Dataset for CDS BAX-like of Organism Astatotilapia calliptera

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8R8S7_BOK-01      atggagatgttgcgtcgctcctc---------------------------
A0A3P8R3S9_BOK-03      atggaggtcctgcgcaggtcttc---------------------------
A0A3P8R3S9_BOK-06      atggaggtcctgcgcaggtcttc---------------------------
A0A3P8R3S9_BOK-01      atggaggtcctgcgcaggtcttc---------------------------
A0A3P8R3S9_BOK-02      atggaggtcctgcgcaggtcttc---------------------------
A0A3P8R3S9_BOK-05      atggaggtcctgcgcaggtcttc---------------------------
A0A3P8R3S9_BOK-04      atggaggtcctgcgcaggtcttc---------------------------
A0A3P8N5H5_BAX-01      atgatggttcgtacggagtatctgaactgtggaagaacacaaagtaaaac
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      ---atgcttatttatcagcatttgagtcatcta-----------------
A0A3P8NNI6_BAX-01      ---atg-----------gcatc----acaccca-----------------
A0A3P8NNI6_BAX-02      ---atg-----------gcatc----acaccca-----------------
A0A3P8NNI6_BAX-03      ---atgcttatttatcagcatttgagtcatcta-----------------
                                                                         

A0A3P8R8S7_BOK-01      --------------------------------------------------
A0A3P8R3S9_BOK-03      --------------------------------------------------
A0A3P8R3S9_BOK-06      --------------------------------------------------
A0A3P8R3S9_BOK-01      --------------------------------------------------
A0A3P8R3S9_BOK-02      --------------------------------------------------
A0A3P8R3S9_BOK-05      --------------------------------------------------
A0A3P8R3S9_BOK-04      --------------------------------------------------
A0A3P8N5H5_BAX-01      agataaatactcctctgtgggcaggtttctgggcgagtatctccatctgt
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      --------------------------------------------------
A0A3P8NNI6_BAX-01      --------------------------------------------------
A0A3P8NNI6_BAX-02      --------------------------------------------------
A0A3P8NNI6_BAX-03      --------------------------------------------------
                                                                         

A0A3P8R8S7_BOK-01      --------------------------------------------------
A0A3P8R3S9_BOK-03      --------------------------------------------------
A0A3P8R3S9_BOK-06      --------------------------------------------------
A0A3P8R3S9_BOK-01      --------------------------------------------------
A0A3P8R3S9_BOK-02      --------------------------------------------------
A0A3P8R3S9_BOK-05      --------------------------------------------------
A0A3P8R3S9_BOK-04      --------------------------------------------------
A0A3P8N5H5_BAX-01      gggatttctgtgaggcgtgtctacggactgctggtcccgtcgctacgata
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      --------------------------------------------------
A0A3P8NNI6_BAX-01      --------------------------------------------------
A0A3P8NNI6_BAX-02      --------------------------------------------------
A0A3P8NNI6_BAX-03      --------------------------------------------------
                                                                         

A0A3P8R8S7_BOK-01      --------------------------------------------------
A0A3P8R3S9_BOK-03      --------------------------------------------------
A0A3P8R3S9_BOK-06      --------------------------------------------------
A0A3P8R3S9_BOK-01      --------------------------------------------------
A0A3P8R3S9_BOK-02      --------------------------------------------------
A0A3P8R3S9_BOK-05      --------------------------------------------------
A0A3P8R3S9_BOK-04      --------------------------------------------------
A0A3P8N5H5_BAX-01      cttccgtatcacttccgtgtgcttctgttgaaaggcgggtttccacagac
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      --------------------------------------------------
A0A3P8NNI6_BAX-01      --------------------------------------------------
A0A3P8NNI6_BAX-02      --------------------------------------------------
A0A3P8NNI6_BAX-03      --------------------------------------------------
                                                                         

