Dataset for CDS BAX-like of Organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5KA26_BOK-01      ----------atgaagggcatggaggttctgcgtcgttcctcagtgtttgcagcagaagt
W5KF74_BOK-01      ------------------------------------------------------------
W5KF74_BOK-02      ----------aggaa-----------------------------tttttttgctagaagt
W5KJ41_BAX-02      atggcagattccggagacagcggggggaatgagg--------------------------
W5KJ41_BAX-01      atggcagattccggagacagcggggggaatgagg--------------------------
W5KCK0_BAX-01      tttttaaatcaccaaggaagtggaggatcaacgt--------------------------
W5KCL0_BAX-01      ------------------------------------------------------------
                                                                               

W5KA26_BOK-01      a--------------------atggaagtgtttgagcgctctcccactgataaggaac--
W5KF74_BOK-01      ---------------------atggatttgatggatcgaggcccgagtgagaaggagc--
W5KF74_BOK-02      gagaacctcaagatcctgaagatggatttgatggatcgaggcccgagtgagaaggagc--
W5KJ41_BAX-02      ---------------------acagtgagctgttaggagctacaggtggagaagatgttg
W5KJ41_BAX-01      ---------------------acagtgagctgttaggagctacaggtggagaagatgttg
W5KCK0_BAX-01      ---------------------acag-aagtgttaatctgctacgcataggatataggc--
W5KCL0_BAX-01      ------------------------------------------------------------
                                                                               

W5KA26_BOK-01      ------------tcgtctcccagtccaaagttctgtgcagagactacatccactccaggc
W5KF74_BOK-01      ------------tggttttccagtctaagatactgtgcagagacttcatttactccagga
W5KF74_BOK-02      ------------tggttttccagtctaagatactgtgcagagacttcatttactccagga
W5KJ41_BAX-02      tagacgaccaaatcgtagaacaaggcgcaatagtactgagagggtatgttcttcggcggc
W5KJ41_BAX-01      tagacgaccaaatcgtagaacaaggcgcaatagtactgagagggtatgttcttcggcggc
W5KCK0_BAX-01      ---------------------------------tactgataaactttatctctgagcgtc
W5KCL0_BAX-01      ------------------------------------------------------------
                                                                               

W5KA26_BOK-01      tgaaccgggccggaatcg---gctggtccaaagctga----ccacgggctgt-----ctg
W5KF74_BOK-01      tcaccagagaaggtctca---actggtccaaagttgaatcgtccctgcctgtaccagttc
W5KF74_BOK-02      tcaccagagaaggtctca---actggtccaaagttgaatcgtccctgcctgtaccagttc
W5KJ41_BAX-02      tcagtacagagaaccctg---atgtacgtgtgagttgggtggaccttggtggaagacctg
W5KJ41_BAX-01      tcagtacagagaaccctg---atgtacgtgtgagttgggtggaccttggtggaagacctg
W5KCK0_BAX-01      tt----cagcgcacattggaaattgatgctgcagtaaccaaaaacctgttggacgagacg
W5KCL0_BAX-01      ------------------------------------------------------------
                                                                               

W5KA26_BOK-01      caggcgggtcgc----------tgggggaggtgtcatcagtgcttctatggttaggtgac
W5KF74_BOK-01      cagacggagctc----------ttggagatgtctccatggtgcttctaaagcttggtgat
W5KF74_BOK-02      cagacggagctc----------ttggagatgtctccatggtgcttctaaagcttggtgat
W5KJ41_BAX-02      atgaaggcg-atgaccctcaaataaaagtggttgtggagcagcttcttagaattgctgat
W5KJ41_BAX-01      atgaaggcg-atgaccctcaaataaaagtggttgtggagcagcttcttagaattgctgat
W5KCK0_BAX-01      gaagaggtgcctgatcccaacattaagaaagttggacagcgtctacagcagtttggagat
W5KCL0_BAX-01      ------------------------------------------------------------
                                                                               

W5KA26_BOK-01      gagctagaatacc------tgcgtccgaatgtgtaccgcaacgtggcgcgccaactcaac
W5KF74_BOK-01      gagctggagtaca------tgcggccgtatatctacaggaacgtggcgaagcagctcagt
W5KF74_BOK-02      gagctggagtaca------tgcggccgtatatctacaggaacgtggcgaagcagctcagt
W5KJ41_BAX-02      gatctgaatcgcaatactgagcttcaacacctcatcagcact------gtgcaggctaac
W5KJ41_BAX-01      gatctgaatcgcaatactgagcttcaacacctcatcagcact------gtgcaggctaac
W5KCK0_BAX-01      gaactggacaatgacacagaattgaaaaatatgataaatgactcggcgctacagccca--
W5KCL0_BAX-01      ------------------------------atgattaataac------ctaatgccca--
                                                  *                         *  

W5KA26_BOK-01      attacggtggcatcagagagtgtggtgtctgatgccttcctggcagtggcagcagaaata
W5KF74_BOK-01      atatcggtgtctgtggagagcgtggtgtcggacgcttttctctctgtggcgacggagatc
W5KF74_BOK-02      atatcggtgtctgtggagagcgtggtgtcggacgcttttctctctgtggcgacggagatc
W5KJ41_BAX-02      tgtgctcag---------------------gatgtgttcatgacggtggccaggacgatc
W5KJ41_BAX-01      tgtgctcag---------------------gatgtgttcatgacggtggccaggacgatc
W5KCK0_BAX-01      ----cccaa---------------------gacgtgtttgtgaaagtggcttgtgaaatc
W5KCL0_BAX-01      ----caaaa---------------------gaagtgttcctgaaaatcgcctatgaaatc
                       *                         ** *  **  *     * **       ** 

