Dataset for CDS BAX-like of Organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5DQ30_BOK-01       atgga-ggtgctgcgccgctcctccg-tcttcgccgccgagatcatggac
A0A2K5D7G1_BAK1-01      ----atggcatcggggcaaggcccaggtcctcccaggcaggagtgcggag
A0A2K5D885_BAX-04       atggacgggtccggggagcagcccag--------aggcgaggg-------
A0A2K5D885_BAX-02       atggacgggtccggggagcagcccag--------aggcgaggg-------
A0A2K5D885_BAX-01       atggacgggtccggggagcagcccag--------aggcgaggg-------
A0A2K5D885_BAX-03       atggacgggtccggggagcagcccag--------aggcgaggg-------
                            * **    * *      * * *         * *  *         

A0A2K5DQ30_BOK-01       gcctttgaccgctcgcccaccgacaaggagctggtggcccagccaaagta
A0A2K5D7G1_BAK1-01      agcctgactcaccc-tctgcttctgaggagcaggtagcccgggacacgga
A0A2K5D885_BAX-04       ----------gccc-accagctctgagcag------atcatgaagacagg
A0A2K5D885_BAX-02       -----------------------tgag-----------------------
A0A2K5D885_BAX-01       ----------gccc-accagctctgagcag------atcatgaagacagg
A0A2K5D885_BAX-03       ----------gccc-accagctctgagcag------atcatgaagacagg
                                                 **                       

A0A2K5DQ30_BOK-01       cg------tgcacgcgcggctgctcgcgcccgagcgcgccg---------
A0A2K5D7G1_BAK1-01      ggaggttttccaaagctacgttttttaccgccatcg-gcaggaacaggag
A0A2K5D885_BAX-04       ggcccttttgc---ttcagggtttcatccaggatcgagcag-----ggcg
A0A2K5D885_BAX-02       ---------------------tttcatccaggatcgagcag---------
A0A2K5D885_BAX-01       ggcccttttgc---ttcagggtttcatccaggatcgagcag-----ggcg
A0A2K5D885_BAX-03       ggcccttttgc---ttcagg------------------------------
                                                                          

A0A2K5DQ30_BOK-01       -----------cgccgtccgggc--gccctgccgaggtcgtggcggccct
A0A2K5D7G1_BAK1-01      gctgaaggggcggccgcccctgctgacccagagatggttagcttgtctct
A0A2K5D885_BAX-04       aatcgggggggagacacccgagctggccc--------tggacccggtgcc
A0A2K5D885_BAX-02       ------------gacacccgagctggccc--------tggacccggtgcc
A0A2K5D885_BAX-01       aatcgggggggagacacccgagctggccc--------tggacccggtgcc
A0A2K5D885_BAX-03       --------------------------------------------------
                                                                          

A0A2K5DQ30_BOK-01       aca----ggcagcacc------cgggcgggacg--agctggagatgatcc
A0A2K5D7G1_BAK1-01      ccaacctagcagcaccatggggcaggtgggacggcagctcgccatcattg
A0A2K5D885_BAX-04       ccaggatgcgtccaccaagaagc---tgagcgagtgtctcaagcgcatcg
A0A2K5D885_BAX-02       ccaggatgcgtccaccaagaagc---tgagcgagtgtctcaagcgcatcg
A0A2K5D885_BAX-01       ccaggatgcgtccaccaagaagc---tgagcgagtgtctcaagcgcatcg
A0A2K5D885_BAX-03       --------------------------------------------------
                                                                          

A0A2K5DQ30_BOK-01       ggcccagcgtctaccg------caacgtggcgcgccagc---tgcacatc
A0A2K5D7G1_BAK1-01      gggatgacatcaaccggcgctatgactcggagttccagaccatgctgcag
A0A2K5D885_BAX-04       gggacgagctggacag------taacatggagctgcagaggatgat----
A0A2K5D885_BAX-02       gggacgagctggacag------taacatggagctgcagaggatgat----
A0A2K5D885_BAX-01       gggacgagctggacag------taacatggagctgcagaggatgat----
A0A2K5D885_BAX-03       ---------------------------------------ggatgat----
                                                                  **      

A0A2K5DQ30_BOK-01       tccctacagtctgagcccgtggtgaccgacgc---gttcctggccg---t
A0A2K5D7G1_BAK1-01      cacctgcaacccacggcagagaacgcctacga---gtacttcaccaagat
A0A2K5D885_BAX-04       ----tgccgctgtggacacagactccccccgagaggtcttttttcgag-t
A0A2K5D885_BAX-02       ----tgccgctgtggacacagactccccccgagaggtcttttttcgag-t
A0A2K5D885_BAX-01       ----tgccgctgtggacacagactccccccgagaggtcttttttcgag-t
A0A2K5D885_BAX-03       ----tgccgctgtggacacagactccccccgagaggtcttttttcgag-t
                            * *       * *   *    **  **    **   *   *    *

