Dataset for CDS BAX-like of Organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A6H6W7_BOK-01       atgga-ggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccg
Q05KI7_BAK1-01      ----atggcttccggacaaggcccaggtccccccgggcaggactgcgacgagcctgaccc
O02703_BAX-01       atggacgggtccggggagcaacccaga----------------ggcggggggc-------
O02703_BAX-02       atggacgggtccggggagcaacccaga----------------ggcggggggc-------
O02703_BAX-03       ------------------------------------------------------------
                                                                                

A6H6W7_BOK-01       ctcgcccaccgacaaggagctggtggcccaggcc------aaggctctcggccgcgagtt
Q05KI7_BAK1-01      ctcctccacctcggaggagcaggtggcccgggacaccgaggaggtcttccgcagctacgt
O02703_BAX-01       --ccaccagctctgagcagatcatg----aagac----aggggcccttttgcttcagggt
O02703_BAX-02       --ccaccagctctgagcagatcatg----aagac----aggggcccttttgcttcagggt
O02703_BAX-03       ----------------------atg----aagac----aggggcccttttgcttcagggt
                                           **      * *        *    *  **  *    *

A6H6W7_BOK-01       cgtgcacgcgcgactgctg---cgcgctggcctctcctggagc-----------gcgccc
Q05KI7_BAK1-01      cttttaccgccatcagcaggaac-aggaggccgagggggcggctgcgcctactgac-cca
O02703_BAX-01       tt--------catc--caggatcgagcagggcgaatgggggg--------agagacaccc
O02703_BAX-02       tt--------catc--caggatcgagcagggcgaatgggggg--------agagacaccc
O02703_BAX-03       tt--------catc--caggatcgagcagggcgaatgggggg--------agagacaccc
                              *  *  * *   *  *  ** *      *  *             * ** 

A6H6W7_BOK-01       gagc---gcgccgcgccggt--ccccgg---cggccgcctggcggaggtgtgcgccgtgc
Q05KI7_BAK1-01      gagatggtcaccttgca-----cccagaacctagcagcaccatggggcag-gtgggccgc
O02703_BAX-01       gagctgggcttggagcaggtgccccaggatgcatc--caccaagaagctgagcgagtgtc
O02703_BAX-02       gagctgggcttggagcaggtgccccaggatgcatc--caccaagaagctgagcgagtgtc
O02703_BAX-03       gagctgggcttggagcaggtgccccaggatgcatc--caccaagaagctgagcgagtgtc
                    ***     *     **      *** *       *  *     *  *  * * *     *

A6H6W7_BOK-01       tgctgcg----cctggcggacgagctggagctgatccggcccagtgtctaccgcaacgtg
Q05KI7_BAK1-01      cagctcgccgtcatcggggacgacatcaa------ccggc---------gctacgatgcg
O02703_BAX-01       tgaagcg----catcggagatgaattgga------cag---------------taacatg
O02703_BAX-02       tgaagcg----catcggagatgaattgga------cag---------------taacatg
O02703_BAX-03       tgaagcg----catcggagatgaattgga------cag---------------taacatg
                         **    * * *  ** **  *  *      * *                 *   *

A6H6W7_BOK-01       gcccgccagctgaacctctc---cctgcagtcg----gagaccgtggtgaccgacgcctt
Q05KI7_BAK1-01      gagttccaggccatgctgcagcacctgcagccaacagcagacaacgccta-tgagtactt
O02703_BAX-01       gagctgcagaggatgat--cgcagctgtggaca----cagactctccccg-agaggtctt
O02703_BAX-02       gagctgcagaggatgat--cgcagctgtggaca----cagactctccccg-agaggtctt
O02703_BAX-03       gagctgcagaggatgat--cgcagctgtggaca----cagactctccccg-agaggtctt
                    *     ***   *   *       ***  * *      ****          **   ***

A6H6W7_BOK-01       cctggctgtggcgacccagatcttttctgcaggca---tcacgtggggcaaagttgtgtc
Q05KI7_BAK1-01      caccaagatcgcgtccagcctgtt---tgagagcggtatcaactggggccgcgtggtggc
O02703_BAX-01       tttccgagtggcggctgaaatgttttctgacggcaacttcaactggggccgggttgtcgc
O02703_BAX-02       tttccgagtggcggctgaaatgttttctgacggcaacttcaactggggccgggttgtcgc
O02703_BAX-03       tttccgagtggcggctgaaatgttttctgacggcaacttcaactggggccgggttgtcgc
                            * *** *     * **   **   **    ***  ******   ** **  *

A6H6W7_BOK-01       cctgtactccgtggccgcggggctggccgt--ggactgtgtgcggcaggcccagcccgcc
Q05KI7_BAK1-01      tctgctgggctttggctaccgcctggccct-----ccacgtctacca------gcgcggc
O02703_BAX-01       ccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggt--gcccgag
O02703_BAX-02       ccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggt--gcccgag
O02703_BAX-03       ccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggt--gcccgag
                     **      * * * *      ****   *     *   **    **      ** **  

A6H6W7_BOK-01       ctggtgcacgccctcgtcgactgtctcggggagtttgtgcggaagacgc----tggcaac
Q05KI7_BAK1-01      ctgaccgg---cttcctgggccaggt----gacccgcttcgtggccgacttcatgctgcg
O02703_BAX-01       ttgatcaggaccatcatgggctggacattggacttccttcgagagcggc----tgctggg
O02703_BAX-02       ttgatcaggaccatcatgggctggacattggacttccttcgagagcggc----tgctggg
O02703_BAX-03       ttgatcaggaccatcatgggctggacattggacttccttcgagagcggc----tgctggg
                     **        * ** * * *         **     * **       *    **     

