgaatgtgct
                                                **   ** *      **      *        

U3BU97_BAX-04       aatcatcag--atgtggtctataatg-------------------------cattt----
U3BU97_BAX-02       gaccatc-t--ttgtgg-ctggagtgctcaccgcct--------cgcttaccatctggaa
U3BU97_BAX-03       gaccatc-t--ttgtgg-ctggagtgctcaccgcct--------cgcttaccatctggaa
U3BU97_BAX-01       gaccatc-t--ttgtgg-ctggagtgctcaccgcct--------cgcttaccatctggaa
F6SBR3_BOK-01       cgccgcact--ctgcagcttt----ggccgcttcctgaaggctgccttcttcgtgctcct
F7ICC2_BAK1-01      ggtcgttctgggtgtggttctgttgggccagtttgtggtacgaagattcttc--------
                       *        **  *        *                         *        

U3BU97_BAX-04       -------------
U3BU97_BAX-02       gaacatgggctga
U3BU97_BAX-03       gaacatgggctga
U3BU97_BAX-01       gaacatgggctga
F6SBR3_BOK-01       gccagagagatga
F7ICC2_BAK1-01      ----aaatcatga

© 1998-2019