W5KA26_BOK-01      ttctccacaggag---tgacgtggggtaaggtggtctctctgtacgccgtagccggagct
W5KF74_BOK-01      ctctccctgggga---tcacgtggggaaaggtggtggccatctttgcagtagctgggggt
W5KF74_BOK-02      ctctccctgggga---tcacgtggggaaaggtggtggccatctttgcagtagctgggggt
W5KJ41_BAX-02      ttcacagatggca---ttaactggggacgaatcgtggctctgtttcatctggcctatcag
W5KJ41_BAX-01      ttcacagatggca---ttaactggggacgaatcgtggctctgtttcatctggcctatcag
W5KCK0_BAX-01      ttctctgatgggaagtttaactggggcagggtggtggcgcttttctattttgcttgtcga
W5KCL0_BAX-01      ttctctgactggaagtttaactggggcagggtggtggcactgttctactttgcttgtgag
                    ** *     *     * *  *****     * **  *  * *      * **       

W5KA26_BOK-01      ctggcggtagat---------------------------------tgtgtccgacacggt
W5KF74_BOK-01      ctggcggtggac---------------------------------tgtgtccggcagggt
W5KF74_BOK-02      ctggcggtggac---------------------------------tgtgtccggcagggt
W5KJ41_BAX-02      cttatttataat---------------------------------gcactgactcaaaac
W5KJ41_BAX-01      cttatttataatatcccagagaagttgagaccatttctgaacatggcactgactcaaaac
W5KCK0_BAX-01      ctcgtcatcaag---------------------------------gctgtgctgactaag
W5KCL0_BAX-01      tttgtcaagatg---------------------------------g--------------
                    *                                                          

W5KA26_BOK-01      caccccgccatggtacatactattgtagactgcatgggcgagtttgtccgcaagagcctg
W5KF74_BOK-01      catccagccatgatactcactatagtggacagcctgggggagttcgtccggaagagcctg
W5KF74_BOK-02      catccagccatgatactcactatagtggacagcctgggggagttcgtccggaagagcctg
W5KJ41_BAX-02      cacttagaaatcatcaataacatcattagctgggtattacagtatatcaggcagcacgta
W5KJ41_BAX-01      cacttagaaatcatcaataacatcattagctgggtattacagtatatcaggcagcacgta
W5KCK0_BAX-01      cttcctgacatcatcagaaccatcatcaattggaccgtagactacctgcgggaacatgtg
W5KCL0_BAX-01      -ttcctgatatcatcagtaacatcatcagctggactctagaattcatgcgtgatcatgtg
                         *  **  *    *  **  *     *        * *   *  *  *     * 

W5KA26_BOK-01      gtgtcctggttaaagagacgaggaggctggactga---tatcaccaaatgcgttgtcaac
W5KF74_BOK-01      gtgccctggctgaagaggagaggaggctggggaga---catttcaaagtgtgtgacgagc
W5KF74_BOK-02      gtgccctggctgaagaggagaggaggctggggaga---catttcaaagtgtgtgacgagc
W5KJ41_BAX-02      tccgcctggatcagacagcagggaggatgggaaggggttatccgc---------a-gcgt
W5KJ41_BAX-01      tccgcctggatcagacagcagggaggatgggaaggggttatccgc---------a-gcgt
W5KCK0_BAX-01      attaattggatcagggaacagggaggctgggaagg---tatccggtcctactttg-gaac
W5KCL0_BAX-01      attgcatggatcagtggacagggaggctgggacgc---aatcctctcacagattg-aagc
                         *** * *        ***** ***   *     **                   

W5KA26_BOK-01      acggacccca-gcttccgttctcactggctggtggcggcggcctgcacctgcgtgcacta
W5KF74_BOK-01      gtggacactacacctccg-tcccattggatgtctgcagtagtatcaacctggaggcacgt
W5KF74_BOK-02      gtggacactacacctccg-tcccattggatgtctgcagtagtatcaacctggaggcacgt
W5KJ41_BAX-02      gtcgagatgg-cgcaccgtgaccgt--gatcgctgctgtagcattcatcgctgctgctgt
W5KJ41_BAX-01      gtcgagatgg-cgcaccgtgaccgt--gatcgctgctgtagcattcatcgctgctgctgt
W5KCK0_BAX-01      ccctacctgg-caaactgttggcgt--ctttctggctggagtgctcaccactgtgctggt
W5KCL0_BAX-01      accttcctgg-acaactgtcactgc--atttgtggctggagttctcactactgctctcat
                                  * *           *    ** *  *     *             

W5KA26_BOK-01      cctgaaggccgtggtgttctatctgctgagagagaagtga
W5KF74_BOK-01      tgtgaagaccatgtacatctacctgat------gaagtaa
W5KF74_BOK-02      tgtgaagaccatgtacatctacctgat------gaagtaa
W5KJ41_BAX-02      -atactggaaacgaag-----------------tcgctga
W5KJ41_BAX-01      -atactggaaacgaag-----------------tcgctga
W5KCK0_BAX-01      catgcgcaaaatg------------------------tga
W5KCL0_BAX-01      cgtaaacaaaatg------------------------tga
                     *         *                        * *

© 1998-2018