A6H6W7_BOK-01       c---------------tggctgcggaggcgtggtggatggacggacgtgct---------
Q05KI7_BAK1-01      tcgctccatcgcccggtggatcgcgcagaggggtggctgggtggcagccct---------
O02703_BAX-01       c---------------tggatccaggaccagggtggttg---------------------
O02703_BAX-02       c---------------tggatccaggaccagggtggttgggtgagacctctaaccccacc
O02703_BAX-03       c---------------tggatccaggaccagggtggttgggtgagacctctaaccccacc
                                    *** *   *      ***** **                     

A6H6W7_BOK-01       ------------------------------------------------------------
Q05KI7_BAK1-01      ---------------------ggacttggg------------------------------
O02703_BAX-01       ------------------------------------------------------------
O02703_BAX-02       ccattcccccactcctctggggcccttgggcctttctgtgcccaccataggagtgccccc
O02703_BAX-03       ccattcccccactcctctggggcccttgggcctttctgtgcccaccataggagtgccccc
                                                                                

A6H6W7_BOK-01       ------------------------------------------------------------
Q05KI7_BAK1-01      ------------------------------------------------------------
O02703_BAX-01       ------------------------------------------------------------
O02703_BAX-02       ttccccattttggggtcatatgtctgatcaacccctgattcacagggtgcccaatgacct
O02703_BAX-03       ttccccattttggggtcatatgtctgatcaacccctgattcacagggtgcccaatgacct
                                                                                

A6H6W7_BOK-01       ------------------------------------------------------------
Q05KI7_BAK1-01      ------------------------------------------------------------
O02703_BAX-01       ------------------------------------------------------------
O02703_BAX-02       gtccatgacccttgacctccttgtgacctctgacctcctagtgacccctgacccgatgcc
O02703_BAX-03       gtccatgacccttgacctccttgtgacctctgacctcctagtgacccctgacccgatgcc
                                                                                

A6H6W7_BOK-01       ------------------------------------------------------------
Q05KI7_BAK1-01      ------------------------------------------------------------
O02703_BAX-01       ------------------------------------------------------------
O02703_BAX-02       tcgatgccctccctggtgcctccctccaattcctctggaatccctcaagttctatgataa
O02703_BAX-03       tcgatgccctccctggtgcctccctccaattcctctggaatccctcaagttctatgataa
                                                                                

A6H6W7_BOK-01       ------------------------------------------------------------
Q05KI7_BAK1-01      ------------------------------------------------------------
O02703_BAX-01       ------------------------------------------------------------
O02703_BAX-02       tcctttaacttccccactcgtaggcccttgcccctacttgtgccctctgacccctccctg
O02703_BAX-03       tcctttaacttccccactcgtaggcccttgcccctacttgtgccctctgacccctccctg
                                                                                

A6H6W7_BOK-01       ------------------------------------------------------------
Q05KI7_BAK1-01      ------------------------------------------------------------
O02703_BAX-01       ------------------------------------------------------------
O02703_BAX-02       ctccctcatgtgctggcccaggggctgccccttggctgagtcgctgaagtgcctgctgtc
O02703_BAX-03       ctccctcatgtgctggcccaggggctgccccttggctgagtcgctgaagtgcctgctgtc
                                                                                

A6H6W7_BOK-01       -------caagtgcgtggtcagcaccgacccgggcctgcgctcgcactggctggtggccg
Q05KI7_BAK1-01      ----------gaacggccccatc------------------------aagagcgtagcca
O02703_BAX-01       ----------ggacggcctcctctcctactttgggacacccacatggcagacagtgacca
O02703_BAX-02       cctatccccaggacggcctcctctcctactttgggacacccacatggcagacagtgacca
O02703_BAX-03       cctatccccaggacggcctcctctcctactttgggacacccacatggcagacagtgacca
                              *  **    *  *                          *   **  ** 

A6H6W7_BOK-01       cgctctgcagctttggccgcttcctgaaggcagccttcttcatgctgttgccggagag--
Q05KI7_BAK1-01      t-cgttctggctgtgg--------ttttgttgggccagtttgtggt----acgaagat--
O02703_BAX-01       t-ctttgtggctggag--------tgctcaccgcctcgctcaccatctggaagaagatgg
O02703_BAX-02       t-ctttgtggctggag--------tgctcaccgcctcgctcaccatctggaagaagatgg
O02703_BAX-03       t-ctttgtggctggag--------tgctcaccgcctcgctcaccatctggaagaagatgg
                      *  *   ***   *        *       * *    *     *      * ***   

A6H6W7_BOK-01       ------------------------------------------------------------
Q05KI7_BAK1-01      ------------------------------------------------------------
O02703_BAX-01       gctga-------------------------------------------------------
O02703_BAX-02       gctgaggccatcaactgccttggactttttctgcataaattatggcatttttcagggggg
O02703_BAX-03       gctgaggccatcaactgccttggactttttctgcataaattatggcatttttcagggggg
                                                                                

A6H6W7_BOK-01       ---------------------------------------atga
Q05KI7_BAK1-01      -----------------------------tcttcaagtcatga
O02703_BAX-01       -------------------------------------------
O02703_BAX-02       tggggcggatttgggggccatggagtttttcttacttttttaa
O02703_BAX-03       tggggcggatttgggggccatggagtttttcttacttttttaa
                                                               

© 1998-2019