Dataset for CDS BAX of Organism Astatotilapia calliptera

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8N5H5_BAX-01      atgatggttcgtacggagtatctgaactgtggaagaacacaaagtaaaac
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      ---atgcttatttatcagcatttgagtcatcta-----------------
A0A3P8NNI6_BAX-01      ---atg-----------gcatc----acaccca-----------------
A0A3P8NNI6_BAX-02      ---atg-----------gcatc----acaccca-----------------
A0A3P8NNI6_BAX-03      ---atgcttatttatcagcatttgagtcatcta-----------------
                                                                         

A0A3P8N5H5_BAX-01      agataaatactcctctgtgggcaggtttctgggcgagtatctccatctgt
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      --------------------------------------------------
A0A3P8NNI6_BAX-01      --------------------------------------------------
A0A3P8NNI6_BAX-02      --------------------------------------------------
A0A3P8NNI6_BAX-03      --------------------------------------------------
                                                                         

A0A3P8N5H5_BAX-01      gggatttctgtgaggcgtgtctacggactgctggtcccgtcgctacgata
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      --------------------------------------------------
A0A3P8NNI6_BAX-01      --------------------------------------------------
A0A3P8NNI6_BAX-02      --------------------------------------------------
A0A3P8NNI6_BAX-03      --------------------------------------------------
                                                                         

A0A3P8N5H5_BAX-01      cttccgtatcacttccgtgtgcttctgttgaaaggcgggtttccacagac
A0A3P8N5H5_BAX-02      --------------------------------------------------
A0A3P8NNW3_BAX-01      --------------------------------------------------
A0A3P8NNI6_BAX-01      --------------------------------------------------
A0A3P8NNI6_BAX-02      --------------------------------------------------
A0A3P8NNI6_BAX-03      --------------------------------------------------
                                                                         

A0A3P8N5H5_BAX-01      taggtttggctccatggctgacggcc---------gaggggggcagaatc
A0A3P8N5H5_BAX-02      -------------atggctgacggcc---------gaggggggcagaatc
A0A3P8NNW3_BAX-01      -------------atgagtgtctacctttgtctttcatggaat-------
A0A3P8NNI6_BAX-01      -------------ggaggaggcgatc---------aaggtagtagcagct
A0A3P8NNI6_BAX-02      -------------ggaggaggcgatc---------aagggaat-------
A0A3P8NNI6_BAX-03      -------------atgagtgtctacctttgtctttcagggaat-------
                                          * *   *          * *           

A0A3P8N5H5_BAX-01      cggagcaggagccgaggggc------------------------gccgcg
A0A3P8N5H5_BAX-02      cggagcaggagccgaggggc------------------------gccgcg
A0A3P8NNW3_BAX-01      ----tccggagatcagatac--------------------------tgga
A0A3P8NNI6_BAX-01      atcgtcaacaaataaaatacatatatttcgactctgacagtgtcggtggg
A0A3P8NNI6_BAX-02      ----tccggagatcagatac--------------------------tgga
A0A3P8NNI6_BAX-03      ----tccggagatcagatac--------------------------tgga
                            *   *    *    *                           *  

A0A3P8N5H5_BAX-01      ggtggagacgatgtcgttga---------tgattccatcctcgaagaagg
A0A3P8N5H5_BAX-02      ggtggagacgatgtcgttga---------tgattccatcctcgaagaagg
A0A3P8NNW3_BAX-01      agtcggaactattttgttaca--------ggatttcatctatgagcgag-
A0A3P8NNI6_BAX-01      agtccga------tagacacagataatgtggctttcatctatgagcgag-
A0A3P8NNI6_BAX-02      agtcggaactattttgttaca--------ggatttcatctatgagcgag-
A0A3P8NNI6_BAX-03      agtcggaactattttgttaca--------ggatttcatctatgagcgag-
                        **          * *              * ** ****   **   ** 

