Dataset for CDS BAX-like of Organism Astatotilapia calliptera

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8R8S7_BOK-01      atggagatgttgcgt-----------------------------------
A0A3P8R188_BOK-05      atggaggtcctgcgc-----------------------------------
A0A3P8R188_BOK-06      atggaggtcctgcgc-----------------------------------
A0A3P8R188_BOK-01      atggaggtcctgcgc-----------------------------------
A0A3P8R188_BOK-02      atggaggtcctgcgc-----------------------------------
A0A3P8R188_BOK-03      atggaggtcctgcgc-----------------------------------
A0A3P8R188_BOK-04      atggaggtcctgcgc-----------------------------------
A0A3P8N5H5_BAX-01      atgatggttcgtacggagtatctgaactgtggaagaacacaaagtaaaac
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      atg----ct-----------------------------------------
A0A3P8NNH7_BAX-01      atggcatca-----------------------------------------
A0A3P8NNH7_BAX-03      atg----ct-----------------------------------------
                                                                         

A0A3P8R8S7_BOK-01      -------cgctcctctgtgtttgc---------ctctgaagtgtttga--
A0A3P8R188_BOK-05      -------aggtcttcagtgtttgctgcagaggtcctggatgtgtttga--
A0A3P8R188_BOK-06      -------aggtcttcagtgtttgctgcagaggtcctggatgtgtttga--
A0A3P8R188_BOK-01      -------aggtcttcagtgtttgctgcagaggtcctggatgtgtttga--
A0A3P8R188_BOK-02      -------aggtcttcagtgtttgctgcagaggtcctggatgtgtttga--
A0A3P8R188_BOK-03      -------aggtcttcagtgtttgctgcagaggtcctggatgtgtttga--
A0A3P8R188_BOK-04      -------aggtcttcagtgtttgctgcagaggtcctggatgtgtttga--
A0A3P8N5H5_BAX-01      agataaatactcctctgtgggca------ggtttctgggcgagtatctcc
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      -------tatttatcagcatttg------agtcatctaatgagtgtct--
A0A3P8NNH7_BAX-01      -------cacccaggagga----------ggcgatcaaggtagtagca--
A0A3P8NNH7_BAX-03      -------tatttatcagcatttg------agtcatctaatgagtgtct--
                                                                         

A0A3P8R8S7_BOK-01      --------------------------------------------------
A0A3P8R188_BOK-05      --------------------------------------------------
A0A3P8R188_BOK-06      --------------------------------------------------
A0A3P8R188_BOK-01      --------------------------------------------------
A0A3P8R188_BOK-02      --------------------------------------------------
A0A3P8R188_BOK-03      --------------------------------------------------
A0A3P8R188_BOK-04      --------------------------------------------------
A0A3P8N5H5_BAX-01      atctgtgggatttctgtgaggcgtgtctacggactgctggtcccgtcgct
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      --------------------------------------------------
A0A3P8NNH7_BAX-01      --------------------------------------------------
A0A3P8NNH7_BAX-03      --------------------------------------------------
                                                                         

A0A3P8R8S7_BOK-01      --------------------------------------------------
A0A3P8R188_BOK-05      --------------------------------------------------
A0A3P8R188_BOK-06      --------------------------------------------------
A0A3P8R188_BOK-01      --------------------------------------------------
A0A3P8R188_BOK-02      --------------------------------------------------
A0A3P8R188_BOK-03      --------------------------------------------------
A0A3P8R188_BOK-04      --------------------------------------------------
A0A3P8N5H5_BAX-01      acgatacttccgtatcacttccgtgtgcttctgttgaaaggcgggtttcc
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      --------------------------------------------------
A0A3P8NNH7_BAX-01      --------------------------------------------------
A0A3P8NNH7_BAX-03      --------------------------------------------------
                                                                         