A0A3P8R8S7_BOK-01      -------------tgtgtttgc---------ctctgaagtgtt-tgaccg
A0A3P8R3S9_BOK-03      -------------agtgtttgctgcagaggtcctggatgtgtt-tgaccg
A0A3P8R3S9_BOK-06      -------------agtgtttgctgcagaggtcctggatgtgtt-tgaccg
A0A3P8R3S9_BOK-01      -------------agtgtttgctgcagaggtcctggatgtgtt-tgaccg
A0A3P8R3S9_BOK-02      -------------agtgtttgctgcagaggtcctggatgtgtt-tgaccg
A0A3P8R3S9_BOK-05      -------------agtgtttgctgcagaggtcctggatgtgtt-tgaccg
A0A3P8R3S9_BOK-04      -------------agtgtttgctgcagaggtcctggatgtgtt-tgaccg
A0A3P8N5H5_BAX-01      taggtttggctccatggctgacggcc---------gaggggggcagaatc
A0A3P8N5H5_BAX-02      -------------atggctgacggcc---------gaggggggcagaatc
A0A3P8NNW3_BAX-01      -------------atgagtgtctacctttgtctttcatggaat-------
A0A3P8NNI6_BAX-01      -------------ggaggaggcgatc---------aaggtagtagcagct
A0A3P8NNI6_BAX-02      -------------ggaggaggcgatc---------aagggaat-------
A0A3P8NNI6_BAX-03      -------------atgagtgtctacctttgtctttcagggaat-------
                                            *              * *           

A0A3P8R8S7_BOK-01      ctcgcccaccgacaaggagc--------------------------tggt
A0A3P8R3S9_BOK-03      atcactgaccgagaaggagc--------------------------tggt
A0A3P8R3S9_BOK-06      atcactgaccgagaaggagc--------------------------tggt
A0A3P8R3S9_BOK-01      atcactgaccgagaaggagc--------------------------tggt
A0A3P8R3S9_BOK-02      atcactgaccgagaaggagc--------------------------tggt
A0A3P8R3S9_BOK-05      atcactgaccgagaaggagc--------------------------tggt
A0A3P8R3S9_BOK-04      atcactgaccgagaaggagc--------------------------tggt
A0A3P8N5H5_BAX-01      cggagcaggagccgaggggc------------------------gccgcg
A0A3P8N5H5_BAX-02      cggagcaggagccgaggggc------------------------gccgcg
A0A3P8NNW3_BAX-01      ----tccggagatcagatac--------------------------tgga
A0A3P8NNI6_BAX-01      atcgtcaacaaataaaatacatatatttcgactctgacagtgtcggtggg
A0A3P8NNI6_BAX-02      ----tccggagatcagatac--------------------------tgga
A0A3P8NNI6_BAX-03      ----tccggagatcagatac--------------------------tgga
                                     *    *                           *  

A0A3P8R8S7_BOK-01      gtcccaagccaaagcactgtgcag-----ggaatacatccactccagg--
A0A3P8R3S9_BOK-03      gacccagtctaaggcgctgtgcag-----agactacatcttgtcgagg--
A0A3P8R3S9_BOK-06      gacccagtctaaggcgctgtgcag-----agactacatcttgtcgagg--
A0A3P8R3S9_BOK-01      gacccagtctaaggcgctgtgcag-----agactacatcttgtcgagg--
A0A3P8R3S9_BOK-02      gacccagtctaaggcgctgtgcag-----agactacatcttgtcgagg--
A0A3P8R3S9_BOK-05      gacccagtctaaggcgctgtgcag-----agactacatcttgtcgagg--
A0A3P8R3S9_BOK-04      gacccagtctaaggcgctgtgcag-----agactacatcttgtcgagg--
A0A3P8N5H5_BAX-01      ggtggagacgatgtcgttga---------tgattccatcctcgaagaagg
A0A3P8N5H5_BAX-02      ggtggagacgatgtcgttga---------tgattccatcctcgaagaagg
A0A3P8NNW3_BAX-01      agtcggaactattttgttaca--------ggatttcatctatgagcgag-
A0A3P8NNI6_BAX-01      agtccga------tagacacagataatgtggctttcatctatgagcgag-
A0A3P8NNI6_BAX-02      agtcggaactattttgttaca--------ggatttcatctatgagcgag-
A0A3P8NNI6_BAX-03      agtcggaactattttgttaca--------ggatttcatctatgagcgag-
                                                     *  * ****           

