Dataset for CDS BOK of Organism Anabas testudineus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q1I4R6_BOK-01      atggaagtcctgcggcggtcttctgtctttgccgcagaggtcctggatgt
A0A3Q1I9F7_BOK-01      atggagatgttgcgccgctcctcagtgtttgcggctgaa---------gt
                       *****  *  **** ** ** ** ** ***** ** **          **

A0A3Q1I4R6_BOK-01      ctttgaccgatcgctgactgagaaagagctggtgtcccagtccaaagcct
A0A3Q1I9F7_BOK-01      gtttgaccgctcgcccaccgacaaggagttggtgtcccaggccaaagcgc
                        ******** ****  ** ** ** *** *********** *******  

A0A3Q1I4R6_BOK-01      tgtgcagggactacatcctgtccagactcaaccagaacgggctgggatgg
A0A3Q1I9F7_BOK-01      tgtgcagggactacattcattccaggctgaaccgtgccgggataggctgg
                       **************** *  ***** ** ****    **** * ** ***

A0A3Q1I4R6_BOK-01      tccaaaactgaactcaacctctccccatcaaatgcagctcttgctgatgt
A0A3Q1I9F7_BOK-01      tctaagcctgagcacggactggctgcatcaggtggggcactgggagagat
                       ** **  **** * *   **  *  *****  **  ** ** *  **  *

A0A3Q1I4R6_BOK-01      gtctttggtgcttctctgtctgggcgacgaactggagtgtatacagccca
A0A3Q1I9F7_BOK-01      ctcctctgtgctgctgtggctgggggatgagttggagtacctgcgaccca
                        ** *  ***** ** ** ***** ** **  ******   * *  ****

A0A3Q1I4R6_BOK-01      gtttgtggaggaatgtggcgcggcagctcaacatctctgttgccatggag
A0A3Q1I9F7_BOK-01      acatttatcgtaacgtagcgcgacagctcaacatccctgtggcgtccgag
                          * *   * ** ** ***** ************ **** **    ***

A0A3Q1I4R6_BOK-01      aacatggtttcagatgcttttatcggcgtggcaacggaaatcttctcaac
A0A3Q1I9F7_BOK-01      ggcgtggtgtcagatgctttcctggctgtggcagcagacattttctccac
                         * **** ***********  * *  ****** * ** ** ***** **

A0A3Q1I4R6_BOK-01      aggtataacatggggtaaggtggtgtccatgtatgcagtagctggagccc
A0A3Q1I9F7_BOK-01      aggtgtgacgtggggaaaggtggtttctttgtacgccgtggcaggggcct
                       **** * ** ***** ******** **  **** ** ** ** ** *** 

A0A3Q1I4R6_BOK-01      tggcagtcgactgtgtcagacaaggacatccgtccacagttcacataata
A0A3Q1I9F7_BOK-01      tagcagtggactgcgtccgccatggtcatccagctattgtccacaccatc
                       * ***** ***** *** * ** ** *****  * *  ** ****  ** 

A0A3Q1I4R6_BOK-01      gtggacagtctgggacagtttgtccgtaggttcctggttccctggctgaa
A0A3Q1I9F7_BOK-01      gtcgactgtatgggagagtttgtccgcaagagtctgacctcctggttaaa
                       ** *** ** ***** ********** * *   ***    ***** * **

A0A3Q1I4R6_BOK-01      gagacgaggaggatgggcagagatctcaaaatgcgtggtgaagaaggatc
A0A3Q1I9F7_BOK-01      aaagagagggggctgggtggatttaacaaaatgtgtggtgaacactgatc
                        *   **** ** ****  **  *  ******* ******** *  ****

A0A3Q1I4R6_BOK-01      tcagtcctgaacaccactggt---tgtcctctgtcatcgagtcgctgaag
A0A3Q1I9F7_BOK-01      ccagcttctgctctcactggctggtgtccgctgcctttg---cctttgga
                        ***          ******    ***** *** * * *   *  *    

A0A3Q1I4R6_BOK-01      tacttcctca---ccacgatg-tacgtctgcatcatgaaggaaccctga
A0A3Q1I9F7_BOK-01      tattatctgaaggccatcgtgttacacctac-tcagagagaag---tga
                       ** *  ** *   ***   ** ***  ** * ***   ** *    ***

© 1998-2019