A0A3P8R8S7_BOK-01      -------------------ccgctcgcccaccgaca--------------
A0A3P8R188_BOK-05      -------------------ccgatcactgaccgaga--------------
A0A3P8R188_BOK-06      -------------------ccgatcactgaccgaga--------------
A0A3P8R188_BOK-01      -------------------ccgatcactgaccgaga--------------
A0A3P8R188_BOK-02      -------------------ccgatcactgaccgaga--------------
A0A3P8R188_BOK-03      -------------------ccgatcactgaccgaga--------------
A0A3P8R188_BOK-04      -------------------ccgatcactgaccgaga--------------
A0A3P8N5H5_BAX-01      acagactaggtttggctccatggctgacggccgaggggggcagaatccgg
A0A3P8N5H5_BAX-02      -------------------atggctgacggccgaggggggcagaatccgg
A0A3P8NNW3_BAX-01      -------------------acctttgtctttcatgg------aattccgg
A0A3P8NNH7_BAX-01      -------------------gctatcgtcaacaaata------aaatacat
A0A3P8NNH7_BAX-03      -------------------acctttgtctttcaggg------aattccgg
                                                                         

A0A3P8R8S7_BOK-01      ---------------aggagctggtgtcccaagccaaagcactgtgcag-
A0A3P8R188_BOK-05      ---------------aggagctggtgacccagtctaaggcgctgtgcag-
A0A3P8R188_BOK-06      ---------------aggagctggtgacccagtctaaggcgctgtgcag-
A0A3P8R188_BOK-01      ---------------aggagctggtgacccagtctaaggcgctgtgcag-
A0A3P8R188_BOK-02      ---------------aggagctggtgacccagtctaaggcgctgtgcag-
A0A3P8R188_BOK-03      ---------------aggagctggtgacccagtctaaggcgctgtgcag-
A0A3P8R188_BOK-04      ---------------aggagctggtgacccagtctaaggcgctgtgcag-
A0A3P8N5H5_BAX-01      agc--aggagccgaggggcgccgcgggtggagacgatgtcgttga-----
A0A3P8N5H5_BAX-02      agc--aggagccgaggggcgccgcgggtggagacgatgtcgttga-----
A0A3P8NNW3_BAX-01      aga-------tc---agatactggaagtcggaactattttgttaca----
A0A3P8NNH7_BAX-01      atatttcgactc---tgacagtgtcggtgggagtccgatagacacagata
A0A3P8NNH7_BAX-03      aga-------tc---agatactggaagtcggaactattttgttaca----
                                       *     *                           

A0A3P8R8S7_BOK-01      ----ggaatacatccactccagg------------ctgaaccgtgccggg
A0A3P8R188_BOK-05      ----agactacatcttgtcgagg------------ctcaaccaaaacggg
A0A3P8R188_BOK-06      ----agactacatcttgtcgagg------------ctcaaccaaaacggg
A0A3P8R188_BOK-01      ----agactacatcttgtcgagg------------ctcaaccaaaacggg
A0A3P8R188_BOK-02      ----agactacatcttgtcgagg------------ctcaaccaaaacggg
A0A3P8R188_BOK-03      ----agactacatcttgtcgagg------------ctcaaccaaaacggg
A0A3P8R188_BOK-04      ----agactacatcttgtcgagg------------ctcaaccaaaacggg
A0A3P8N5H5_BAX-01      ----tgattccatcctcgaagaaggtgcggttgtctttagagggtatgtg
A0A3P8N5H5_BAX-02      ----tgattccatcctcgaagaaggtgcggttgtctttagagggtatgtg
A0A3P8NNW3_BAX-01      ----ggatttcatctatgagcgag-----------ttcagaggcaaagag
A0A3P8NNH7_BAX-01      atgtggctttcatctatgagcgag-----------ttcagaggcaaggag
A0A3P8NNH7_BAX-03      ----ggatttcatctatgagcgag-----------ttcagaggcaaggag
                            *  * ****                      * *        * *