A0A3P8R8S7_BOK-01      ----------ctgaaccgtgccgggatcggctggtccaagcctgaaca--
A0A3P8R3S9_BOK-03      ----------ctcaaccaaaacgggttgggatggtctaaaactgaact--
A0A3P8R3S9_BOK-06      ----------ctcaaccaaaacgggttgggatggtctaaaactgaact--
A0A3P8R3S9_BOK-01      ----------ctcaaccaaaacgggttgggatggtctaaaactgaact--
A0A3P8R3S9_BOK-02      ----------ctcaaccaaaacgggttgggatggtctaaaactgaact--
A0A3P8R3S9_BOK-05      ----------ctcaaccaaaacgggttgggatggtctaaaactgaact--
A0A3P8R3S9_BOK-04      ----------ctcaaccaaaacgggttgggatggtctaaaactgaact--
A0A3P8N5H5_BAX-01      tgcggttgtctttagagggtatgtgattgcacatataaacacagaggagc
A0A3P8N5H5_BAX-02      tgcggttgtctttagagggtatgtgattgcacatataaacacagaggagc
A0A3P8NNW3_BAX-01      ----------ttcagaggcaaagagatggca---------atagtgca--
A0A3P8NNI6_BAX-01      ----------ttcagaggcaaggagatggca---------ataaggca--
A0A3P8NNI6_BAX-02      ----------ttcagaggcaaggagatggca---------ataaggca--
A0A3P8NNI6_BAX-03      ----------ttcagaggcaaggagatggca---------ataaggca--
                                  * *        * * * *                     

A0A3P8R8S7_BOK-01      -cggactggctgcgtcaggtgggacactgggagagatatcttcggtcctg
A0A3P8R3S9_BOK-03      -caatttttctccctcaaacacagcgctggctgaagtgtctatggtgctt
A0A3P8R3S9_BOK-06      -caatttttctccctcaaacacagcgctggctgaagtgtctatggtgctt
A0A3P8R3S9_BOK-01      -caatttttctccctcaaacacagcgctggctgaagtgtctatggtgctt
A0A3P8R3S9_BOK-02      -caatttttctccctcaaacacagcgctggctgaagtgtctatggtgctt
A0A3P8R3S9_BOK-05      -caatttttctccctcaaacacagcgctggctgaagtgtctatggtgctt
A0A3P8R3S9_BOK-04      -caatttttctccctcaaacacagcgctggctgaagtgtctatggtgctt
A0A3P8N5H5_BAX-01      ccagtcgacacgtgacttctgaggatttgggaggaaggccagatgaacaa
A0A3P8N5H5_BAX-02      ccagtcgacacgtgacttctgaggatttgggaggaaggccagatgaacaa
A0A3P8NNW3_BAX-01      -----------gtgacgagagaacagcttgatggaa-gccagctgact--
A0A3P8NNI6_BAX-01      -----------gtgacgagagaacagcttggtggaa-gccagctgact--
A0A3P8NNI6_BAX-02      -----------gtgacgagagaacagcttggtggaa-gccagctgact--
A0A3P8NNI6_BAX-03      -----------gtgacgagagaacagcttggtggaa-gccagctgact--
                                      *           * *  *      *    *     

