Dataset for CDS BAX of Organism Bos taurus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O02703_BAX-01      atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatg
O02703_BAX-02      atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatg
O02703_BAX-03      ---------------------------------------------------------atg
                                                                            ***

O02703_BAX-01      aagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatgggggga
O02703_BAX-02      aagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatgggggga
O02703_BAX-03      aagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatgggggga
                   ************************************************************

O02703_BAX-01      gagacacccgagctgggcttggagcaggtgccccaggatgcatccaccaagaagctgagc
O02703_BAX-02      gagacacccgagctgggcttggagcaggtgccccaggatgcatccaccaagaagctgagc
O02703_BAX-03      gagacacccgagctgggcttggagcaggtgccccaggatgcatccaccaagaagctgagc
                   ************************************************************

O02703_BAX-01      gagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
O02703_BAX-02      gagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
O02703_BAX-03      gagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
                   ************************************************************

O02703_BAX-01      gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
O02703_BAX-02      gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
O02703_BAX-03      gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttt
                   ************************************************************

O02703_BAX-01      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
O02703_BAX-02      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
O02703_BAX-03      tctgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaaactg
                   ************************************************************

O02703_BAX-01      gtgctcaaggccctgtgcaccaaggtgcccgagttgatcaggaccatcatgggctggaca
O02703_BAX-02      gtgctcaaggccctgtgcaccaaggtgcccgagttgatcaggaccatcatgggctggaca
O02703_BAX-03      gtgctcaaggccctgtgcaccaaggtgcccgagttgatcaggaccatcatgggctggaca
                   ************************************************************

O02703_BAX-01      ttggacttccttcgagagcggctgctgggctggatccaggaccagggtggttg-------
O02703_BAX-02      ttggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggtgaga
O02703_BAX-03      ttggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggtgaga
                   *****************************************************       

O02703_BAX-01      ------------------------------------------------------------
O02703_BAX-02      cctctaaccccaccccattcccccactcctctggggcccttgggcctttctgtgcccacc
O02703_BAX-03      cctctaaccccaccccattcccccactcctctggggcccttgggcctttctgtgcccacc
                                                                               

O02703_BAX-01      ------------------------------------------------------------
O02703_BAX-02      ataggagtgcccccttccccattttggggtcatatgtctgatcaacccctgattcacagg
O02703_BAX-03      ataggagtgcccccttccccattttggggtcatatgtctgatcaacccctgattcacagg
                                                                               

O02703_BAX-01      ------------------------------------------------------------
O02703_BAX-02      gtgcccaatgacctgtccatgacccttgacctccttgtgacctctgacctcctagtgacc
O02703_BAX-03      gtgcccaatgacctgtccatgacccttgacctccttgtgacctctgacctcctagtgacc
                                                                               

O02703_BAX-01      ------------------------------------------------------------
O02703_BAX-02      cctgacccgatgcctcgatgccctccctggtgcctccctccaattcctctggaatccctc
O02703_BAX-03      cctgacccgatgcctcgatgccctccctggtgcctccctccaattcctctggaatccctc
                                                                               

O02703_BAX-01      ------------------------------------------------------------
O02703_BAX-02      aagttctatgataatcctttaacttccccactcgtaggcccttgcccctacttgtgccct
O02703_BAX-03      aagttctatgataatcctttaacttccccactcgtaggcccttgcccctacttgtgccct
                                                                               

O02703_BAX-01      ------------------------------------------------------------
O02703_BAX-02      ctgacccctccctgctccctcatgtgctggcccaggggctgccccttggctgagtcgctg
O02703_BAX-03      ctgacccctccctgctccctcatgtgctggcccaggggctgccccttggctgagtcgctg
                                                                               

O02703_BAX-01      ------------------------ggacggcctcctctcctactttgggacacccacatg
O02703_BAX-02      aagtgcctgctgtccctatccccaggacggcctcctctcctactttgggacacccacatg
O02703_BAX-03      aagtgcctgctgtccctatccccaggacggcctcctctcctactttgggacacccacatg
                                           ************************************

O02703_BAX-01      gcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccatctggaagaa
O02703_BAX-02      gcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccatctggaagaa
O02703_BAX-03      gcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccatctggaagaa
                   ************************************************************

O02703_BAX-01      gatgggctga--------------------------------------------------
O02703_BAX-02      gatgggctgaggccatcaactgccttggactttttctgcataaattatggcatttttcag
O02703_BAX-03      gatgggctgaggccatcaactgccttggactttttctgcataaattatggcatttttcag
                   **********                                                  

O02703_BAX-01      ------------------------------------------------
O02703_BAX-02      gggggtggggcggatttgggggccatggagtttttcttacttttttaa
O02703_BAX-03      gggggtggggcggatttgggggccatggagtttttcttacttttttaa
                                                                   

© 1998-2019