Dataset for CDS BAX-like of Organism Anas platyrhynchos

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


U3I5I2_BAK1-01      atggcctcagggaacgacggagacccaccgagggcccacggacgccggggcagcaatggg
U3ISP1_BOK-01       ----------------atggaagtgcttcgccgatcctcagtcttcgctgcagaggtgat
                                    * ***    *  **  *  ** * * *  **  ****   **  

U3I5I2_BAK1-01      cgcagactgtcacaagagctcaattcagaagaccaggtggctcaggaaaccgaggaggtg
U3ISP1_BOK-01       gg-----------aggtgttcga----------caggtctccc-----actgacaaggag
                     *           * * * ** *          *****  * *     ** **  *** *

U3I5I2_BAK1-01      tttcggagctacgccttctaccgctaccaacaggagagagaagagagcggggaagaagtg
U3ISP1_BOK-01       cttgtgtcccaag----ctaaggctctctgcagagactacataaattcgaggctgg----
                     **  *  * * *    ***  ***  *  ***     * *  *   ** **  *     

U3I5I2_BAK1-01      cccttggacccggagattgcggagatccagcaagacctgg-gcagtac-cgggagcctgg
U3ISP1_BOK-01       ---ttcgagcaggtgtcagctgg-----agcaaacccgagtgcaatgcgccggtgcctgg
                       ** ** * ** *   ** *      *****  **  * *** * * * ** ******

U3I5I2_BAK1-01      tgggaaggcgcc-----tggccatcatc------------ggcgatgacatta---acaa
U3ISP1_BOK-01       cgggaagctggccgaagtgtccaccatcctgctgcggctgggagatgagctggaatacat
                     ******  * *     ** *** ****            ** *****  *     *** 

U3I5I2_BAK1-01      gcggtacgacg-----ctgagtttcg-ctacatgctgaaatccttgcagctcaccaagga
U3ISP1_BOK-01       tcgccccaacgtctaccggaacatcgcccgccagctgaacatctctctgcac-tcggaga
                     **   * ***     * **   *** *  *  ******   **  * ** *  *   **

U3I5I2_BAK1-01      gaatgcctacgattactt-------------catcaagattgcctcc-------------
U3ISP1_BOK-01       cggtggtgacggacgccttcctggctgtagccgcgcagattttcaccgcagagttcagag
                       **   ***    * *             *    *****  * **             

U3I5I2_BAK1-01      -----agcctgtttgaaagc---ggcattaactggggccgggtgatcgcgctgctgggct
U3ISP1_BOK-01       gaaagaggctcttaccaagcaaaggcataacgtggggcaaggtggtgtctct-ctacgcg
                         ** ** **   ****   ***** *  ******  **** *  * ** **  ** 

U3I5I2_BAK1-01      tcggctactgca-tggccatccacgtctaccagcacggcataacaggcttcctccgccgc
U3ISP1_BOK-01       gtggcggcggggctggcagtggactgtgtgcggcacgcacagccagccatggtgcacacc
                      ***  * *   ****  *  **      * *****      *** * *  * * *  *

U3I5I2_BAK1-01      atcgcccgctacgtgacggagttcatgctgcgcaaccgcatcgcccagtggatcgcccag
U3ISP1_BOK-01       atcgttgactgcctgggagagttcgt-ccgcaagaccttggtgacc--tggctgaaaagg
                    ****    ** * **   ****** * * **   ***     * **  *** *      *

U3I5I2_BAK1-01      cagggaggatgggt-ggctgcactcgatctg--gacaatgtttacatgaa-----gtaca
U3ISP1_BOK-01       cgaggaggctgggcagacatcacgaagtgtgttgtgaatactgaccccagccttcgctcc
                    *  ***** ****  * *  ***    * **  *  ***  * **   *      *  * 

U3I5I2_BAK1-01      tgctggcggtggtggcc-ctggtgatgg--tggggcatttagtggtacgacg--cttctt
U3ISP1_BOK-01       cactggc--tcgtggctgctgtttgcagctttgggcacttcct--caaggcgatcttctt
                      *****  * *****  *** *    *  * ***** **  *   * * **  ******

U3I5I2_BAK1-01      caggc-----cctga-------
U3ISP1_BOK-01       cgtgctgctgcctgagagatga
                    *  **     *****       

© 1998-2018