Dataset for CDS BOK of Organism Amphiprion ocellaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q1ANM8_BOK-01      atggagatgttgcgccgctcctctgtgtttgcggctgaa---------gt
A0A3Q1AZQ5_BOK-01      atggaggtgctgcgtcggtcctctgtgtttgctgcagaggtgctggatgt
                       ****** ** **** ** ************** ** **          **

A0A3Q1ANM8_BOK-01      gtttgaccgatcgcccaccgacaaggagctggtgtcccaggccaaagctc
A0A3Q1AZQ5_BOK-01      gtttgaccgatcgctgactgagaaggagctggtgtcccagtccaaagctc
                       **************  ** ** ****************** *********

A0A3Q1ANM8_BOK-01      tgtgcagagactacatccactccaggctgaaccggaccgggatcggctgg
A0A3Q1AZQ5_BOK-01      tgtgcagagactacatcctgtccagactcaaccagaacgggctgggatgg
                       ******************  ***** ** **** ** **** * ** ***

A0A3Q1ANM8_BOK-01      tctaaacccgagcacggactggctgcatcaggtgggactctgg--gagag
A0A3Q1AZQ5_BOK-01      tctaaaactgagatcaactttggtccgtccaatgcagcgctggccgaggt
                       ****** * ***  *    * * * * **   **   * ****  ***  

A0A3Q1ANM8_BOK-01      gtctctggtgtcctgctgtggctgggtgatgagttggaatatcttcgtcc
A0A3Q1AZQ5_BOK-01      gtctctggtg--cttctctgtctcggcgacgagctggagtgtatacagcc
                       **********  ** ** ** ** ** ** *** **** * * * *  **

A0A3Q1ANM8_BOK-01      caacgtgtatcgcaacgtcgcccgacagctgaacatcacagtagcttcag
A0A3Q1AZQ5_BOK-01      cagtctgtacaggaacgtggcgcggcagctcaacatttctgttgccatgg
                       **   ****  * ***** ** ** ***** *****  * ** **    *

A0A3Q1ANM8_BOK-01      agagcattgtgtctgatgccttcctggctgtcgctgcagatattttctcc
A0A3Q1AZQ5_BOK-01      agaacatggtttcggatgccttcattggcgtggcaacggagatcttctct
                       *** *** ** ** ********* * *  ** **  * ** ** ***** 

A0A3Q1ANM8_BOK-01      acaggtgtgacatgggggaaggtggtttccctgtacgctgtggcaggagc
A0A3Q1AZQ5_BOK-01      gcaggtataacatggggtaaggtggtatccatgtacgcagtagctggagc
                        ***** * ******** ******** *** ******* ** ** *****

A0A3Q1ANM8_BOK-01      tctggcggtggactgtgttcgccacggtcatcctgctatggtccacacca
A0A3Q1AZQ5_BOK-01      cctggcagtcgactgtgtcagacaaggccatccaaccacagtacacatct
                        ***** ** ********  * ** ** *****  * *  ** **** * 

A0A3Q1ANM8_BOK-01      ttgtggactgcatgggggagtttgtccgcaagagtctgacctcctggtta
A0A3Q1AZQ5_BOK-01      tagtggacagtctgggacagtttgttcgcaaattcctggttccctggctg
                       * ****** *  ****  ******* *****    ***    ***** * 

A0A3Q1ANM8_BOK-01      aagaggagaggaggctgggcagatatgaccaaatgtgtggtgaacactga
A0A3Q1AZQ5_BOK-01      aaaagacgaggaggatgggctgagattacaaaatgtgtggtgaagaagga
                       ** **  ******* ***** ** ** ** ************** *  **

A0A3Q1ANM8_BOK-01      tcccagtttccgttctcactggctggtgtctgctgtctttgcctttggac
A0A3Q1AZQ5_BOK-01      tctcacccctgaacaaaactggttctcctctactgtggagtctctcacgt
                       ** **            ***** *    *** ****     *  *     

A0A3Q1ANM8_BOK-01      actacctgaaggccgtcgtgt---tgtacctcctcagggagaagtga
A0A3Q1AZQ5_BOK-01      acttcctga---ccacaatgtacgtctacatcatgaaggagccgtga
                       *** *****   **    ***   * *** ** * * ****  ****

© 1998-2019