Dataset for CDS BAX of Organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5KJ41_BAX-02      atggcagattccggagacagcggggggaatgaggacagtgagctgttaggagctacaggt
W5KJ41_BAX-01      atggcagattccggagacagcggggggaatgaggacagtgagctgttaggagctacaggt
W5KCK0_BAX-01      tttttaaatcaccaaggaagtggaggatcaacgtacag-aagtgttaatctgctacgcat
W5KCL0_BAX-01      ------------------------------------------------------------
                                                                               

W5KJ41_BAX-02      ggagaagatgttgtagacgaccaaatcgtagaacaaggcgcaatagtactgagagggtat
W5KJ41_BAX-01      ggagaagatgttgtagacgaccaaatcgtagaacaaggcgcaatagtactgagagggtat
W5KCK0_BAX-01      aggatataggc-----------------------------------tactgataaacttt
W5KCL0_BAX-01      ------------------------------------------------------------
                                                                               

W5KJ41_BAX-02      gttcttcggcggctcagtacagagaaccctg---atgtacgtgtgagttgggtggacctt
W5KJ41_BAX-01      gttcttcggcggctcagtacagagaaccctg---atgtacgtgtgagttgggtggacctt
W5KCK0_BAX-01      atctctgagcgtctt----cagcgcacattggaaattgatgctgcagtaaccaaaaacct
W5KCL0_BAX-01      ------------------------------------------------------------
                                                                               

W5KJ41_BAX-02      ggtggaagacctgatgaaggcg-atgaccctcaaataaaagtggttgtggagcagcttct
W5KJ41_BAX-01      ggtggaagacctgatgaaggcg-atgaccctcaaataaaagtggttgtggagcagcttct
W5KCK0_BAX-01      gttggacgagacggaagaggtgcctgatcccaacattaagaaagttggacagcgtctaca
W5KCL0_BAX-01      ------------------------------------------------------------
                                                                               

W5KJ41_BAX-02      tagaattgctgatgatctgaatcgcaatactgagcttcaacacctcatcagcact-----
W5KJ41_BAX-01      tagaattgctgatgatctgaatcgcaatactgagcttcaacacctcatcagcact-----
W5KCK0_BAX-01      gcagtttggagatgaactggacaatgacacagaattgaaaaatatgataaatgactcggc
W5KCL0_BAX-01      -------------------------------------------atgattaataac-----
                                                               * ** *          

W5KJ41_BAX-02      -gtgcaggctaactgtgctcaggatgtgttcatgacggtggccaggacgatcttcacaga
W5KJ41_BAX-01      -gtgcaggctaactgtgctcaggatgtgttcatgacggtggccaggacgatcttcacaga
W5KCK0_BAX-01      gctacagccca------cccaagacgtgtttgtgaaagtggcttgtgaaatcttctctga
W5KCL0_BAX-01      -ctaatgccca------caaaagaagtgttcctgaaaatcgcctatgaaatcttctctga
                     *   * * *      *  * ** *****  ***   * **       ****** * **

W5KJ41_BAX-02      tggca---ttaactggggacgaatcgtggctctgtttcatctggcctatcagcttattta
W5KJ41_BAX-01      tggca---ttaactggggacgaatcgtggctctgtttcatctggcctatcagcttattta
W5KCK0_BAX-01      tgggaagtttaactggggcagggtggtggcgcttttctattttgcttgtcgactcgtcat
W5KCL0_BAX-01      ctggaagtttaactggggcagggtggtggcactgttctactttgcttgtgagtttgtcaa
                     * *   **********  *  * ***** ** **  *  * ** * *    *  *   

W5KJ41_BAX-02      taat---------------------------------gcactgactcaaaaccacttaga
W5KJ41_BAX-01      taatatcccagagaagttgagaccatttctgaacatggcactgactcaaaaccacttaga
W5KCK0_BAX-01      caag---------------------------------gctgtgctgactaagcttcctga
W5KCL0_BAX-01      gatg---------------------------------g---------------ttcctga
                    *                                   *                    **

W5KJ41_BAX-02      aatcatcaataacatcattagctgggtattacagtatatcaggcagcacgtatccgcctg
W5KJ41_BAX-01      aatcatcaataacatcattagctgggtattacagtatatcaggcagcacgtatccgcctg
W5KCK0_BAX-01      catcatcagaaccatcatcaattggaccgtagactacctgcgggaacatgtgattaattg
W5KCL0_BAX-01      tatcatcagtaacatcatcagctggactctagaattcatgcgtgatcatgtgattgcatg
                    *******  * ****** *  ***    ** * *   *  *  * ** **       **

W5KJ41_BAX-02      gatcagacagcagggaggatgggaaggggttatccgc---------agcgtgtcgagatg
W5KJ41_BAX-01      gatcagacagcagggaggatgggaaggggttatccgc---------agcgtgtcgagatg
W5KCK0_BAX-01      gatcagggaacagggaggctgggaagg---tatccggtcctactttggaacccctacctg
W5KCL0_BAX-01      gatcagtggacagggaggctgggacgc---aatcctctcacagattgaagcaccttcctg
                   ******    ******** ***** *     ****                  *    **

W5KJ41_BAX-02      gcgcaccgtgaccgtgatcgctgctgtagcattcatcgctgctgctgt-atactggaaac
W5KJ41_BAX-01      gcgcaccgtgaccgtgatcgctgctgtagcattcatcgctgctgctgt-atactggaaac
W5KCK0_BAX-01      gcaaactgttggcgtctttctggctggagtgctcaccactgtgctggtcatgcgcaaaat
W5KCL0_BAX-01      gacaactgtcactgcatttgtggctggagttctcactactgctctcatcgtaaacaaaat
                   *   ** **    *   *    **** **   ***   ***      *  *     *** 

W5KJ41_BAX-02      gaagtcgctga
W5KJ41_BAX-01      gaagtcgctga
W5KCK0_BAX-01      g-------tga
W5KCL0_BAX-01      g-------tga
                   *       ***

© 1998-2018