Dataset for CDS BOK of Organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5KA26_BOK-01      atgaagggcatggaggttctgcgtcgttcctcagtgtttgcagcagaagta---------
W5KF74_BOK-01      ------------------------------------------------------------
W5KF74_BOK-02      aggaa-----------------------------tttttttgctagaagtgagaacctca
                                                                               

W5KA26_BOK-01      -----------atggaagtgtttgagcgctctcccactgataaggaactcgtctcccagt
W5KF74_BOK-01      -----------atggatttgatggatcgaggcccgagtgagaaggagctggttttccagt
W5KF74_BOK-02      agatcctgaagatggatttgatggatcgaggcccgagtgagaaggagctggttttccagt
                              *****  ** * ** **    ** * *** ***** ** ** * *****

W5KA26_BOK-01      ccaaagttctgtgcagagactacatccactccaggctgaaccgggccggaatcggctggt
W5KF74_BOK-01      ctaagatactgtgcagagacttcatttactccaggatcaccagagaaggtctcaactggt
W5KF74_BOK-02      ctaagatactgtgcagagacttcatttactccaggatcaccagagaaggtctcaactggt
                   * **  * ************* ***  ******** * * * * *  **  **  *****

W5KA26_BOK-01      ccaaagctga----ccacgggctgt-----ctgcaggcgggtcgctgggggaggtgtcat
W5KF74_BOK-01      ccaaagttgaatcgtccctgcctgtaccagttccagacggagctcttggagatgtctcca
W5KF74_BOK-02      ccaaagttgaatcgtccctgcctgtaccagttccagacggagctcttggagatgtctcca
                   ****** ***     * * * ****      * *** ***  * ** ** ** ** **  

W5KA26_BOK-01      cagtgcttctatggttaggtgacgagctagaatacctgcgtccgaatgtgtaccgcaacg
W5KF74_BOK-01      tggtgcttctaaagcttggtgatgagctggagtacatgcggccgtatatctacaggaacg
W5KF74_BOK-02      tggtgcttctaaagcttggtgatgagctggagtacatgcggccgtatatctacaggaacg
                     *********  * * ***** ***** ** *** **** *** ** * *** * ****

W5KA26_BOK-01      tggcgcgccaactcaacattacggtggcatcagagagtgtggtgtctgatgccttcctgg
W5KF74_BOK-01      tggcgaagcagctcagtatatcggtgtctgtggagagcgtggtgtcggacgcttttctct
W5KF74_BOK-02      tggcgaagcagctcagtatatcggtgtctgtggagagcgtggtgtcggacgcttttctct
                   *****   ** ****  **  ***** *    ***** ******** ** ** ** **  

W5KA26_BOK-01      cagtggcagcagaaatattctccacaggagtgacgtggggtaaggtggtctctctgtacg
W5KF74_BOK-01      ctgtggcgacggagatcctctccctggggatcacgtggggaaaggtggtggccatctttg
W5KF74_BOK-02      ctgtggcgacggagatcctctccctggggatcacgtggggaaaggtggtggccatctttg
                   * *****  * ** **  *****   **  * ******** ********  *  * *  *

W5KA26_BOK-01      ccgtagccggagctctggcggtagattgtgtccgacacggtcaccccgccatggtacata
W5KF74_BOK-01      cagtagctgggggtctggcggtggactgtgtccggcagggtcatccagccatgatactca
W5KF74_BOK-02      cagtagctgggggtctggcggtggactgtgtccggcagggtcatccagccatgatactca
                   * ***** ** * ********* ** ******** ** ***** ** ****** ***  *

W5KA26_BOK-01      ctattgtagactgcatgggcgagtttgtccgcaagagcctggtgtcctggttaaagagac
W5KF74_BOK-01      ctatagtggacagcctgggggagttcgtccggaagagcctggtgccctggctgaagagga
W5KF74_BOK-02      ctatagtggacagcctgggggagttcgtccggaagagcctggtgccctggctgaagagga
                   **** ** *** ** **** ***** ***** ************ ***** * *****  

W5KA26_BOK-01      gaggaggctggactgatatcaccaaatgcgttgtcaacacggacccca-gcttccgttct
W5KF74_BOK-01      gaggaggctggggagacatttcaaagtgtgtgacgagcgtggacactacacctccg-tcc
W5KF74_BOK-02      gaggaggctggggagacatttcaaagtgtgtgacgagcgtggacactacacctccg-tcc
                   ***********   ** **  * ** ** **    * *  **** * *  * **** ** 

W5KA26_BOK-01      cactggctggtggcggcggcctgcacctgcgtgcactacctgaaggccgtggtgttctat
W5KF74_BOK-01      cattggatgtctgcagtagtatcaacctggaggcacgttgtgaagaccatgtacatctac
W5KF74_BOK-02      cattggatgtctgcagtagtatcaacctggaggcacgttgtgaagaccatgtacatctac
                   ** *** **   ** *  *  *  *****   ****    ***** ** **    **** 

W5KA26_BOK-01      ctgctgagagagaagtga
W5KF74_BOK-01      ctgat------gaagtaa
W5KF74_BOK-02      ctgat------gaagtaa
                   *** *      ***** *

© 1998-2018