Dataset for CDS BAX-like of Organism Amphiprion percula

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8SEB1_BOK-01      atg-----------gaggtgctgcgtcggtcctctgtgtttgctgcagag
A0A3P8RKE4_BOK-01      atg-----------gagatgttgcgccgctcctctgtgtttgcggctgaa
A0A3P8RKE4_BOK-02      atg-----------gagatgttgcgccgctcctctgtgtttgcggctgaa
A0A3P8RS99_BAX-01      atgtc-tgacagccgagacgaggagaaatcac-------------cggga
A0A3P8TFP0_BAX-01      atggcatcacacccgggaggaggcg-----ac-------------caagg
                       ***           * *  *  * *      *             *    

A0A3P8SEB1_BOK-01      gtgctggatgtgtttgaccgatcgctgactgagaaggag--ctggt----
A0A3P8RKE4_BOK-01      ---------gtgtttgaccgatcgcccaccgacaaggag--ctggt----
A0A3P8RKE4_BOK-02      ---------gtgtttgaccgatcgcccaccgacaaggag--ctggt----
A0A3P8RS99_BAX-01      gagcaggaacctcagggcg--ccgtgggcggagaagatg--ttgtt-gat
A0A3P8TFP0_BAX-01      aaatggcaa----agaacagctcgtggaagtaggagctgctttgttaaag
                                        *    **       *  **  *   ** *    

A0A3P8SEB1_BOK-01      -gtcccagtccaaagctctgtgcag--------agactacatcctgtcca
A0A3P8RKE4_BOK-01      -gtcccaggccaaagctctgtgcag--------agactacatccactcca
A0A3P8RKE4_BOK-02      -gtcccaggccaaagctctgtgcag--------agactacatccactcca
A0A3P8RS99_BAX-01      gatcccatcttggagcagggagcagtggtcctcagagggtatgtgattga
A0A3P8TFP0_BAX-01      gacttcatttttgagc-gggttcagcggcatggagacggta--------a
                            **      ***   *  ***        ***    *        *

A0A3P8SEB1_BOK-01      gactcaaccagaacgggc--------tgggatggtct-------aaaact
A0A3P8RKE4_BOK-01      ggctgaaccgggccggga--------tcggctggtct-------aaaccc
A0A3P8RKE4_BOK-02      ggctgaaccgggccggga--------tcggctggtct-------aaaccc
A0A3P8RS99_BAX-01      acgtata--aacacagaagaccctagtcggcacgtctcctctgaggatct
A0A3P8TFP0_BAX-01      aactgta--gtgacaaga-----------gcacagct-------gggt--
                          *  *      *               *     **             

A0A3P8SEB1_BOK-01      gagatcaactttggtccgtccaatgcagcgctggcc--gaggtgtctctg
A0A3P8RKE4_BOK-01      gagcacggactggctgcatcaggtgggactctgg----gagaggtctctg
A0A3P8RKE4_BOK-02      gagcacggactggctgcatcaggtgggactctgg----gagaggtctctg
A0A3P8RS99_BAX-01      gggaggaaggccggatgaactacaggatccacaaattaaagaagtggtgg
A0A3P8TFP0_BAX-01      -ggaggagagctggttgaccca----agccat------aagaagc--tcg
                         *         *      *        *          **  *     *

A0A3P8SEB1_BOK-01      gtg-----cttctctgtcttggcgacgagctggagtgtatacagcccagt
A0A3P8RKE4_BOK-01      gtgtc---ctgctgtggctgggtgatgagttggaatatcttcgtcccaac
A0A3P8RKE4_BOK-02      gtgtc---ctgctgtggctgggtgatgagttggaatatcttcgtcccaac
A0A3P8RS99_BAX-01      atcag---cttctcaagatagctgatgaactga-----------------
A0A3P8TFP0_BAX-01      gtcagtgcctgcagcagattggagatgagctgg-----------------
                        *      ** *      * *  ** **  **                  

A0A3P8SEB1_BOK-01      ctgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagaa
A0A3P8RKE4_BOK-01      gtgtatcgcaacgtcgcccgacagctgaacatcacagtagcttcagagag
A0A3P8RKE4_BOK-02      gtgtatcgcaacgtcgcccgacagctgaacatcacagtagcttcagagag
A0A3P8RS99_BAX-01      ----acaggaacgctgagctccagcgacttatcaaccaggttcagggaaa
A0A3P8TFP0_BAX-01      ----atggaaatgtggaactccagaggatgataaatgattcctcactcag
                           *  * ** *  *  *  ***      **                * 