A0A3P8N5H5_BAX-01      tgcggttgtctttagagggtatgtgattgcacatataaacacagaggagc
A0A3P8N5H5_BAX-02      tgcggttgtctttagagggtatgtgattgcacatataaacacagaggagc
A0A3P8NNW3_BAX-01      ----------ttcagaggcaaagagatggca---------atagtgca--
A0A3P8NNI6_BAX-01      ----------ttcagaggcaaggagatggca---------ataaggca--
A0A3P8NNI6_BAX-02      ----------ttcagaggcaaggagatggca---------ataaggca--
A0A3P8NNI6_BAX-03      ----------ttcagaggcaaggagatggca---------ataaggca--
                                 ** *****  * * *** ***         * *  * *  

A0A3P8N5H5_BAX-01      ccagtcgacacgtgacttctgaggatttgggaggaaggccagatgaacaa
A0A3P8N5H5_BAX-02      ccagtcgacacgtgacttctgaggatttgggaggaaggccagatgaacaa
A0A3P8NNW3_BAX-01      -----------gtgacgagagaacagcttgatggaa-gccagctgact--
A0A3P8NNI6_BAX-01      -----------gtgacgagagaacagcttggtggaa-gccagctgact--
A0A3P8NNI6_BAX-02      -----------gtgacgagagaacagcttggtggaa-gccagctgact--
A0A3P8NNI6_BAX-03      -----------gtgacgagagaacagcttggtggaa-gccagctgact--
                                  *****    **  *  * *  **** ***** ***    

A0A3P8N5H5_BAX-01      caggatccacaagtcaaagaagtggtagaacagctgcgcaagatagccga
A0A3P8N5H5_BAX-02      caggatccacaagtcaaagaagtggtagaacagctgcgcaagatagccga
A0A3P8NNW3_BAX-01      ---gacccaaaacataagaagcttgctcagtgcctgcagcatattggaga
A0A3P8NNI6_BAX-01      ---gacccaaaacataagaagcttgctcagtgcctgcagcagattggaga
A0A3P8NNI6_BAX-02      ---gacccaaaacataagaagcttgctcagtgcctgcagcagattggaga
A0A3P8NNI6_BAX-03      ---gacccaaaacataagaagcttgctcagtgcctgcagcagattggaga
                          ** *** **   **  *  * *   *    ****   * ** *  **

A0A3P8N5H5_BAX-01      cagtttaaaccgcaatgctgagcttcagagactgataaaccaggttcagg
A0A3P8N5H5_BAX-02      cagtttaaaccgcaatgctgagcttcagagactgataaaccaggttcagg
A0A3P8NNW3_BAX-01      cgagctggatggaaatgtagagctccaaagaatgataaataactcttcg-
A0A3P8NNI6_BAX-01      cgagctggatggaaatgtagagctccaaagaatgataaatgactcttcg-
A0A3P8NNI6_BAX-02      cgagctggatggaaatgtagagctccaaagaatgataaatgactcttcg-
A0A3P8NNI6_BAX-03      cgagctggatggaaatgtagagctccaaagaatgataaatgactcttcg-
                       *    *  *  * ****  ***** ** *** *******  *   *  * 

A0A3P8N5H5_BAX-01      ggaactgcgttc-----aagatgtcttcatggcagttgcaagaaacatct
A0A3P8N5H5_BAX-02      ggaactgcgttc-----aagatgtcttcatggcagttgcaagaaacatct
A0A3P8NNW3_BAX-01      ----ctttgtcccacaagaaaggtttttatgagagtggcctctgagatct
A0A3P8NNI6_BAX-01      ----ctttgtcccacaagagaggtttttatgagagtggcctatgagatct
A0A3P8NNI6_BAX-02      ----ctttgtcccacaagagaggtttttatgagagtggcctatgagatct
A0A3P8NNI6_BAX-03      ----ctttgtcccacaagagaggtttttatgagagtggcctatgagatct
                           **  ** *      * * ** ** ***  *** **     * ****

