Dataset for CDS BAX of Organism Anabas testudineus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


R9Y0N7_BAX-01          atggcatcatacccgggaggaggcgatcaaggaaataccaaagatcagat
A0A3Q1I5B7_BAX-01      atggc-tgacagccgagaagaggagaagaaaga-----cggagacgagga
A0A3Q1I5B7_BAX-02      atggc-tgacagccgagaagaggagaagaaaga-----cggagacgagga
                       ***** * * * *** ** **** **  ** **     *  ***  **  

R9Y0N7_BAX-01          ac------------tggaagtaggatgtgtt-------------------
A0A3Q1I5B7_BAX-01      gcctcagggcgccgtgggtggagaagatgttgtcgatgattccatcatgg
A0A3Q1I5B7_BAX-02      gcctcagggcgccgtgggtggagaaggtat--------------------
                        *            ***  * ** *  * *                    

R9Y0N7_BAX-01          --------------ttgttaaaggatttcatctatgagcgaattcagagg
A0A3Q1I5B7_BAX-01      agcaagcagcagtagtgctcagagggtttgtgattgagcgcctt----ag
A0A3Q1I5B7_BAX-02      -------------------------gtttgtgattgagcgcctt----ag
                                                 **  *   ******  **     *

R9Y0N7_BAX-01          catgga-gatgccagtactgcagtgaccagggcacagctaggtggagga-
A0A3Q1I5B7_BAX-01      cacagatgatcctggtcaacaagtgtcccctgagcaactgggtggaaggc
A0A3Q1I5B7_BAX-02      cacagatgatcctggtcaacaagtgtcccctgagcaactgggtggaaggc
                       **  ** *** *  **     **** **   *  ** ** ****** *  

R9Y0N7_BAX-01          -----gagctgtgtgacccaaaccacaagaa---gcttgcccagtgtctg
A0A3Q1I5B7_BAX-01      caaatgaacagcaggatccacagatcaaagacgtggtggaccag---ctg
A0A3Q1I5B7_BAX-02      caaatgaacagcaggatccacagatcaaagacgtggtggaccag---ctg
                            ** * *   ** *** *   ***  *   * * * ****   ***

R9Y0N7_BAX-01          cagcagattggagatgagctggatgcaaatgtagatctccaaaggatgat
A0A3Q1I5B7_BAX-01      atcaagattgcagaggaactgaacaggaacgccgaactccaacaactgat
A0A3Q1I5B7_BAX-02      atcaagattgcagaggaactgaacaggaacgccgaactccaacaactgat
                           ****** *** ** *** *    ** *  ** ******    ****

R9Y0N7_BAX-01          aaatgactcttcactcagtcccacaaaagacatatttatgaaagtcgcct
A0A3Q1I5B7_BAX-01      caaccaggttcaaagtaactgtgcacatgacgtcttcatgaccgtagtca
A0A3Q1I5B7_BAX-02      caaccaggttcaaagtaactgtgcacatgacgtcttcatgaccgtagtca
                        **  *   *  *   *      ** * *** * ** ****  ** * * 

R9Y0N7_BAX-01          tagagatcttctcagatggaaaattcaactggggcagagtggttgctcta
A0A3Q1I5B7_BAX-01      ggagcatctttgctgatggca---tcaactggggtcgagtggtggctctc
A0A3Q1I5B7_BAX-02      ggagcatctttgctgatggca---tcaactggggtcgagtggtggctctc
                            *****  * ***** *   **********  ******* ***** 

R9Y0N7_BAX-01          ttctactttgcctgtcgacttgtcatcaaagctgttgtgacccaggttcc
A0A3Q1I5B7_BAX-01      ttccatctggcctacaggctcatacacagggcactgaccaccaaccatct
A0A3Q1I5B7_BAX-02      ttccatctggcctacaggctcatacacagggcactgaccaccaaccatct
                       *** *  * ****   * **  *   **  **  *    *** *   ** 

R9Y0N7_BAX-01          tgatatcatcagaaccattatcagttggaccatggattacctccgggaac
A0A3Q1I5B7_BAX-01      agacaacatcaggatggtctttaactggttccttgaggtcatcagagagc
A0A3Q1I5B7_BAX-02      agacaacatcaggatggtctttaactggttccttgaggtcatcagagagc
                        ** * ****** *   *  * *  ***  * * **   * ** * ** *

R9Y0N7_BAX-01          atgtgataaa---ctggatcagggagcaaggtggctgggagggtattcgt
A0A3Q1I5B7_BAX-01      ---tgctctactcctggctcgtacagcaaggaggctgggtgggggt--ga
A0A3Q1I5B7_BAX-02      ---tgctctactcctggctcgtacagcaaggaggctgggtgggggt--ga
                          ** *  *   **** **    ******* ******* ***  *  * 

R9Y0N7_BAX-01          tcctactttggcacacccacatggcagacggtgg------------gggt
A0A3Q1I5B7_BAX-01      tcc----gtggcttctcccggtggaggacagtagccatagcagcatcagt
A0A3Q1I5B7_BAX-02      tcc----gtggcttctcccggtggaggacagtagccatagcagcatcagt
                       ***     ****    **   ***  *** ** *              **

R9Y0N7_BAX-01          tttcttggctggtgttctcaccactgttctcgtcattcgcaagatg---t
A0A3Q1I5B7_BAX-01      aatattag-tggcg-----acctttgtttactaca---ggaagacacgct
A0A3Q1I5B7_BAX-02      aatattag-tggcg-----acctttgtttactaca---ggaagacacgct
                         * ** * *** *     ***  ****  *  **   * ****     *

R9Y0N7_BAX-01          ga
A0A3Q1I5B7_BAX-01      ga
A0A3Q1I5B7_BAX-02      ga
                       **

© 1998-2019