Dataset for CDS BAX-like of Organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1K8X4_BOK-01       atga-------------------------agatggatgtactgcgccgctcctctgtctt
G1KSN2_BAK1-01      atggcctcaagaaatggcaacgacccaacagacaggaggaggacagagatacgcagacca
H9G9C2_BAX-01       ----------------------------------------------ggagcagaggcctc
H9GPC1_BAX-01       atggc----------ggcagcagcagcggatcccgggagatcgcgggaagctggggcccc
                                                                           * *  

G1K8X4_BOK-01       cgctgcagaagtgatggaagtgtttgaccggacacccaccgacaaggagcttgtgtctca
G1KSN2_BAK1-01      tccatggaaattgcattaga----agaccaggtggctcaggagacggaggaggtgttcca
H9G9C2_BAX-01       cc--------------------------cagatgct------------------------
H9GPC1_BAX-01       acctcggaaagcgggcaccagttcagatcagatccttcaga----------------cag
                                                * *                             

G1K8X4_BOK-01       ggccaa---------------------------------agtgctgtgcagagacttcat
G1KSN2_BAK1-01      gagctacgctttctaccggtatca-acaggagcgggagcagactgagggggatgtgccac
H9G9C2_BAX-01       ------------------------------------------gctgc-------------
H9GPC1_BAX-01       gaactgtgcttctgaagggatttatttgggaccgagtgcagagctgtggagactctgaac
                                                                                

G1K8X4_BOK-01       ccactcccggctcatac-------------------gggctggcattggctgga------
G1KSN2_BAK1-01      atgacccagaaatagctgc-----------------gatcccgcatgagccaaatagcac
H9G9C2_BAX-01       ------------------------------------agtcacgtctctgc--aa------
H9GPC1_BAX-01       gcatccaggcaacgttggcggagctcaaggaatcagagtctcggatttgt--gaccctaa
                                                           *  *  *  *    *      

G1K8X4_BOK-01       -acaagcctgaacacagcgtgcctgttcccgggggcaagttagcagaggtatccaacata
G1KSN2_BAK1-01      aaattgccaggtgggcaggcgcctggccacta--------ttggtgatgacatcaatg--
H9G9C2_BAX-01       ----------------gattgcatgttccgta--------tatggcaggaactcagca--
H9GPC1_BAX-01       gaccaagcagttgagtgagtgcctgcgccgga--------ttggagatgaactggacg--
                                        ** **  *            *     * *           

G1K8X4_BOK-01       cttctcagattaggtgatgagctg--gagtacattagg-----cccaacctttaccggaa
G1KSN2_BAK1-01      ----cccgctatgacaaggagttctcggaaatgttgaagtcactccag------ccaaca
H9G9C2_BAX-01       ----------gtaatcgtgatttgaccagcatggtaga--------aagtgccactggta
H9GPC1_BAX-01       ----------gaaatatggagctgcaaagtatgatagaacaagtccaggtgtatccgcca
                                      **  *       *   *           *       *    *

G1K8X4_BOK-01       cgtagcgcgacagctgaacatttctttgcactctgaaacagtggtgacggatgcattcct
G1KSN2_BAK1-01      aaggacaacgcctatgagtactttattaga------------------------------
H9G9C2_BAX-01       aa----aaccctctggaagtcctggctgat------------------------------
H9GPC1_BAX-01       aa------------ggaggtttttttcaga------------------------------
                                   **     *                                     

G1K8X4_BOK-01       ggcggtggcaacgcagatcttttcttcaggca---taacatggggcaagattgt-gtctc
G1KSN2_BAK1-01      ----atagccagcagtttgtttgaaagtggca---taaactggggccgtgtgatagcact
H9G9C2_BAX-01       ----gtgtctgaacacctgtttgctgacggga---tcaactggggtcggattgttgtctt
H9GPC1_BAX-01       ----gtcgctgccgagatgttctctgatgggaccttcaattggggacgagtggtagcttt
                         *  *        * **       ** *   * *  *****     *  * *    

G1K8X4_BOK-01       tctatgctgtggcagctggccttgctgtggactgtgtgcgacatgctcagccag-----c
G1KSN2_BAK1-01      gttgggcttcggctacagg----atggcgatccatgtataccagcatgggatga------
H9G9C2_BAX-01       tttctactttgccttccga----gttattgcccaggtaaaaaaaaaggaagcgaagaacc
H9GPC1_BAX-01       gttctactttgcatg-caa----gttggtcc-----tgaaggcaatttgcactaaattac
                      *   **  *                         *                       

G1K8X4_BOK-01       catggttcat----actattgtggattgcttgggagagttt---gtacgcaagaccttgg
G1KSN2_BAK1-01      ccggcttcctgaggagaattgcccgctacatggctgattttgtgcttcgcaaccgcattg
H9G9C2_BAX-01       cagaaagcattgaggatgtggtgagttgggccatgaccttc---ctacagaaccacctgg
H9GPC1_BAX-01       cagagctcataaagaccatcattagctggacaatggagtac---atcaaaaatcatgtcc
                    *      * *        *       *           *      *    **     *  

G1K8X4_BOK-01       tgacctggatgaagagaagaggaggctggagtgacataaca----aaatgtgtggtgaat
G1KSN2_BAK1-01      cccggtggattgctcagcagggcggatgggtggcagcactg---gacttaagcaacgtgt
H9G9C2_BAX-01       ctaactggatccaacagcaaggaggctgggagggcctcctgtcctacttcggcacccca-
H9GPC1_BAX-01       tgacctggatccaagcccagggaggatgggagggcctcctgtcctacttcggcaccccg-
                         *****          ** ** ***   *            *  *  *        

G1K8X4_BOK-01       actgatcccaacctccgctctcattggcttgtggctgccattt--gtagctttggccact
G1KSN2_BAK1-01      acttg---aagtatgtgctgatagtggc----ggctgtgatcttg-----ctaggccagt
H9G9C2_BAX-01       acttggcaaaccat-tgctg-tatttgc----ggctggcgtcttgactgcttcgctgacc
H9GPC1_BAX-01       acttggcaaactat-tgctg-tatttgc----ggctggtgtcttgactgcctcgctcacc
                    ***      *   *  ***   * * **    *****   * *        * *   *  

G1K8X4_BOK-01       tcctga---aggccatcttctttgtgctgttaccagaaagatga
G1KSN2_BAK1-01      ttgtggtgcggcgtttctt---------------caacccatga
H9G9C2_BAX-01       ttctgg---aaaatgtctt---------------aa--------
H9GPC1_BAX-01       ttctgg---aaaatgtctt---------------aa--------
                    *  **          ****                         

© 1998-2018