Dataset for CDS BAX-like of Organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5KCK0_BAX-01      atg--tttgtatgttctgtgttcaaaggcaacggtaatgaacaactgttagacctgggag
W5KF74_BOK-01      atggatttgatggatcgaggcccgagtgagaaggagctg----gttttccagtctaaga-
                   ***  ****   * **   *  * *  *  * **   **      * *     **  ** 

W5KCK0_BAX-01      cttccctgctaaaagattttatctaccaacgggttcagcgtcatggggacagcaatgctt
W5KF74_BOK-01      ---tactgtgcagagacttcatttac-------tccaggatcacca--------------
                        ***   * *** ** ** ***       * ***  ***                 

W5KCK0_BAX-01      tggtgacaaggaaccagttgggcgggacagagttgtgtgaccc-----------------
W5KF74_BOK-01      ----gagaaggtctcaactggtc----caaagttgaatcgtccctgcctgtaccagttcc
                       ** ****   **  *** *    ** *****  *   **                 

W5KCK0_BAX-01      -----gagccataagagacttgcgcagtgt-cttcagcagattggagacgagttagacag
W5KF74_BOK-01      agacggagctcttggagatgtctccatggtgcttctaaagcttggtgatgagctgga---
                        ****  *  ****  *   **  ** ****   ** **** ** *** * **   

W5KCK0_BAX-01      caatgtaca-gctgcagagtatgataaatgactcggcgctacagcccacccaagacgtgt
W5KF74_BOK-01      ----gtacatgcggccgtatatctacaggaacgtggcgaagcagctcagtatatcggtgt
                       ***** ** ** *  ***    *   **  ****   **** **    *   ****

W5KCK0_BAX-01      ttgtgaaa---------------------------gtggcttgtgaaatcttctctgatg
W5KF74_BOK-01      ctgtggagagcgtggtgtcggacgcttttctctctgtggcgacggagatcctctccctgg
                    **** *                            *****    ** *** ****    *

W5KCK0_BAX-01      ggaagtttaactggggcagggtggtggcgcttttctattttgcttgtcgactcgtcatca
W5KF74_BOK-01      gga---tcacgtgggggaaggtggtggccatctttgcagtagctggggggtctggcggt-
                   ***   * *  ***** * *********  * **     * *** *  *    * *    

W5KCK0_BAX-01      aggctgtgctgactaag--cttcctgacatcatcagaaccatcatcaattggaccgtaga
W5KF74_BOK-01      ggactgtgtccggcagggtcatccagccatgatactcactatagtggacagcctggggga
                    * *****      * *  * *** * *** **    ** **  *  *  *    *  **

W5KCK0_BAX-01      ctacctgcgggaacatgtgattaattggatcagggaacagggaggctgggaaggtat---
W5KF74_BOK-01      gttcgtccggaagagcctggtgccctggctgaagaggagaggaggctggggagacatttc
                    * * * *** *     ** *    *** * * *      ********** **  **   

W5KCK0_BAX-01      ------------------------------ccggtcctact-------------------
W5KF74_BOK-01      aaagtgtgtgacgagcgtggacactacacctccgtcccattggatgtctgcagtagtatc
                                                  * **** * *                   

W5KCK0_BAX-01      ---ttgga---------------------acccctacctggcaaa---------------
W5KF74_BOK-01      aacctggaggcacgttgtgaagaccatgtatatctacctgatgaagtaactgtggaagca
                       ****                     *   *******   **               

W5KCK0_BAX-01      ----ctgttg--gcgtctttctggctggagtgctcaccactgtg----------ctggtc
W5KF74_BOK-01      gtagctgttaatacggctccaggactgga------attactgggaagtctcagactgctc
                       *****    ** **    * *****      *  **** *          *** **

W5KCK0_BAX-01      atg--cgcaaaatgtga----
W5KF74_BOK-01      atgatctcagagctttactaa
                   ***  * ** *   * *    

© 1998-2019