A0A2K5DQ30_BOK-01       ggccggccacatcttctctgcaggca---tcacgtggggcaaggtggtgt
A0A2K5D7G1_BAK1-01      cgcctccagcctgtt---tgagagtggcatcaactggggccgtgtggtgg
A0A2K5D885_BAX-04       ggcagctgacatgttctctgacggcaacttcaactggggccgggttgtcg
A0A2K5D885_BAX-02       ggcagctgacatgttctctgacggcaacttcaactggggccgggttgtcg
A0A2K5D885_BAX-01       ggcagctgacatgttctctgacggcaacttcaactggggccgggttgtcg
A0A2K5D885_BAX-03       ggcagctgacatgttctctgacggcaacttcaactggggccgggttgtcg
                         **      * * **   **   *     ***  ******   ** **  

A0A2K5DQ30_BOK-01       ccctgtacgcggtggccgcagggctggccgtggactgcgtgaggcaggcc
A0A2K5D7G1_BAK1-01      ctct-----------cctgggcttcggctaccgtct----------ggcc
A0A2K5D885_BAX-04       ccct-----------tttctactttgccagcaaactg-gtgctcaaggcc
A0A2K5D885_BAX-02       ccct-----------tttctactttgccagcaaactg-gtgctcaaggcc
A0A2K5D885_BAX-01       ccct-----------tttctactttgccagcaaactg-gtgctcaaggcc
A0A2K5D885_BAX-03       ccct-----------tttctactttgccagcaaactg-gtgctcaaggcc
                        * **                     * *      **          ****

A0A2K5DQ30_BOK-01       cagcctgccatggtccacgcccttgtcga---ctgcctgggagagtttgt
A0A2K5D7G1_BAK1-01      ctacatgtctaccagcgcggcctgactgg---cttcctgggccaggtgac
A0A2K5D885_BAX-04       ctgtgtgccaaggtgcccgagctgatcagaaccatcatgggctgg-----
A0A2K5D885_BAX-02       ctgtgtgccaaggtgcccgagctgatcagaaccatcatgggctgg-----
A0A2K5D885_BAX-01       ctgtgtgccaaggtgcccgagctgatcagaaccatcatgggctgg-----
A0A2K5D885_BAX-03       ctgtgtgccaaggtgcccgagctgatcagaaccatcatgggctgg-----
                        *    ** *      * **  **         *  * ****   *     

A0A2K5DQ30_BOK-01       acgcaagaccctggccacctggctgcgga--------ggcgcggtggatg
A0A2K5D7G1_BAK1-01      ccgcttcgtggtggacttcatgctgcatc-actgcatcgcccggtggat-
A0A2K5D885_BAX-04       --actt-----tggacttccttcgggagcggctgttgggc----tggat-
A0A2K5D885_BAX-02       --actt-----tggacttccttcgggagcggctgttgggc----tggat-
A0A2K5D885_BAX-01       --actt-----tggacttccttcgggagcggctgttgggc----tggat-
A0A2K5D885_BAX-03       --actt-----tggacttccttcgggagcggctgttgggc----tggat-
                           *       *** *  *   * *             **    ***** 

A0A2K5DQ30_BOK-01       gactgatgtcctcaagtgtgtggtcagcaccgaccccggcctccgct--c
A0A2K5D7G1_BAK1-01      --------cgcacagaggggcggctggg-----tggcagccctggac---
A0A2K5D885_BAX-04       --------ccaagaccagggtggttgggtcacactgcttcccctgcc-ca
A0A2K5D885_BAX-02       --------ccaagaccagggtggttggg----atggcctcctctcctact
A0A2K5D885_BAX-01       --------ccaagaccagggtggttggg----atggcctcctctcctact
A0A2K5D885_BAX-03       --------ccaagaccagggtggttggg----atggcctcctctcctact
                                     *   * * **   *         *  **         

A0A2K5DQ30_BOK-01       ccactggctgctcgccgcactgtgcagcttcggccgcttcctgaag----
A0A2K5D7G1_BAK1-01      ---ttgggcaatggtcccatc---ctgaatgtgctggtggttctgggtgt
A0A2K5D885_BAX-04       tcttcagatca----t--------cagat---------------------
A0A2K5D885_BAX-02       tctttgggaca----cccacgtggcagacagtgaccatctttgtggctgg
A0A2K5D885_BAX-01       tctttgggaca----cccacgtggcagacagtgaccatctttgtggctgg
A0A2K5D885_BAX-03       tctttgggaca----cccacgtggcagacagtgaccatctttgtggctgg
                              *                 * *                       

A0A2K5DQ30_BOK-01       ---gctgccttcttcgtgctcctgccagaga----------gatga
A0A2K5D7G1_BAK1-01      ggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
A0A2K5D885_BAX-04       -gtggtctctaatgcattt---------------------------
A0A2K5D885_BAX-02       agtgctcactgcctcgcttaccatctggaagaacatgggctga---
A0A2K5D885_BAX-01       agtgctcactgcctcgcttaccatctggaagaacatgggctga---
A0A2K5D885_BAX-03       agtgctcactgcctcgcttaccatctggaagaacatgggctga---
                             *                                        

© 1998-2018