A0A3P8R8S7_BOK-01      ctgtggctggg---cgatgagttgg---agtaccttcgtc---------c
A0A3P8R3S9_BOK-03      ctctgtcttgg---cgatgagctgg---agtgtatacagc---------c
A0A3P8R3S9_BOK-06      ctctgtcttgg---cgatgagctgg---agtgtatacagc---------c
A0A3P8R3S9_BOK-01      ctctgtcttgg---cgatgagctgg---agtgtatacagc---------c
A0A3P8R3S9_BOK-02      ctctgtcttgg---cgatgagctgg---agtgtatacagc---------c
A0A3P8R3S9_BOK-05      ctctgtcttgg---cgatgagctgg---agtgtatacagc---------c
A0A3P8R3S9_BOK-04      ctctgtcttgg---cgatgagctgg---agtgtatacagc---------c
A0A3P8N5H5_BAX-01      caggatccacaagtcaaagaagtggtagaacagctgcgcaagatagccga
A0A3P8N5H5_BAX-02      caggatccacaagtcaaagaagtggtagaacagctgcgcaagatagccga
A0A3P8NNW3_BAX-01      ---gacccaaaacataagaagcttgctcagtgcctgcagcatattggaga
A0A3P8NNI6_BAX-01      ---gacccaaaacataagaagcttgctcagtgcctgcagcagattggaga
A0A3P8NNI6_BAX-02      ---gacccaaaacataagaagcttgctcagtgcctgcagcagattggaga
A0A3P8NNI6_BAX-03      ---gacccaaaacataagaagcttgctcagtgcctgcagcagattggaga
                             *         *  *  * *   *     * *             

A0A3P8R8S7_BOK-01      caatgtgtaccgtaacgtcgcccgccagctgaacatcacagtggcatcgg
A0A3P8R3S9_BOK-03      cagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatgg
A0A3P8R3S9_BOK-06      cagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatgg
A0A3P8R3S9_BOK-01      cagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatgg
A0A3P8R3S9_BOK-02      cagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatgg
A0A3P8R3S9_BOK-05      cagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatgg
A0A3P8R3S9_BOK-04      cagtttgtacaggaacgtggcgcggcagctcaacatttctgttgccatgg
A0A3P8N5H5_BAX-01      cagtttaaaccgcaatgctgagcttcagagactgataaaccaggttcagg
A0A3P8N5H5_BAX-02      cagtttaaaccgcaatgctgagcttcagagactgataaaccaggttcagg
A0A3P8NNW3_BAX-01      cgagctggatggaaatgtagagctccaaagaatgataaataactcttcg-
A0A3P8NNI6_BAX-01      cgagctggatggaaatgtagagctccaaagaatgataaatgactcttcg-
A0A3P8NNI6_BAX-02      cgagctggatggaaatgtagagctccaaagaatgataaatgactcttcg-
A0A3P8NNI6_BAX-03      cgagctggatggaaatgtagagctccaaagaatgataaatgactcttcg-
                       *    *  *  * ** *  *  *  **       **            * 

A0A3P8R8S7_BOK-01      agagcgtggtgtcc-----gacgccttcctggctgtcgctgcagacattt
A0A3P8R3S9_BOK-03      agaacatggtttcg-----gatgccttcatcggtgtagcaacagagattt
A0A3P8R3S9_BOK-06      agaacatggtttcg-----gatgccttcatcggtgtagcaacagagattt
A0A3P8R3S9_BOK-01      agaacatggtttcg-----gatgccttcatcggtgtagcaacagagattt
A0A3P8R3S9_BOK-02      agaacatggtttcg-----gatgccttcatcggtgtagcaacagagattt
A0A3P8R3S9_BOK-05      agaacatggtttcg-----gatgccttcatcggtgtagcaacagagattt
A0A3P8R3S9_BOK-04      agaacatggtttcg-----gatgccttcatcggtgtagcaacagagattt
A0A3P8N5H5_BAX-01      ggaactgcgttc-----aagatgtcttcatggcagttgcaagaaacatct
A0A3P8N5H5_BAX-02      ggaactgcgttc-----aagatgtcttcatggcagttgcaagaaacatct
A0A3P8NNW3_BAX-01      ----ctttgtcccacaagaaaggtttttatgagagtggcctctgagatct
A0A3P8NNI6_BAX-01      ----ctttgtcccacaagagaggtttttatgagagtggcctatgagatct
A0A3P8NNI6_BAX-02      ----ctttgtcccacaagagaggtttttatgagagtggcctatgagatct
A0A3P8NNI6_BAX-03      ----ctttgtcccacaagagaggtttttatgagagtggcctatgagatct
                           *   **          * *  **  *    ** **     * ** *

