Dataset for CDS BOK of Organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B1IPM7_BOK-01      atgaagggcatggaggttctgcgtcgttcctcagtgtttgcagcagaagt
W5KF74_BOK-01          --------------------------------------------------
                                                                         

A0A3B1IPM7_BOK-01      aatggaagtgtttgagcgctctcccactgataaggaactcgtctcccagt
W5KF74_BOK-01          -atggatttgatggatcgaggcccgagtgagaaggagctggttttccagt
                        *****  ** * ** **    ** * *** ***** ** ** * *****

A0A3B1IPM7_BOK-01      ccaaagttctgtgcagagactacatccactccaggctgaaccgggccgga
W5KF74_BOK-01          ctaagatactgtgcagagacttcatttactccaggatcaccagagaaggt
                       * **  * ************* ***  ******** * * * * *  ** 

A0A3B1IPM7_BOK-01      atcggctggtccaaagctga----ccacgggctgt-----ctgcaggcgg
W5KF74_BOK-01          ctcaactggtccaaagttgaatcgtccctgcctgtaccagttccagacgg
                        **  *********** ***     * * * ****      * *** ***

A0A3B1IPM7_BOK-01      gtcgctgggggaggtgtcatcagtgcttctatggttaggtgacgagctag
W5KF74_BOK-01          agctcttggagatgtctccatggtgcttctaaagcttggtgatgagctgg
                         * ** ** ** ** **    *********  * * ***** ***** *

A0A3B1IPM7_BOK-01      aatacctgcgtccgaatgtgtaccgcaacgtggcgcgccaactcaacatt
W5KF74_BOK-01          agtacatgcggccgtatatctacaggaacgtggcgaagcagctcagtata
                       * *** **** *** ** * *** * *********   ** ****  ** 

A0A3B1IPM7_BOK-01      acggtggcatcagagagtgtggtgtctgatgccttcctggcagtggcagc
W5KF74_BOK-01          tcggtgtctgtggagagcgtggtgtcggacgcttttctctctgtggcgac
                        ***** *    ***** ******** ** ** ** **  * *****  *

A0A3B1IPM7_BOK-01      agaaatattctccacaggagtgacgtggggtaaggtggtctctctgtacg
W5KF74_BOK-01          ggagatcctctccctggggatcacgtgggggaaggtggtggccatctttg
                        ** **  *****   **  * ******** ********  *  * *  *

A0A3B1IPM7_BOK-01      ccgtagcc-ggagctctggcggtagattgtgtccgacacggtcaccccgc
W5KF74_BOK-01          cagtagctggggggtctggcggtggactgtgtccggcagggtcatccagc
                       * *****  ** * ********* ** ******** ** ***** ** **

A0A3B1IPM7_BOK-01      catggtacatactattgtagactgcatgggcgagtttgtccgcaagagcc
W5KF74_BOK-01          catgatactcactatagtggacagcctgggggagttcgtccggaagagcc
                       **** ***  ***** ** *** ** **** ***** ***** *******

A0A3B1IPM7_BOK-01      tggtgtcctggttaaagagacgaggaggctggactgatatcaccaaatgc
W5KF74_BOK-01          tggtgccctggctgaagaggagaggaggctggggagacatttcaaagtgt
                       ***** ***** * *****  ***********   ** **  * ** ** 

A0A3B1IPM7_BOK-01      gttgtcaacacggacccca-gcttccgttctcactggctggtggcggcgg
W5KF74_BOK-01          gtgacgagcgtggacactacacctccg-tcccattggatgtctgcagtag
                       **    * *  **** * *  * **** ** ** *** **   ** *  *

A0A3B1IPM7_BOK-01      cctgcacctgcgtgcactacctgaaggccgtggtgttctatctgctgaga
W5KF74_BOK-01          tatcaacctggaggcacgttgtgaagaccatgtatatctacctgatgaag
                         *  *****   ****    ***** ** **    **** *** ***  

A0A3B1IPM7_BOK-01      -------------------------------------------------g
W5KF74_BOK-01          taactgtggaagcagtagctgttaatacggctccaggactggaattactg
                                                                        *

A0A3B1IPM7_BOK-01      agaag-------------------------------tga
W5KF74_BOK-01          ggaagtctcagactgctcatgatctcagagctttactaa
                        ****                               * *

© 1998-2019