Dataset for CDS BAX-like of Organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O02703_BAX-01       atggacg-ggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcat
A6H6W7_BOK-01       atggaggtgctgcggcgc---tcctcg-------------gtcttcgccgccgagatcat
Q05KI7_BAK1-01      atg-----gcttccggacaaggcccag-------------gtccccccgggcaggactgc
                    ***     * * * *       **  *               *  * * *    **    

O02703_BAX-01       -gaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggg
A6H6W7_BOK-01       ggacgcctttgaccgctcgcccac-------cgacaaggagctggtggcccaggcca---
Q05KI7_BAK1-01      -gacgagcctgacccctcctccac-------ctcggaggagcaggtggcccgggacaccg
                     ** *     * **  *   *  *       *    **** *  *  *  *         

O02703_BAX-01       gagagacacccga-------------------------------gctgggct----tgga
A6H6W7_BOK-01       ---aggctctcggccgcgagttcgtgcacgcgcgactgctgcgcgctggcctctcctgga
Q05KI7_BAK1-01      aggaggtcttccgcagctacgtctttta-----------------ccgccatcagcagga
                       **     *                                  * *   *     ***

O02703_BAX-01       gcaggtgccccaggatgca---------tccaccaa---------gaagctgagcg-agt
A6H6W7_BOK-01       gc--gcgcccgagcgcgccgcgccggtccccggcggccgcctggcggaggtgtgcgccgt
Q05KI7_BAK1-01      acaggaggccgagggggcggctgcg---cctactgacc------cagagatggtcacctt
                     *  * * ** **   **           *                 ** **  *    *

O02703_BAX-01       gtctgaagcgcatcggagatgaattgga---------------------cagtaacatgg
A6H6W7_BOK-01       gc-tgctgcgcctggcggacgagctggagctgatccggcccagtgtctaccgcaacgtgg
Q05KI7_BAK1-01      gcacccagaacctagcag-caccatggggcag------------------------gtgg
                    *      *  * * *  *      ***                              ***

O02703_BAX-01       agctgcagagga-----tgatcgcagctgtggac---acagactctccccgagaggtctt
A6H6W7_BOK-01       cccgccagctgaacctctccctgcagtcggagaccgtggtgaccgacgcc----------
Q05KI7_BAK1-01      gccgccag--------ctcgccgtcatcggggacgacatcaaccggcgctacgatgcgga
                      *  ***         *    *     *  ***       **   * *           

O02703_BAX-01       tttccgag---tg-----------gcggctgaaatgttttctgacggcaact--------
A6H6W7_BOK-01       -ttcctggctgtg-----------gcgacccagatcttttctgcaggcatcacgtgggg-
Q05KI7_BAK1-01      gttccaggccatgctgcagcacctgcagccaa--------cagcagacaacgcctatgag
                     ****  *   **           **  *  *        * *  * ** *         

O02703_BAX-01       ----------------------------------------tcaactggggccgggttgtc
A6H6W7_BOK-01       --------caaagttgtgtcc--------------ctgtact--ccgtggccgcggg---
Q05KI7_BAK1-01      tacttcaccaagatcgcgtccagcctgtttgagagcggtatcaactggggccgcgtggtg
                                                                * * ***** *     

O02703_BAX-01       gcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgag
A6H6W7_BOK-01       -----gctggccgtggactgt------gtgcggcaggcccagcccgccctggtgcacgcc
Q05KI7_BAK1-01      gctctgctgggctttggctac---------cgcctggccctccacgtctaccagcgcggc
                           *   * * * *            *    *****    *  *     ** **  

O02703_BAX-01       ttgatcaggaccatcatgggctggacattggacttccttcgagagcggc----tgctg--
A6H6W7_BOK-01       ctcgtc--gactgtc-----tcggggagtt-------tgtgcggaagac-----gctg--
Q05KI7_BAK1-01      ctgacc--ggcttcc-----tgggccaggtgacccgcttcgtggccgacttcatgctgcg
                     *   *  * *   *       **  *          *  * *   * *     ****  

O02703_BAX-01       ----------ggctgga------tccaggaccagggtggttgggacggcctcctctccta
A6H6W7_BOK-01       -------gcaacctggc------tgcggaggcgtggtggatggacggacgtgct---caa
Q05KI7_BAK1-01      tcgctccatcgcccggtggatcgcgcagagg---ggtggctgggtggcagccct---gga
                                * **         * *      ***** ***   *     **     *

O02703_BAX-01       ctttgggacacccacatggcagacagtgaccatctttgtggctggagtgctca-----cc
A6H6W7_BOK-01       gtgcgtggtcagcaccgacccgggcct-gcgctcgcactggctggtggccgcgctctgca
Q05KI7_BAK1-01      cttggggaacggccccatcaagagcgtagccatcgttctggct-gtggttttg-------
                     *  * *     * *      *    *  *  **    ***** * *             

O02703_BAX-01       gcctcgctcaccatctggaagaaga--------------------tgggctga
A6H6W7_BOK-01       gctttggccgcttcctgaaggcagccttcttcatgctgttgccggagagatga
Q05KI7_BAK1-01      --ttgggccagtttgtggtacgaagattcttca------------agtcatga
                       * *  *      **     *                       *   ***

© 1998-2018