Dataset for CDS BAX of Organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

U3BU97_BAX-04      atggacgggtccggggagcaacccagaggcgaggggcccaccagctctgagcagatcatg
U3BU97_BAX-02      atggacgggtccggggagcaacccagaggcgaggg-----------------------tg
U3BU97_BAX-03      atggacgggtccggggagcaacccagaggcgaggggcccaccagctctgagcagatcatg
U3BU97_BAX-01      atggacgggtccggggagcaacccagaggcgaggggcccaccagctctgagcagatcatg
                   ***********************************                       **

U3BU97_BAX-04      aagacaggggcccttttgcttcagggtttcatccaggatcgagcagggagaatcgcgggg
U3BU97_BAX-02      aggcgggaggcagtcgggcgggaga-------------------------------aggg
U3BU97_BAX-03      aagacaggggcccttttgcttcagg-----------------------------------
U3BU97_BAX-01      aagacaggggcccttttgcttcagggtttcatccaggatcgagcagggagaatcgcgggg
                   * *   * ***  *   **   **                                    

U3BU97_BAX-04      gagacacccgagctggccctggacccggtgccccaggatgcgtccaccaagaagctgagc
U3BU97_BAX-02      cgaacacccgagctggccctggacccggtgccccaggatgcgtccaccaagaagctgagc
U3BU97_BAX-03      ------------------------------------------------------------
U3BU97_BAX-01      gagacacccgagctggccctggacccggtgccccaggatgcgtccaccaagaagctgagc

U3BU97_BAX-04      gagtgtctcaagcgcatcggggacgagctggacagtaacatggagctgcagaggatgatt
U3BU97_BAX-02      gagtgtctcaagcgcatcggggacgagctggacagtaacatggagctgcagaggatgatt
U3BU97_BAX-03      ----------------------------------------------------ggatgatt
U3BU97_BAX-01      gagtgtctcaagcgcatcggggacgagctggacagtaacatggagctgcagaggatgatt

U3BU97_BAX-04      gctgctgtggatacagactccccacgagaggtcttttttcgagtggcagctgacatgttc
U3BU97_BAX-02      gctgctgtggatacagactccccacgagaggtcttttttcgagtggcagctgacatgttc
U3BU97_BAX-03      gctgctgtggatacagactccccacgagaggtcttttttcgagtggcagctgacatgttc
U3BU97_BAX-01      gctgctgtggatacagactccccacgagaggtcttttttcgagtggcagctgacatgttc

U3BU97_BAX-04      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
U3BU97_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
U3BU97_BAX-03      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
U3BU97_BAX-01      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg

U3BU97_BAX-04      gtgctcaaggccctgtgtgccaaggtgcccgagctgatcagaaccatcatgggctggact
U3BU97_BAX-02      gtgctcaaggccctgtgtgccaaggtgcccgagctgatcagaaccatcatgggctggact
U3BU97_BAX-03      gtgctcaaggccctgtgtgccaaggtgcccgagctgatcagaaccatcatgggctggact
U3BU97_BAX-01      gtgctcaaggccctgtgtgccaaggtgcccgagctgatcagaaccatcatgggctggact

U3BU97_BAX-04      ttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggtgaga
U3BU97_BAX-02      ttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggatggc
U3BU97_BAX-03      ttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggatggc
U3BU97_BAX-01      ttggacttcctccgggagcggctgttgggctggatccaagaccagggtggttgggatggc
                   *******************************************************   * 

U3BU97_BAX-04      cccctctacccttcctgcccagcctcccctgactcctctgggaccctgggccttccaagc
U3BU97_BAX-02      ctcctct---------------------cctacttctttgggacc-----cccacatggc
U3BU97_BAX-03      ctcctct---------------------cctacttctttgggacc-----cccacatggc
U3BU97_BAX-01      ctcctct---------------------cctacttctttgggacc-----cccacatggc
                   * *****                     *  *** ** *******     **  *   **

U3BU97_BAX-04      aggtcacaatcatcagatgtggtctataatg-----------------cattt-------
U3BU97_BAX-02      agacagtgaccatc-tttgtgg-ctggagtgctcaccgcctcgcttaccatctggaagaa
U3BU97_BAX-03      agacagtgaccatc-tttgtgg-ctggagtgctcaccgcctcgcttaccatctggaagaa
U3BU97_BAX-01      agacagtgaccatc-tttgtgg-ctggagtgctcaccgcctcgcttaccatctggaagaa
                   **      * ****   ***** **  * **                 *** *       

U3BU97_BAX-04      ----------
U3BU97_BAX-02      catgggctga
U3BU97_BAX-03      catgggctga
U3BU97_BAX-01      catgggctga

© 1998-2019