A0A3P8R8S7_BOK-01      tctccacaggtg---tgacatggggaaaggtggtttccttgtacgctgta
A0A3P8R3S9_BOK-03      tctcagcaggca---taacatggggtaaggtggtgtccatgtttgcggta
A0A3P8R3S9_BOK-06      tctcagcaggca---taacatggggtaaggtggtgtccatgtttgcggta
A0A3P8R3S9_BOK-01      tctcagcaggca---taacatggggtaaggtggtgtccatgtttgcggta
A0A3P8R3S9_BOK-02      tctcagcaggca---taacatggggtaaggtggtgtccatgtttgcggta
A0A3P8R3S9_BOK-05      tctcagcaggca---taacatggggtaaggtggtgtccatgtttgcggta
A0A3P8R3S9_BOK-04      tctcagcaggca---taacatggggtaaggtggtgtccatgtttgcggta
A0A3P8N5H5_BAX-01      ttgctgatggca---tcaactggggtcgagtagtggctctcttcc-----
A0A3P8N5H5_BAX-02      ttgctgatggca---tcaactggggtcgagtagtggctctcttcc-----
A0A3P8NNW3_BAX-01      tttcagatggaatatttaactggggcagggtggttgcactgttct-----
A0A3P8NNI6_BAX-01      tttcagatggaatatttaactggggcagggtggttgcactgttct-----
A0A3P8NNI6_BAX-02      tttcagatggaatatttaactggggcagggtggttgcactgttct-----
A0A3P8NNI6_BAX-03      tttcagatggaatatttaactggggcagggtggttgcactgttct-----
                       *  *    **     * *  *****    ** **  *  * *        

A0A3P8R8S7_BOK-01      gcgggagccttggcggtggactgtgtacgccatggtcatccagca-----
A0A3P8R3S9_BOK-03      gctggagccctggcagtggactgtgtcagacaaggccatccggct-----
A0A3P8R3S9_BOK-06      gctggagccctggcagtggactgtgtcagacaaggccatccggct-----
A0A3P8R3S9_BOK-01      gctggagccctggcagtggactgtgtcagacaaggccatccggct-----
A0A3P8R3S9_BOK-02      gctggagccctggcagtggactgtgtcagacaaggccatccggct-----
A0A3P8R3S9_BOK-05      gctggagccctggcagtggactgtgtcagacaaggccatccggct-----
A0A3P8R3S9_BOK-04      gctggagccctggcagtggactgtgtcagacaaggccatccggct-----
A0A3P8N5H5_BAX-01      ------atctggcctgtaaact-tatacacaaggctattaccgccaatca
A0A3P8N5H5_BAX-02      ------atctggcctgtaaact-tatacacaaggctattaccgccaatca
A0A3P8NNW3_BAX-01      ------actttgcatgccgact-cgttatcaaagtacgtgaaact-----
A0A3P8NNI6_BAX-01      ------actttgcatgccgact-cgttatcaaagctcttgtaactcagat
A0A3P8NNI6_BAX-02      ------actttgcatgccgact-cgttatcaaagctcttgtaactcagat
A0A3P8NNI6_BAX-03      ------actttgcatgccgact-cgttatcaaagctcttgtaactcagat
                                  *   *   ***   *     * *    *    *      