A0A3P8SEB1_BOK-01      catggtttcggatgccttcattggcgtggcaacggagatcttctctgcag
A0A3P8RKE4_BOK-01      cattgtgtctgatgctttcctggctgtcgctgcagatattttctccacag
A0A3P8RKE4_BOK-02      cattgtgtctgatgctttcctggctgtcgctgcagatattttctccacag
A0A3P8RS99_BAX-01      ctgtgctcaggacatcttcatgaaggttgccaggagcatctttgctgatg
A0A3P8TFP0_BAX-01      tcctacaaaagacgtgtttctgaaagttgctgttgagatcttttcagatg
                                 **    **  *    ** **       ** **  *    *

A0A3P8SEB1_BOK-01      gta---taacatggggtaaggtggtatccatgtacgcagtagc-------
A0A3P8RKE4_BOK-01      gtg---tgacatggggtaaggtggtttccctgtacgctgtggc-------
A0A3P8RKE4_BOK-02      gtg---tgacatggggtaaggtggtttccctgtacgctgtggc-------
A0A3P8RS99_BAX-01      gaa---ttaactggggtcgagtggtggctctctttcatctggcctacaga
A0A3P8TFP0_BAX-01      gaaaatttaactggggcagggtggttgcgctgttctactttgcctgtcga
                       *     * *  *****    *****  *  * *      * **       

A0A3P8SEB1_BOK-01      --------tggagccctggcagtcgactgtgtcagacaaggccatccaac
A0A3P8RKE4_BOK-01      --------aggagctctggcggtggactgtgttcgccacggtcatcctgc
A0A3P8RKE4_BOK-02      --------aggagctctggcggtggactgtgttcgccacggtcatcctgc
A0A3P8RS99_BAX-01      cttatatacaaggctctgactaccaac---------------catttaga
A0A3P8TFP0_BAX-01      ctcgtcattaaggctcttgtaacccaa---------------gttcctga
                                   ** **        *                  *     

A0A3P8SEB1_BOK-01      cacagtacacatcttagtggacagtctgggacagtttgttcgcaaattcc
A0A3P8RKE4_BOK-01      tatggtccacaccattgtggactgcatgggggagtttgtccgcaagagtc
A0A3P8RKE4_BOK-02      tatggtccacaccattgtggactgcatgggggagtttgtccgcaagagtc
A0A3P8RS99_BAX-01      gaacatcagaatggttatcagctgggttctccaagtcattagagagcagc
A0A3P8TFP0_BAX-01      tatcatcagaaccattattcattggaccatggactacctccgggaacatg
                        *   *    *   *  *     *        *     *  *  *     

A0A3P8SEB1_BOK-01      tggttccctggctgaaaagacgaggaggatgggctgagattacaaaatgt
A0A3P8RKE4_BOK-01      tgacctcctggttaaagaggagaggaggctgggcagatatgaccaaatgt
A0A3P8RKE4_BOK-02      tgacctcctggttaaagaggagaggaggctggctctacaagaggaaaaca
A0A3P8RS99_BAX-01      tctatgcctggcttgtgcagcagggaggctggg-----agggggtgatcc
A0A3P8TFP0_BAX-01      tgatcaactggatcagggagcaaggtggctggg-----aggg---tattc
                       *      **** *          ** ** ***      *       *   

A0A3P8SEB1_BOK-01      gtggtgaa--gaaggatctca-----cccctgaacaaaactggttctc--
A0A3P8RKE4_BOK-01      gtggtgaa--cactgatcccagtttccgttctcactgg-ctggtgtctg-
A0A3P8RKE4_BOK-02      acgataagttcaccgatgcaa------------actggactgggatacgc
A0A3P8RS99_BAX-01      gt---------agcttttctc-----------------gatggagggc--
A0A3P8TFP0_BAX-01      gttcccacttcggcactccca-----------------catggcagac--
                                       *                       ***       

A0A3P8SEB1_BOK-01      ----ctctactgtggagtctctcacg---tacttcctgaccacaatgtac
A0A3P8RKE4_BOK-01      ----ctgtc--------tgtgcctttggacactacctgaaggccgtcgtg
A0A3P8RKE4_BOK-02      acaactctccagggagatatgtcaggaaacactgc---------------
A0A3P8RS99_BAX-01      ----------agcagccatagtagcatcagtcgtactggtggcaactttt
A0A3P8TFP0_BAX-01      ----------agtgggagttttcttggcaggcgttctcaccactgttctc
                                                      *                  

A0A3P8SEB1_BOK-01      gtctacatcatgaaggagccgtga-------
A0A3P8RKE4_BOK-01      ttgtacctcctcagggagaagtga-------
A0A3P8RKE4_BOK-02      --aaacctcccaagcattacatggcgtctaa
A0A3P8RS99_BAX-01      gtttatctcaggaggacacgctga-------
A0A3P8TFP0_BAX-01      gtcattcgcaagatg------tga-------
                               *   *        **        

© 1998-2019