A0A3P8R8S7_BOK-01      atcggctggtccaagcctgaaca---cggactggctgcgtcaggtgggac
A0A3P8R188_BOK-05      ttgggatggtctaaaactgaact---caatttttctccctcaaacacagc
A0A3P8R188_BOK-06      ttgggatggtctaaaactgaact---caatttttctccctcaaacacagc
A0A3P8R188_BOK-01      ttgggatggtctaaaactgaact---caatttttctccctcaaacacagc
A0A3P8R188_BOK-02      ttgggatggtctaaaactgaact---caatttttctccctcaaacacagc
A0A3P8R188_BOK-03      ttgggatggtctaaaactgaact---caatttttctccctcaaacacagc
A0A3P8R188_BOK-04      ttgggatggtctaaaactgaact---caatttttctccctcaaacacagc
A0A3P8N5H5_BAX-01      attgcacatataaacacagaggagcccagtcgacacgtgacttctgagga
A0A3P8N5H5_BAX-02      attgcacatataaacacagaggagcccagtcgacacgtgacttctgagga
A0A3P8NNW3_BAX-01      atggca---------atagtgca-------------gtgacgagagaaca
A0A3P8NNH7_BAX-01      atggca---------ataaggca-------------gtgacgagagaaca
A0A3P8NNH7_BAX-03      atggca---------ataaggca-------------gtgacgagagaaca
                        * *                                    *         

A0A3P8R8S7_BOK-01      actgggagagatatcttcggtcctgctgtggctggg---cgatgagttgg
A0A3P8R188_BOK-05      gctggctgaagtgtctatggtgcttctctgtcttgg---cgatgagctgg
A0A3P8R188_BOK-06      gctggctgaagtgtctatggtgcttctctgtcttgg---cgatgagctgg
A0A3P8R188_BOK-01      gctggctgaagtgtctatggtgcttctctgtcttgg---cgatgagctgg
A0A3P8R188_BOK-02      gctggctgaagtgtctatggtgcttctctgtcttgg---cgatgagctgg
A0A3P8R188_BOK-03      gctggctgaagtgtctatggtgcttctctgtcttgg---cgatgagctgg
A0A3P8R188_BOK-04      gctggctgaagtgtctatggtgcttctctgtcttgg---cgatgagctgg
A0A3P8N5H5_BAX-01      tttgggaggaaggccagatgaacaacaggatccacaagtcaaagaagtgg
A0A3P8N5H5_BAX-02      tttgggaggaaggccagatgaacaacaggatccacaagtcaaagaagtgg
A0A3P8NNW3_BAX-01      gcttgatggaa-gccagctgact-----gacccaaaacataagaagcttg
A0A3P8NNH7_BAX-01      gcttggtggaa-gccagctgact-----gacccaaaacataagaagcttg
A0A3P8NNH7_BAX-03      gcttggtggaa-gccagctgact-----gacccaaaacataagaagcttg
                         * *  *      *    *           *         *  *  * *

A0A3P8R8S7_BOK-01      ---agtaccttcgtc---------ccaatgtgtaccgtaacgtcgcccgc
A0A3P8R188_BOK-05      ---agtgtatacagc---------ccagtttgtacaggaacgtggcgcgg
A0A3P8R188_BOK-06      ---agtgtatacagc---------ccagtttgtacaggaacgtggcgcgg
A0A3P8R188_BOK-01      ---agtgtatacagc---------ccagtttgtacaggaacgtggcgcgg
A0A3P8R188_BOK-02      ---agtgtatacagc---------ccagtttgtacaggaacgtggcgcgg
A0A3P8R188_BOK-03      ---agtgtatacagc---------ccagtttgtacaggaacgtggcgcgg
A0A3P8R188_BOK-04      ---agtgtatacagc---------ccagtttgtacaggaacgtggcgcgg
A0A3P8N5H5_BAX-01      tagaacagctgcgcaagatagccgacagtttaaaccgcaatgctgagctt
A0A3P8N5H5_BAX-02      tagaacagctgcgcaagatagccgacagtttaaaccgcaatgctgagctt
A0A3P8NNW3_BAX-01      ctcagtgcctgcagcatattggagacgagctggatggaaatgtagagctc
A0A3P8NNH7_BAX-01      ctcagtgcctgcagcagattggagacgagctggatggaaatgtagagctc
A0A3P8NNH7_BAX-03      ctcagtgcctgcagcagattggagacgagctggatggaaatgtagagctc
                          *     * *             *    *  *  * ** *  *  *  

