Dataset for CDS BOK of Organism Amphiprion percula

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8SEB1_BOK-01      atggaggtgctgcgtcggtcctctgtgtttgctgcagaggtgctggatgt
A0A3P8RKE4_BOK-01      atggagatgttgcgccgctcctctgtgtttgcggctgaa---------gt
A0A3P8RKE4_BOK-02      atggagatgttgcgccgctcctctgtgtttgcggctgaa---------gt
                       ****** ** **** ** ************** ** **          **

A0A3P8SEB1_BOK-01      gtttgaccgatcgctgactgagaaggagctggtgtcccagtccaaagctc
A0A3P8RKE4_BOK-01      gtttgaccgatcgcccaccgacaaggagctggtgtcccaggccaaagctc
A0A3P8RKE4_BOK-02      gtttgaccgatcgcccaccgacaaggagctggtgtcccaggccaaagctc
                       **************  ** ** ****************** *********

A0A3P8SEB1_BOK-01      tgtgcagagactacatcctgtccagactcaaccagaacgggctgggatgg
A0A3P8RKE4_BOK-01      tgtgcagagactacatccactccaggctgaaccgggccgggatcggctgg
A0A3P8RKE4_BOK-02      tgtgcagagactacatccactccaggctgaaccgggccgggatcggctgg
                       ******************  ***** ** **** *  **** * ** ***

A0A3P8SEB1_BOK-01      tctaaaactgagatcaactttggtccgtccaatgcagcgctggccgaggt
A0A3P8RKE4_BOK-01      tctaaacccgagcacggactggctgcatcaggtgggactctgg--gagag
A0A3P8RKE4_BOK-02      tctaaacccgagcacggactggctgcatcaggtgggactctgg--gagag
                       ****** * ***  *    * * * * **   **   * ****  ***  

A0A3P8SEB1_BOK-01      gtctctggtg--cttctctgtcttggcgacgagctggagtgtatacagcc
A0A3P8RKE4_BOK-01      gtctctggtgtcctgctgtggctgggtgatgagttggaatatcttcgtcc
A0A3P8RKE4_BOK-02      gtctctggtgtcctgctgtggctgggtgatgagttggaatatcttcgtcc
                       **********  ** ** ** ** ** ** *** **** * * * *  **

A0A3P8SEB1_BOK-01      cagtctgtacaggaacgtggcgcggcagctcaacatttctgttgccatgg
A0A3P8RKE4_BOK-01      caacgtgtatcgcaacgtcgcccgacagctgaacatcacagtagcttcag
A0A3P8RKE4_BOK-02      caacgtgtatcgcaacgtcgcccgacagctgaacatcacagtagcttcag
                       **   ****  * ***** ** ** ***** *****  * ** **    *

A0A3P8SEB1_BOK-01      agaacatggtttcggatgccttcattggcgtggcaacggagatcttctct
A0A3P8RKE4_BOK-01      agagcattgtgtctgatgctttcctggctgtcgctgcagatattttctcc
A0A3P8RKE4_BOK-02      agagcattgtgtctgatgctttcctggctgtcgctgcagatattttctcc
                       *** *** ** ** ***** *** * *  ** **  * ** ** ***** 

A0A3P8SEB1_BOK-01      gcaggtataacatggggtaaggtggtatccatgtacgcagtagctggagc
A0A3P8RKE4_BOK-01      acaggtgtgacatggggtaaggtggtttccctgtacgctgtggcaggagc
A0A3P8RKE4_BOK-02      acaggtgtgacatggggtaaggtggtttccctgtacgctgtggcaggagc
                        ***** * ***************** *** ******* ** ** *****

A0A3P8SEB1_BOK-01      cctggcagtcgactgtgtcagacaaggccatccaaccacagtacacatct
A0A3P8RKE4_BOK-01      tctggcggtggactgtgttcgccacggtcatcctgctatggtccacacca
A0A3P8RKE4_BOK-02      tctggcggtggactgtgttcgccacggtcatcctgctatggtccacacca
                        ***** ** ********  * ** ** *****  * *  ** **** * 

A0A3P8SEB1_BOK-01      tagtggacagtctgggacagtttgttcgcaaattcctggttccctggctg
A0A3P8RKE4_BOK-01      ttgtggactgcatgggggagtttgtccgcaagagtctgacctcctggtta
A0A3P8RKE4_BOK-02      ttgtggactgcatgggggagtttgtccgcaagagtctgacctcctggtta
                       * ****** *  ****  ******* *****    ***    ***** * 

A0A3P8SEB1_BOK-01      aaaagacgaggaggatgggctgagattacaaaatgtgtggtgaa--gaag
A0A3P8RKE4_BOK-01      aagaggagaggaggctgggcagatatgaccaaatgtgtggtgaa--cact
A0A3P8RKE4_BOK-02      aagaggagaggaggctggctctacaagaggaaaacaacgataagttcacc
                       ** **  ******* ***    * *  *  ***     * * *    *  

A0A3P8SEB1_BOK-01      gatctca-----cccctgaacaaaactggttctc------ctctactgtg
A0A3P8RKE4_BOK-01      gatcccagtttccgttctcactgg-ctggtgtctg-----ctgtc-----
A0A3P8RKE4_BOK-02      gatgcaa------------actggactgggatacgcacaactctccaggg
                       ***   *            **    ****           ** *      

A0A3P8SEB1_BOK-01      gagtctctcacg---tacttcctgaccacaatgtacgtctacatcatgaa
A0A3P8RKE4_BOK-01      ---tgtgcctttggacactacctgaaggccgtcgtgttgtacctcctcag
A0A3P8RKE4_BOK-02      agatatgtcaggaaacactgc-----------------aaacctcccaag
                          * *  *       *** *                   ** **   * 

A0A3P8SEB1_BOK-01      ggagccgtga-------
A0A3P8RKE4_BOK-01      ggagaagtga-------
A0A3P8RKE4_BOK-02      cattacatggcgtctaa
                              **        

© 1998-2019