Dataset for CDS BAX-like of Organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B1IPM7_BOK-01      atgaagggcatggaggttctgcgtcgttcctcagtgtttgcagcagaagt
W5KF74_BOK-01          --------------------------------------------------
W5KJ43_BAX-01          atg---g-----------------cagattccggagacagcggagggaat
W5KJ43_BAX-02          atg---g-----------------cagattccggagacagcggagggaat
A0A3B1JGN3_BAX-01      atg---g-----------------ca--------gctcag-ggagaaggt
W5KCK0_BAX-01          atgtttg-----------------tatgttctgtgttcaa-aggcaacgg
                                                                         

A0A3B1IPM7_BOK-01      aatg-----gaagtgtttgagc---gctctcccactgataaggaactcgt
W5KF74_BOK-01          -atg-----gatttgatggatc---gaggcccgagtgagaaggagctggt
W5KJ43_BAX-01          gaggacagtgagctgtta------ggagctacaggtggagaagatgttgt
W5KJ43_BAX-02          gaggacagtgagctgtta------ggagctacaggtggagaagatgttgt
A0A3B1JGN3_BAX-01      tatgctgttaatctgctacgcataggatataggctactgataaactttat
W5KCK0_BAX-01          ta--atgaacaactgttagacctgggagcttccctgctaaaagattttat
                        *        *  ** *        *                 *  *  *

A0A3B1IPM7_BOK-01      ctcccagtccaaagt----------------tctgtgcagagactacatc
W5KF74_BOK-01          tttccagtctaagat----------------actgtgcagagacttcatt
W5KJ43_BAX-01          agacgacc---aaatcgtagaacaaggcgcattagtactgagagggtat-
W5KJ43_BAX-02          agacgacc---aaatcgtagaacaaggcgcattagtactgagagggtat-
A0A3B1JGN3_BAX-01      ctctgagc---gtct----------------tcagcgcacattggaaatt
W5KCK0_BAX-01          ctaccaac---gggt----------------tcagcgtcatggggacagc
                            *        *                   *            *  

A0A3B1IPM7_BOK-01      cactccaggctga------accgggccgg--------------aatcggc
W5KF74_BOK-01          tactccaggatca------ccagagaagg--------------tctcaac
W5KJ43_BAX-01          -gttcttcggcggctcagtacagagaaccctgatgtacgtgtgagtcggg
W5KJ43_BAX-02          -gttcttcggcggctcagtacagagaaccctgatgtacgtgtgagtcggg
A0A3B1JGN3_BAX-01      gatgctgcagta-------accaaaaacc--------------tgttgga
W5KCK0_BAX-01          aatgctttggtg-------acaaggaacc--------------agttggg
                           *               *                        *    

A0A3B1IPM7_BOK-01      tggtccaaagctga----ccacgggctgt-----ctgcaggcgggtcgct
W5KF74_BOK-01          tggtccaaagttgaatcgtccctgcctgtaccagttccagacggagctct
W5KJ43_BAX-01          tggaccttggtggaa-------gacctgatgaaggcgatgaccctcagat
W5KJ43_BAX-02          tggaccttggtggaa-------gacctgatgaaggcgatgaccctcagat
A0A3B1JGN3_BAX-01      cga-----gacggaa-------gaggtgc--------ctgatcccaacat
W5KCK0_BAX-01          cgg-----gac---a-------gagttgt--------gtgacccgagcca
                        *                        **           *          

A0A3B1IPM7_BOK-01      gggggaggtgtcatcagtgcttctatggttaggtgacgagctagaatacc
W5KF74_BOK-01          tggagatgtctccatggtgcttctaaagcttggtgatgagctggagtaca
W5KJ43_BAX-01          aaaagtggttgtggagcagcttcttagaattgctgatgatctga------
W5KJ43_BAX-02          aaaagtggttgtggagcagcttcttagaattgctgatgatctga------
A0A3B1JGN3_BAX-01      taagaaagttggacagcgtctacagcagtttggagatgaactgg------
W5KCK0_BAX-01          taagagacttgcgcagtgtcttcagcagattggagacgagttag------
                               *          ** *      * *  ** **  *        

A0A3B1IPM7_BOK-01      tgcgtccgaatgtgtaccgcaacgtggcgcgccaac------tcaacatt
W5KF74_BOK-01          tgcggccgtatatctacaggaacgtggcgaagcagc------tcagtata
W5KJ43_BAX-01          ---------------atcgcaatactgagcttcaacacctcatcagcact
W5KJ43_BAX-02          ---------------atcgcaatactgagcttcaacacctcatcagcact
A0A3B1JGN3_BAX-01      ---------------acaatgacacaaaattgaaagagatgattaataac
W5KCK0_BAX-01          ---------------acagcaatgtacagctgcagagtatgataaatgac
                                      *     *           *        * *     

A0A3B1IPM7_BOK-01      acggtggcatcagagagtgtggtgtctgatgccttcctggcagtggcagc
W5KF74_BOK-01          tcggtgtctgtggagagcgtggtgtcggacgcttttctctctgtggcgac
W5KJ43_BAX-01          ------gtgcaggctaactgtgctcaggatgtgtttatgacggtggccag
W5KJ43_BAX-02          ------gtgcaggctaactgtgctcaggatgtgtttatgacggtggccag
A0A3B1JGN3_BAX-01      ------ctaatgccca------caaaagaagtgttcctgaaaatcgccta
W5KCK0_BAX-01          tcggcgctacagccca------cccaagacgtgtttgtgaaagtggcttg
                                      *           ** *  **  *     * **   