A0A3P8R8S7_BOK-01      cagctgaacatcacagtggcatcggagagcgtggtgtcc-----gacgcc
A0A3P8R188_BOK-05      cagctcaacatttctgttgccatggagaacatggtttcg-----gatgcc
A0A3P8R188_BOK-06      cagctcaacatttctgttgccatggagaacatggtttcg-----gatgcc
A0A3P8R188_BOK-01      cagctcaacatttctgttgccatggagaacatggtttcg-----gatgcc
A0A3P8R188_BOK-02      cagctcaacatttctgttgccatggagaacatggtttcg-----gatgcc
A0A3P8R188_BOK-03      cagctcaacatttctgttgccatggagaacatggtttcg-----gatgcc
A0A3P8R188_BOK-04      cagctcaacatttctgttgccatggagaacatggtttcg-----gatgcc
A0A3P8N5H5_BAX-01      cagagactgataaaccaggttcaggggaactgcgttc-----aagatgtc
A0A3P8N5H5_BAX-02      cagagactgataaaccaggttcaggggaactgcgttc-----aagatgtc
A0A3P8NNW3_BAX-01      caaagaatgataaataactcttcg-----ctttgtcccacaagaaaggtt
A0A3P8NNH7_BAX-01      caaagaatgataaatgactcttcg-----ctttgtcccacaagagaggtt
A0A3P8NNH7_BAX-03      caaagaatgataaatgactcttcg-----ctttgtcccacaagagaggtt
                       **       **            *     *   **          * *  

A0A3P8R8S7_BOK-01      ttcctggctgtcgctgcagacattttctccacaggtg---tgacatgggg
A0A3P8R188_BOK-05      ttcatcggtgtagcaacagagattttctcagcaggca---taacatgggg
A0A3P8R188_BOK-06      ttcatcggtgtagcaacagagattttctcagcaggca---taacatgggg
A0A3P8R188_BOK-01      ttcatcggtgtagcaacagagattttctcagcaggca---taacatgggg
A0A3P8R188_BOK-02      ttcatcggtgtagcaacagagattttctcagcaggca---taacatgggg
A0A3P8R188_BOK-03      ttcatcggtgtagcaacagagattttctcagcaggca---taacatgggg
A0A3P8R188_BOK-04      ttcatcggtgtagcaacagagattttctcagcaggca---taacatgggg
A0A3P8N5H5_BAX-01      ttcatggcagttgcaagaaacatctttgctgatggca---tcaactgggg
A0A3P8N5H5_BAX-02      ttcatggcagttgcaagaaacatctttgctgatggca---tcaactgggg
A0A3P8NNW3_BAX-01      tttatgagagtggcctctgagatcttttcagatggaatatttaactgggg
A0A3P8NNH7_BAX-01      tttatgagagtggcctatgagatcttttcagatggaatatttaactgggg
A0A3P8NNH7_BAX-03      tttatgagagtggcctatgagatcttttcagatggaatatttaactgggg
                       **  *    ** **     * ** **  *    **     * *  *****

A0A3P8R8S7_BOK-01      aaaggtggtttccttgtacgctgtagcgggagccttggcggtggactgtg
A0A3P8R188_BOK-05      taaggtggtgtccatgtttgcggtagctggagccctggcagtggactgtg
A0A3P8R188_BOK-06      taaggtggtgtccatgtttgcggtagctggagccctggcagtggactgtg
A0A3P8R188_BOK-01      taaggtggtgtccatgtttgcggtagctggagccctggcagtggactgtg
A0A3P8R188_BOK-02      taaggtggtgtccatgtttgcggtagctggagccctggcagtggactgtg
A0A3P8R188_BOK-03      taaggtggtgtccatgtttgcggtagctggagccctggcagtggactgtg
A0A3P8R188_BOK-04      taaggtggtgtccatgtttgcggtagctggagccctggcagtggactgtg
A0A3P8N5H5_BAX-01      tcgagtagtggctctcttcc-----------atctggcctgtaaact-ta
A0A3P8N5H5_BAX-02      tcgagtagtggctctcttcc-----------atctggcctgtaaact-ta
A0A3P8NNW3_BAX-01      cagggtggttgcactgttct-----------actttgcatgccgact-cg
A0A3P8NNH7_BAX-01      cagggtggttgcactgttct-----------actttgcatgccgact-cg
A0A3P8NNH7_BAX-03      cagggtggttgcactgttct-----------actttgcatgccgact-cg
                           ** **  *  * *                   *   *   ***   

