Dataset for CDS BAX of Organism Anolis carolinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H9G9C2_BAX-01      ------------------------------------ggagcagaggcctccc--------
H9GPC1_BAX-01      atggcggcagcagcagcggatcccgggagatcgcgggaagctggggccccacctcggaaa
                                                       * *** * **** * *        

H9G9C2_BAX-01      ------------------cagatgct----------------------------------
H9GPC1_BAX-01      gcgggcaccagttcagatcagatccttcagacaggaactgtgcttctgaagggatttatt
                                     ***** **                                  

H9G9C2_BAX-01      ----------------gctgc---------------------------------------
H9GPC1_BAX-01      tgggaccgagtgcagagctgtggagactctgaacgcatccaggcaacgttggcggagctc
                                   ****                                        

H9G9C2_BAX-01      ----------agtcacgtctctgcaa----------------------gattgcatgttc
H9GPC1_BAX-01      aaggaatcagagtctcggatttgtgaccctaagaccaagcagttgagtgagtgcctgcgc
                             **** **  * **  *                      ** *** **  *

H9G9C2_BAX-01      cgtatatggcaggaactcagcagtaatcgtgatttgaccagcatggtaga--------aa
H9GPC1_BAX-01      cggattggagatgaactggacggaaatatggagctgcaaagtatgatagaacaagtccag
                   ** **  *  * *****   * * ***   **  **   ** *** ****        * 

H9G9C2_BAX-01      gtgccactggtaaaaaccctctggaagtcctggctgatgtgtctgaacacctgtttgctg
H9GPC1_BAX-01      gtgtatccgccaaa--------ggaggtttttttcagagtcgctgccgagatgttctctg
                   ***   * *  ***        *** **  *       **  ***   *  ****  ***

H9G9C2_BAX-01      acggga---tcaactggggtcggattgttgtctttttctactttgccttccgagttattg
H9GPC1_BAX-01      atgggaccttcaattggggacgagtggtagctttgttctactttgcatg-caagttggtc
                   * ****   **** ***** **  * ** *  ** *********** *  * ****  * 

H9G9C2_BAX-01      cccaggtaaaaaaaaaggaagcgaagaacccagaaagcattgaggatgtggtgagttggg
H9GPC1_BAX-01      c-----tgaaggcaatttgcactaaattaccagagctcataaagaccatcattagctgga
                   *     * **   **      * **    *****   ***  **    *  * ** *** 

H9G9C2_BAX-01      ccatgaccttcctacagaaccacctggctaactggatccaacagcaaggaggctgggagg
H9GPC1_BAX-01      caatggagtacatcaaaaatcatgtcctgacctggatccaagcccagggaggatgggagg
                   * ***   * * *  * ** **  *    * **********   ** ***** *******

H9G9C2_BAX-01      gcctcctgtcctacttcggcaccccaacttggcaaaccattgctgtatttgcggctggcg
H9GPC1_BAX-01      gcctcctgtcctacttcggcaccccgacttggcaaactattgctgtatttgcggctggtg
                   ************************* *********** ******************** *

H9G9C2_BAX-01      tcttgactgcttcgctgaccttctggaaaatgtcttaa
H9GPC1_BAX-01      tcttgactgcctcgctcaccttctggaaaatgtcttaa
                   ********** ***** *********************

© 1998-2018