A0A3B1IPM7_BOK-01      agaaatattctccacaggag---tgacgtggggtaaggtggtctctctgt
W5KF74_BOK-01          ggagatcctctccctgggga---tcacgtgggggaaggtggtggccatct
W5KJ43_BAX-01          gacgatcttcacagatggca---ttaactggggacgaatcgtggctctgt
W5KJ43_BAX-02          gacgatcttcacagatggca---ttaactggggacgaatcgtggctctgt
A0A3B1JGN3_BAX-01      tgaaatcttctctgactggaagtttaactggggcagggtggtggcactgt
W5KCK0_BAX-01          tgaaatcttctctgatgggaagtttaactggggcagggtggtggcgcttt
                           **  ** *     *     * *  *****     * **  *  * *

A0A3B1IPM7_BOK-01      acgccgtagcc-ggagctctggcggta-gattgtgtccgacacggtcacc
W5KF74_BOK-01          ttgcagtagctggggggtctggcggtg-gactgtgtccggcagggtcatc
W5KJ43_BAX-01          ttcatctggcctatcagcttatttataatgcactgactca--aaaccact
W5KJ43_BAX-02          ttcatctggcctatcagcttatttataatactttgagagaggaaactata
A0A3B1JGN3_BAX-01      tctactttgcttgtgagtttgtcaagatgg---------------ttcct
W5KCK0_BAX-01          tctattttgcttgtcgactcgtcatcaaggctgtgctgactaagcttcct
                             * **                                        

A0A3B1IPM7_BOK-01      ccg--ccatggtacatact------attgtagactgcatgggcgagtttg
W5KF74_BOK-01          cag--ccatgatactcact------atagtggacagcctgggggagttcg
W5KJ43_BAX-01          tag--aaatcatcaagaac------atcattagctgggtattacagtata
W5KJ43_BAX-02          atgtcaaatcaacaaacgctttcaaatcttcctcggg-------------
A0A3B1JGN3_BAX-01      g----atatcatcagtaac------atcatcagctggactctagaattca
W5KCK0_BAX-01          g----acatcatcagaacc------atcatcaattggaccgtagactacc
                              **                **  *     *              

A0A3B1IPM7_BOK-01      tccgcaagagcctggtgtcctggttaaagagacgaggaggctggactgat
W5KF74_BOK-01          tccggaagagcctggtgccctggctgaagaggagaggaggctggggagac
W5KJ43_BAX-01          tcaggcagcacgtatccgcctggatcagacagcagggaggatgggaaggg
W5KJ43_BAX-02          --agttggtacgtacagctgtggtggagattgtaagtacgactaga----
A0A3B1JGN3_BAX-01      tgcgtgatcatgtgattgcatggatcagtggacagggaggctgggacgca
W5KCK0_BAX-01          tgcgggaacatgtgattaattggatcagggaacagggaggctgggaaggt
                          *        *       ***   *        * * *          

A0A3B1IPM7_BOK-01      atcaccaaatgcgttgtcaacacggacccca-gcttccgttctcactggc
W5KF74_BOK-01          atttcaaagtgtgtgacgagcgtggacactacacctccg-tcccattgga
W5KJ43_BAX-01          gttatccgcagcgtgtcgaga--------tggcgcaccgtgaccgt--ga
W5KJ43_BAX-02          --tttctgttttggttccaaa-------------catcattaac------
A0A3B1JGN3_BAX-01      at--cctctcacagattgaagcaccttcctggacaactgtcactgc--at
W5KCK0_BAX-01          at--ccggtcctactttggaacccctacctggcaaactgttggcgt--ct
                                                                         

A0A3B1IPM7_BOK-01      tggtggcggcggcctgcacctgcgtgcactacctgaaggccgtggtgttc
W5KF74_BOK-01          tgtctgcagtagtatcaacctggaggcacgttgtgaagaccatgtatatc
W5KJ43_BAX-01          tcgctgcagta---gcattc----atcgctgct-----gctgtatactgg
W5KJ43_BAX-02          tccctggggaaaatgctttctatgtttacttct-----gtttttttctga
A0A3B1JGN3_BAX-01      ttgtggctgga----------gttctcactact-----gctctcatcgta
W5KCK0_BAX-01          ttctggctgga----------gtgctcaccact-----gtgctggtcatg
                       *    *  *                   *             *       

A0A3B1IPM7_BOK-01      tatctgctgaga--------------------------------------
W5KF74_BOK-01          tacctgatgaagtaactgtggaagcagtagctgttaatacggctccagga
W5KJ43_BAX-01          aaacgaagtcgc--------------------------------------
W5KJ43_BAX-02          ggctaaa-------------------------------------------
A0A3B1JGN3_BAX-01      aacaaaatg-----------------------------------------
W5KCK0_BAX-01          cgcaaaatg-----------------------------------------
                                                                         

A0A3B1IPM7_BOK-01      -----------gagaag-------------------------------tg
W5KF74_BOK-01          ctggaattactgggaagtctcagactgctcatgatctcagagctttacta
W5KJ43_BAX-01          ------------------------------------------------tg
W5KJ43_BAX-02          ------------------------------------------------tg
A0A3B1JGN3_BAX-01      ------------------------------------------------tg
W5KCK0_BAX-01          ------------------------------------------------tg
                                                                       * 

A0A3B1IPM7_BOK-01      a
W5KF74_BOK-01          a
W5KJ43_BAX-01          a
W5KJ43_BAX-02          a
A0A3B1JGN3_BAX-01      a
W5KCK0_BAX-01          a
                       *

© 1998-2019