A0A3P8R8S7_BOK-01      tacgccatggtcatccagca------------atggtccataccattgtc
A0A3P8R188_BOK-05      tcagacaaggccatccggct------------acagtgcacatcttagtg
A0A3P8R188_BOK-06      tcagacaaggccatccggct------------acagtgcacatcttagtg
A0A3P8R188_BOK-01      tcagacaaggccatccggct------------acagtgcacatcttagtg
A0A3P8R188_BOK-02      tcagacaaggccatccggct------------acagtgcacatcttagtg
A0A3P8R188_BOK-03      tcagacaaggccatccggct------------acagtgcacatcttagtg
A0A3P8R188_BOK-04      tcagacaaggccatccggct------------acagtgcacatcttagtg
A0A3P8N5H5_BAX-01      tacacaaggctattaccgccaatcacttagagaacatccaaatgatcatc
A0A3P8N5H5_BAX-02      tacacaaggctattaccgccaatcacttagagaacatccaaatgatcatc
A0A3P8NNW3_BAX-01      ttatcaaagtacgtgaaact---------------------gctattgcc
A0A3P8NNH7_BAX-01      ttatcaaagctcttgtaactcagattccggatattatcagaaccattatc
A0A3P8NNH7_BAX-03      ttatcaaagctcttgtaactcagattccggatattatcagaaccattatc
                       *     * *    *    *                          *    

A0A3P8R8S7_BOK-01      gactgcatgggggagtttgtccgcaagagcctgacttcctggttaaaaaa
A0A3P8R188_BOK-05      gacagtctgggacagtttgtccgcaaattcctggttccctggctgaagcg
A0A3P8R188_BOK-06      gacagtctgggacagtttgtccgcaaattcctggttccctggctgaagcg
A0A3P8R188_BOK-01      gacagtctgggacagtttgtccgcaaattcctggttccctggctgaagcg
A0A3P8R188_BOK-02      gacagtctgggacagtttgtccgcaaattcctggttccctggctgaagcg
A0A3P8R188_BOK-03      gacagtctgggacagtttgtccgcaaattcctggttccctggctgaagcg
A0A3P8R188_BOK-04      gacagtctgggacagtttgtccgcaaattcctggttccctggctgaagcg
A0A3P8N5H5_BAX-01      agctgggtcctccaggtcatcagggagcaggtctacagctggcttgtggc
A0A3P8N5H5_BAX-02      agctgggtcctccaggtcatcagggagcaggtctacagctggcttgtggc
A0A3P8NNW3_BAX-01      gattccccctttgaat----------------------------------
A0A3P8NNH7_BAX-01      agttggaccatagactatctccgggaacatgtgatcaactggatcaggga
A0A3P8NNH7_BAX-03      agttggaccatagactatctccgggaacatgtgatcaactggatcaggga
                                    *                                    

A0A3P8R8S7_BOK-01      gagaggaggctgggtgg---------atgt-------aacaaagtgcgtg
A0A3P8R188_BOK-05      acggggaggatgggtaa---------gtttctgcctcagcaaaattttgg
A0A3P8R188_BOK-06      acggggaggatgggtaa---------gtttctgcctcagcaaaattttgg
A0A3P8R188_BOK-01      acggggaggatgggtaa---------gtttctgcctcagcaaaattttgg
A0A3P8R188_BOK-02      acggggaggatgggtaa---------gtttctgcctcagcaaaattttgg
A0A3P8R188_BOK-03      acggggaggatgggtaa---------gtttctgcctcagcaaaattttgg
A0A3P8R188_BOK-04      acggggaggatgggtgg---------agatc-------acaaaatgtgtg
A0A3P8N5H5_BAX-01      acaagggggctgggagggggtgatccgtgg--------------------
A0A3P8N5H5_BAX-02      acaagggggctgggagggggtgatccgtgg--------------------
A0A3P8NNW3_BAX-01      ---------------gg---------gttt--------------------
A0A3P8NNH7_BAX-01      gcaaggtggctgggagg---------gtat--------------------
A0A3P8NNH7_BAX-03      gcaaggtggctgggagg---------gtat--------------------
                                                                         