A0A3P8R8S7_BOK-01      -------atggtccataccattgtcgactgcatgggggagtttgtccgca
A0A3P8R3S9_BOK-03      -------acagtgcacatcttagtggacagtctgggacagtttgtccgca
A0A3P8R3S9_BOK-06      -------acagtgcacatcttagtggacagtctgggacagtttgtccgca
A0A3P8R3S9_BOK-01      -------acagtgcacatcttagtggacagtctgggacagtttgtccgca
A0A3P8R3S9_BOK-02      -------acagtgcacatcttagtggacagtctgggacagtttgtccgca
A0A3P8R3S9_BOK-05      -------acagtgcacatcttagtggacagtctgggacagtttgtccgca
A0A3P8R3S9_BOK-04      -------acagtgcacatcttagtggacagtctgggacagtttgtccgca
A0A3P8N5H5_BAX-01      cttagagaacatccaaatgatcatcagctgggtcctccaggtcatcaggg
A0A3P8N5H5_BAX-02      cttagagaacatccaaatgatcatcagctgggtcctccaggtcatcaggg
A0A3P8NNW3_BAX-01      ----------------gctattgccgattccccctttgaat---------
A0A3P8NNI6_BAX-01      tccggatattatcagaaccattatcagttggaccatagactatctccggg
A0A3P8NNI6_BAX-02      tccggatattatcagaaccattatcagttggaccatagactatctccggg
A0A3P8NNI6_BAX-03      tccggatattatcagaaccattatcagttggaccatagactatctccggg
                                           *                 *           

A0A3P8R8S7_BOK-01      agagcctgacttcctggttaaaaaagagaggaggctgggtgg--------
A0A3P8R3S9_BOK-03      aattcctggttccctggctgaagcgacggggaggatgggtaa--------
A0A3P8R3S9_BOK-06      aattcctggttccctggctgaagcgacggggaggatgggtaa--------
A0A3P8R3S9_BOK-01      aattcctggttccctggctgaagcgacggggaggatgggtaa--------
A0A3P8R3S9_BOK-02      aattcctggttccctggctgaagcgacggggaggatgggtaa--------
A0A3P8R3S9_BOK-05      aattcctggttccctggctgaagcgacggggaggatgggtaa--------
A0A3P8R3S9_BOK-04      aattcctggttccctggctgaagcgacggggaggatgggtgg--------
A0A3P8N5H5_BAX-01      agcaggtctacagctggcttgtggcacaagggggctgggagggggtgatc
A0A3P8N5H5_BAX-02      agcaggtctacagctggcttgtggcacaagggggctgggagggggtgatc
A0A3P8NNW3_BAX-01      ----------------------------------------gg--------
A0A3P8NNI6_BAX-01      aacatgtgatcaactggatcagggagcaaggtggctgggagg--------
A0A3P8NNI6_BAX-02      aacatgtgatcaactggatcagggagcaaggtggctgggagg--------
A0A3P8NNI6_BAX-03      aacatgtgatcaactggatcagggagcaaggtggctgggagg--------
                                                                         

A0A3P8R8S7_BOK-01      -atgt-------aacaaagtgcgtggtgagca----------------ct
A0A3P8R3S9_BOK-03      -gtttctgcctcagcaaaattttgggcaaacatgaaatgcataaaaagtt
A0A3P8R3S9_BOK-06      -gtttctgcctcagcaaaattttgggcaaacatgaaatgcataaaaagtt
A0A3P8R3S9_BOK-01      -gtttctgcctcagcaaaattttgggcaaacatgaaatgcataaaaagtt
A0A3P8R3S9_BOK-02      -gtttctgcctcagcaaaattttgggcaaacatgaaatgcataaaaagtt
A0A3P8R3S9_BOK-05      -gtttctgcctcagcaaaattttgggcaaacatgaaatgcataaaaagtt
A0A3P8R3S9_BOK-04      -agatc-------acaaaatgtgtggtgaaaaaggatt----------tt
A0A3P8N5H5_BAX-01      cgtgg-------------------------------------------tt
A0A3P8N5H5_BAX-02      cgtgg-------------------------------------------tt
A0A3P8NNW3_BAX-01      -gttt-------------------------------------------tg
A0A3P8NNI6_BAX-01      -gtat-------------------------------------------tc
A0A3P8NNI6_BAX-02      -gtat-------------------------------------------tc
A0A3P8NNI6_BAX-03      -gtat-------------------------------------------tc
                                                                         

