Dataset for CDS BAX of Organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5KJ43_BAX-01          atg---gcagattccggagacagcggagggaatgaggacagtgagctgtt
W5KJ43_BAX-02          atg---gcagattccggagacagcggagggaatgaggacagtgagctgtt
A0A3B1JGN3_BAX-01      atg---gca--------gctcag-ggagaaggttatgctgttaatctgct
W5KCK0_BAX-01          atgtttgtatgttctgtgttcaa-aggcaacggta--atgaacaactgtt
                       ***   * *           **   *        *        * *** *

W5KJ43_BAX-01          a------ggagctacaggtggagaagatgttgtagacgaccaaatcgtag
W5KJ43_BAX-02          a------ggagctacaggtggagaagatgttgtagacgaccaaatcgtag
A0A3B1JGN3_BAX-01      acgcataggatataggctactgataaactttatctctgagcgtct-----
W5KCK0_BAX-01          agacctgggagcttccctgctaaaagattttatctaccaacgggt-----
                       *      ***  *           * *  ** *     * *   *     

W5KJ43_BAX-01          aacaaggcgcattagtactgagagggtat--gttcttcggcggctcagta
W5KJ43_BAX-02          aacaaggcgcattagtactgagagggtat--gttcttcggcggctcagta
A0A3B1JGN3_BAX-01      -----------tcagcgcacattggaaattgatgctgcagta-------a
W5KCK0_BAX-01          -----------tcagcgtcatggggacagcaatgctttggtg-------a
                                  * **        **  *    * **   *         *

W5KJ43_BAX-01          cagagaaccctgatgtacgtgtgagtcgggtggaccttggtggaagacct
W5KJ43_BAX-02          cagagaaccctgatgtacgtgtgagtcgggtggaccttggtggaagacct
A0A3B1JGN3_BAX-01      ccaaaaacc--------------tgttggacga-----gacggaagaggt
W5KCK0_BAX-01          caaggaacc--------------agttgggcgg-----gac---agagtt
                       *    ****               ** **  *      *     ***  *

W5KJ43_BAX-01          gatgaaggcgatgaccctcagataaaagtggttgtggagcagcttcttag
W5KJ43_BAX-02          gatgaaggcgatgaccctcagataaaagtggttgtggagcagcttcttag
A0A3B1JGN3_BAX-01      gc--------ctgatcccaacattaagaaagttggacagcgtctacagca
W5KCK0_BAX-01          gt--------gtgacccgagccataagagacttgcgcagtgtcttcagca
                       *          *** **       **     ***   **   ** *    

W5KJ43_BAX-01          aattgctgatgatctgaatcgcaatactgagcttcaacacctcatcagca
W5KJ43_BAX-02          aattgctgatgatctgaatcgcaatactgagcttcaacacctcatcagca
A0A3B1JGN3_BAX-01      gtttggagatgaactggacaatgacacaaaattgaaagagatgattaata
W5KCK0_BAX-01          gattggagacgagttagacagcaatgtacagctgcagagtatgataaatg
                         ***  ** **  *  *     *     *  *  *     * ** *   

W5KJ43_BAX-01          ct------gtgcaggctaactgtgctcaggatgtgtttatgacggtggcc
W5KJ43_BAX-02          ct------gtgcaggctaactgtgctcaggatgtgtttatgacggtggcc
A0A3B1JGN3_BAX-01      ac------ctaatgccca------caaaagaagtgttcctgaaaatcgcc
W5KCK0_BAX-01          actcggcgctacagccca------cccaagacgtgtttgtgaaagtggct
                                *   * * *      *  * ** *****  ***   * ** 

W5KJ43_BAX-01          aggacgatcttcacagatggca---ttaactggggacgaatcgtggctct
W5KJ43_BAX-02          aggacgatcttcacagatggca---ttaactggggacgaatcgtggctct
A0A3B1JGN3_BAX-01      tatgaaatcttctctgactggaagtttaactggggcagggtggtggcact
W5KCK0_BAX-01          tgtgaaatcttctctgatgggaagtttaactggggcagggtggtggcgct
                             ****** * **  * *   **********  *  * ***** **

W5KJ43_BAX-01          gtttcatctggcctatcagcttatttataatgcactgactca--aaacca
W5KJ43_BAX-02          gtttcatctggcctatcagcttatttataatactttgagagaggaaacta
A0A3B1JGN3_BAX-01      gttctactttgcttgtgagtttgtcaagatgg---------------ttc
W5KCK0_BAX-01          tttctattttgcttgtcgactcgtcatcaaggctgtgctgactaagcttc
                        **  *  * ** * *    *  *    *                     

W5KJ43_BAX-01          cttag--aaatcatcaagaac------atcattagctgggtattacagta
W5KJ43_BAX-02          taatgtcaaatcaacaaacgctttcaaatcttcctcggg-----------
A0A3B1JGN3_BAX-01      ctg----atatcatcagtaac------atcatcagctggactctagaatt
W5KCK0_BAX-01          ctg----acatcatcagaacc------atcatcaattggaccgtagacta
                              * **** **    *      *** *     **           

W5KJ43_BAX-01          tatcaggcagcacgtatccgcctggatcagacagcagggaggatgggaag
W5KJ43_BAX-02          ----agttggtacgtacagctgtggtggagattgtaagtacgactaga--
A0A3B1JGN3_BAX-01      catgcgtgatcatgtgattgcatggatcagtggacagggaggctgggacg
W5KCK0_BAX-01          cctgcgggaacatgtgattaattggatcagggaacagggaggctgggaag
                            *     * **       ***   **     * * * *    **  

W5KJ43_BAX-01          gggttatccgcagcgtgtcgaga--------tggcgcaccgtgaccgtga
W5KJ43_BAX-02          ----tttctgttttggttccaaa-------------catcattaac----
A0A3B1JGN3_BAX-01      caat--cctctcacagattgaagcaccttcctggacaactgtcactgcat
W5KCK0_BAX-01          gtat--ccggtcctactttggaacccctacctggcaaactgttggcgtct
                              *         *                   *   *        

W5KJ43_BAX-01          tcgctgcagta---gcattc----atcgctgctgctgtatactggaaacg
W5KJ43_BAX-02          tccctggggaaaatgctttctatgtttacttctgtttttttctgaggcta
A0A3B1JGN3_BAX-01      ttgtggctgga----------gttctcactactgctctcatcgtaaacaa
W5KCK0_BAX-01          ttctggctgga----------gtgctcaccactgtgctggtcatgcgcaa
                       *    *  * *              *  *  ***   *   *        

W5KJ43_BAX-01          aagtcgctga
W5KJ43_BAX-02          aa-----tga
A0A3B1JGN3_BAX-01      aatg---tga
W5KCK0_BAX-01          aatg---tga
                       **     ***

© 1998-2019