A0A3P8N5H5_BAX-01      ttgctgatggca---tcaactggggtcgagtagtggctctcttccatctg
A0A3P8N5H5_BAX-02      ttgctgatggca---tcaactggggtcgagtagtggctctcttccatctg
A0A3P8NNW3_BAX-01      tttcagatggaatatttaactggggcagggtggttgcactgttctacttt
A0A3P8NNI6_BAX-01      tttcagatggaatatttaactggggcagggtggttgcactgttctacttt
A0A3P8NNI6_BAX-02      tttcagatggaatatttaactggggcagggtggttgcactgttctacttt
A0A3P8NNI6_BAX-03      tttcagatggaatatttaactggggcagggtggttgcactgttctacttt
                       ** * ***** *   * ********  * ** ** ** ** *** *  * 

A0A3P8N5H5_BAX-01      gcctgtaaacttatacacaaggctattaccgccaatcacttagagaacat
A0A3P8N5H5_BAX-02      gcctgtaaacttatacacaaggctattaccgccaatcacttagagaacat
A0A3P8NNW3_BAX-01      gcatgccgactcgttatcaaagtacgtgaaact-----------------
A0A3P8NNI6_BAX-01      gcatgccgactcgttatcaaagctcttgtaactcagattccggatattat
A0A3P8NNI6_BAX-02      gcatgccgactcgttatcaaagctcttgtaactcagattccggatattat
A0A3P8NNI6_BAX-03      gcatgccgactcgttatcaaagctcttgtaactcagattccggatattat
                       ** **   ***  *   *** *    *    *                  

A0A3P8N5H5_BAX-01      ccaaatgatcatcagctgggtcctccaggtcatcagggagcaggtctaca
A0A3P8N5H5_BAX-02      ccaaatgatcatcagctgggtcctccaggtcatcagggagcaggtctaca
A0A3P8NNW3_BAX-01      ----gctattgccgattccccctttgaat---------------------
A0A3P8NNI6_BAX-01      cagaaccattatcagttggaccatagactatctccgggaacatgtgatca
A0A3P8NNI6_BAX-02      cagaaccattatcagttggaccatagactatctccgggaacatgtgatca
A0A3P8NNI6_BAX-03      cagaaccattatcagttggaccatagactatctccgggaacatgtgatca
                              **   *   *    * *  *                       

A0A3P8N5H5_BAX-01      gctggcttgtggcacaagggggctgggagggggtgatccgtggtttctct
A0A3P8N5H5_BAX-02      gctggcttgtggcacaagggggctgggagggggtgatccgtggtttctct
A0A3P8NNW3_BAX-01      ----------------------------gg---------gttttggattt
A0A3P8NNI6_BAX-01      actggatcagggagcaaggtggctgggagg---------gtattcgctcc
A0A3P8NNI6_BAX-02      actggatcagggagcaaggtggctgggagg---------gtattcgctcc
A0A3P8NNI6_BAX-03      actggatcagggagcaaggtggctgggagg---------gtattcgctcc
                                                   **         **  *   *  

A0A3P8N5H5_BAX-01      cgatggaggacagcagccatggtagcatcagtagtattggtggtag----
A0A3P8N5H5_BAX-02      cgatggaggacagcagccatggtagcatcagtagtattggtggtag----
A0A3P8NNW3_BAX-01      t-------------------gtacgtgttttgaattttgt----------
A0A3P8NNI6_BAX-01      tactttggcacaccaacatggcagacggtcggagttttcttggcaggagt
A0A3P8NNI6_BAX-02      tactttggcacaccaacatggcagacggtcggagttttcttggcaggagt
A0A3P8NNI6_BAX-03      tactttggcacaccaacatggcagacggtcggagttttcttggcaggagt
                                           *           * * **            

A0A3P8N5H5_BAX-01      --------cctttgtttactaccggaa-agtacgataa
A0A3P8N5H5_BAX-02      --------cctttgtttactaccggaa-agtacgataa
A0A3P8NNW3_BAX-01      -------acgtgttttggattttgcaacggtataa---
A0A3P8NNI6_BAX-01      ccttaccactgttcttgtcattcgcaa-gatgtga---
A0A3P8NNI6_BAX-02      ccttaccactgttcttgtcattcgcaa-gatgtga---
A0A3P8NNI6_BAX-03      ccttaccactgttcttgtcattcgcaa-gatgtga---
                               *   * **       * **   *   *   

© 1998-2019