A0A3P8R8S7_BOK-01      gaccc----------aaacttctgttcgcactggctggtgtctgctgtct
A0A3P8R3S9_BOK-03      gacatttgagata--caacagcgatttgcatttgctagttttgtgtgtgt
A0A3P8R3S9_BOK-06      gacatttgagata--caacagcgatttgcatttgctagttttgtgtgtgt
A0A3P8R3S9_BOK-01      gacatttgagata--caacagcgatttgcatttgctagttttgtgtgtgt
A0A3P8R3S9_BOK-02      gacatttgagata--caacagcgatttgcatttgctagttttgtgtgtgt
A0A3P8R3S9_BOK-05      gacatttgagata--caacagcgatttgcatttgctagttttgtgtgtgt
A0A3P8R3S9_BOK-04      tgccctgaagaaaactggctgtcctctgcctttg--agtccctcaagtgc
A0A3P8N5H5_BAX-01      tctctcgatggaggacagcagc--------catggtagcatcagtagtat
A0A3P8N5H5_BAX-02      tctctcgatggaggacagcagc--------catggtagcatcagtagtat
A0A3P8NNW3_BAX-01      gatttt---------------------------gtacgtgttttgaattt
A0A3P8NNI6_BAX-01      gctcctactttggcacaccaac--------atggcagacggtcggagttt
A0A3P8NNI6_BAX-02      gctcctactttggcacaccaac--------atggcagacggtcggagttt
A0A3P8NNI6_BAX-03      gctcctactttggcacaccaac--------atggcagacggtcggagttt
                                                        *             *  

A0A3P8R8S7_BOK-01      gtgcctttggacactacctgaagacggtcgtgctaca--cctcctccgcg
A0A3P8R3S9_BOK-03      gtgtgcaggggtggggtggggatttgaatttgatgca---ctgctttgtg
A0A3P8R3S9_BOK-06      gtgtgcaggggtggggtggggatttgaatttgatgca---ctgctttgtg
A0A3P8R3S9_BOK-01      gtgtgcaggggtggggtggggatttgaatttgatgca---ctgctttgtg
A0A3P8R3S9_BOK-02      gtgtgcaggggtggggtggggatttgaatttgatgca---ctgctttgtg
A0A3P8R3S9_BOK-05      gtgtgcaggggtggggtggggatttgaatttgatgca---ctgctttgtg
A0A3P8R3S9_BOK-04      ttcctcacga--------------------cgatgtatgtctacatcatg
A0A3P8N5H5_BAX-01      --------------tggtggtag------------cctttgtttactacc
A0A3P8N5H5_BAX-02      --------------tggtggtag------------cctttgtttactacc
A0A3P8NNW3_BAX-01      --------------tgt-----------------acgtgttttggatttt
A0A3P8NNI6_BAX-01      --------------tcttggcaggagtccttaccactgttcttgtcattc
A0A3P8NNI6_BAX-02      --------------tcttggcaggagtccttaccactgttcttgtcattc
A0A3P8NNI6_BAX-03      --------------tcttggcaggagtccttaccactgttcttgtcattc
                                                                *        

A0A3P8R8S7_BOK-01      ----agaagtga---
A0A3P8R3S9_BOK-03      -------catga---
A0A3P8R3S9_BOK-06      -------catga---
A0A3P8R3S9_BOK-01      -------catga---
A0A3P8R3S9_BOK-02      -------catga---
A0A3P8R3S9_BOK-05      -------catga---
A0A3P8R3S9_BOK-04      aaggagccgtga---
A0A3P8N5H5_BAX-01      ggaa-agtacgataa
A0A3P8N5H5_BAX-02      ggaa-agtacgataa
A0A3P8NNW3_BAX-01      gcaacggtataa---
A0A3P8NNI6_BAX-01      gcaa-gatgtga---
A0A3P8NNI6_BAX-02      gcaa-gatgtga---
A0A3P8NNI6_BAX-03      gcaa-gatgtga---
                                  *   

© 1998-2019