A0A3P8R8S7_BOK-01      gtgagca----------------ctgaccc----------aaacttctgt
A0A3P8R188_BOK-05      gcaaacatgaaatgcataaaaagttgacatttgagata--caacagcgat
A0A3P8R188_BOK-06      gcaaacatgaaatgcataaaaagttgacatttgagata--caacagcgat
A0A3P8R188_BOK-01      gcaaacatgaaatgcataaaaagttgacatttgagata--caacagcgat
A0A3P8R188_BOK-02      gcaaacatgaaatgcataaaaagttgacatttgagata--caacagcgat
A0A3P8R188_BOK-03      gcaaacatgaaatgcataaaaagttgacatttgagata--caacagcgat
A0A3P8R188_BOK-04      gtgaaaaaggatt----------tttgccctgaagaaaactggctgtcct
A0A3P8N5H5_BAX-01      -----------------------tttctctcgatggaggacagcagc---
A0A3P8N5H5_BAX-02      -----------------------tttctctcgatggaggacagcagc---
A0A3P8NNW3_BAX-01      -----------------------tggatttt-------------------
A0A3P8NNH7_BAX-01      -----------------------tcgctcctactttggcacaccaac---
A0A3P8NNH7_BAX-03      -----------------------tcgctcctactttggcacaccaac---
                                                                         

A0A3P8R8S7_BOK-01      tcgcactggctggtgtctgctgtctgtgcctttggacactacctgaagac
A0A3P8R188_BOK-05      ttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggattt
A0A3P8R188_BOK-06      ttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggattt
A0A3P8R188_BOK-01      ttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggattt
A0A3P8R188_BOK-02      ttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggattt
A0A3P8R188_BOK-03      ttgcatttgctagttttgtgtgtgtgtgtgcaggggtggggtggggattt
A0A3P8R188_BOK-04      ctgcctttg--agtccctcaagtgcttcctcacga---------------
A0A3P8N5H5_BAX-01      -----catggtagcatcagtagtat--------------tggtggta---
A0A3P8N5H5_BAX-02      -----catggtagcatcagtagtat--------------tggtggta---
A0A3P8NNW3_BAX-01      --------gtacgtgttttgaattt--------------tgt--------
A0A3P8NNH7_BAX-01      -----atggcagacggtcggagttt--------------tcttggcagga
A0A3P8NNH7_BAX-03      -----atggcagacggtcggagttt--------------tcttggcagga
                               *             *                           

A0A3P8R8S7_BOK-01      ggtcgtgctaca--cctcctccgcg----agaagtga---
A0A3P8R188_BOK-05      gaatttgatgca---ctgctttgtg-------catga---
A0A3P8R188_BOK-06      gaatttgatgca---ctgctttgtg-------catga---
A0A3P8R188_BOK-01      gaatttgatgca---ctgctttgtg-------catga---
A0A3P8R188_BOK-02      gaatttgatgca---ctgctttgtg-------catga---
A0A3P8R188_BOK-03      gaatttgatgca---ctgctttgtg-------catga---
A0A3P8R188_BOK-04      -----cgatgtatgtctacatcatgaaggagccgtga---
A0A3P8N5H5_BAX-01      ---------gcctttgtttactaccggaa-agtacgataa
A0A3P8N5H5_BAX-02      ---------gcctttgtttactaccggaa-agtacgataa
A0A3P8NNW3_BAX-01      ---------acgtgttttggattttgcaacggtataa---
A0A3P8NNH7_BAX-01      gtccttaccactgttcttgtcattcgcaa-gatgtga---
A0A3P8NNH7_BAX-03      gtccttaccactgttcttgtcattcgcaa-gatgtga---
                                       *                   *   

© 1998-2019