Dataset for CDS BAX-like of Organism Amphilophus citrinellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q0RFY4_BOK-01      at--------------------------------ggagatgttgcgccgc
A0A3Q0S613_BOK-01      at--------------------------------ggaagtcctgcgcaag
A0A3Q0R008_BAX-01      atgtacagcatcatagcatctgttctgtgcagcaggaaccattgcatcag
A0A3Q0S1T8_BAX-01      ----------------------------gaagtgggaactatt-------
                                                         ***     *       

A0A3Q0RFY4_BOK-01      tcctctgtg----tttgcctctgaa---------gtg-------------
A0A3Q0S613_BOK-01      tcatcagta----tttgcttcggaggtcttggacgtg-------------
A0A3Q0R008_BAX-01      agcgctggaaaacctcaggtctgaggatgctgatatgctcacttttcttc
A0A3Q0S1T8_BAX-01      -ttgctaaaggacttcatctatgag-------------------------
                           *         *    *  **                          

A0A3Q0RFY4_BOK-01      -------------------tttgatcgctcgcccaccgacaaggag---c
A0A3Q0S613_BOK-01      -------------------tttgaccgatcgctgactgaaaaggag---c
A0A3Q0R008_BAX-01      attgcatccaccacatgtatgtgatcacacgcataaacacag-aggaccc
A0A3Q0S1T8_BAX-01      -------------------cgtgttcggagacatggagacagcaatactg
                                            **  *     *      * *         

A0A3Q0RFY4_BOK-01      tggtgtcccag-----gccaaagcgctgtgcaggg-actacatccactcc
A0A3Q0S613_BOK-01      tggtgtcccag-----tccaaggcactgtgcagag-actacatcttgtcc
A0A3Q0R008_BAX-01      tagtcggcatgtcacctctgaggatctgggaggaaggccagatgaacaac
A0A3Q0S1T8_BAX-01      tagtgacgagg--------gagcagctgggtggaa-cccagctgactgac
                       * **      *         *    *** *  *    * *  *      *

A0A3Q0RFY4_BOK-01      aggctgaaccgggccgggatcggctggtccaagcctgagcacggactgtc
A0A3Q0S613_BOK-01      agactcacccagaacgggttgggatggtccaaaactgagctcaatttttc
A0A3Q0R008_BAX-01      aggatccacaaatcaaagaagtggtggaccag--------------t---
A0A3Q0S1T8_BAX-01      --------caaaaccataagaggcttgcacag--------------tgcc
                               *             * * *  **               *   

A0A3Q0RFY4_BOK-01      tgcgtcaggtgggactctgggagaaatatcgtcggtcctgctgtggctgg
A0A3Q0S613_BOK-01      tccctcgaatgcagcgctggctgaagtgtctatggtgcttctctgtcttg
A0A3Q0R008_BAX-01      tgcgcaaga--------------------------------------tag
A0A3Q0S1T8_BAX-01      tgcagcaga--------------------------------------ttg
                       * *                                            * *

A0A3Q0RFY4_BOK-01      gtgatgagttggagtgccttcgtcccaatgtgtaccgtaacgtcgcccga
A0A3Q0S613_BOK-01      gcgatgagctggagtgtatacagcctactttgtacaggaacgtggcgcgg
A0A3Q0R008_BAX-01      cggatgagttaa---------------------atcggaatgctgagctt
A0A3Q0S1T8_BAX-01      gagatgagctgg---------------------atggaaatgtagagctc
                         ****** *                       *  * ** *  *  *  

A0A3Q0RFY4_BOK-01      cagctgaacatcacagtggcgtcggagggcgtggtgtccgatgccttcct
A0A3Q0S613_BOK-01      cagctcaacatttcagttgccatggagaacatggtttcggatgccttcat
A0A3Q0R008_BAX-01      cagggactgatcaaccaggttcaggggaactgtgctcaggacatcttcat
A0A3Q0S1T8_BAX-01      caaaggatgatagatgactcttcacttagtcccacaaaagacatttttct
                       **       **                            **    **  *

A0A3Q0RFY4_BOK-01      ggctgtcgctgcagacattttctccacaggtg---tcacatggggaaagg
A0A3Q0S613_BOK-01      cggcgtagcaacagagattttctcagcaggca---taacatggggtaagg
A0A3Q0R008_BAX-01      ggcggtggcaagaaacatctttgctgatggca---tcaactggggtcgaa
A0A3Q0S1T8_BAX-01      gaaagtggccattgagatcttctcagatggaaaatttaactggggcaggg
                           ** **     * ** **  *    **     * *  *****     

A0A3Q0RFY4_BOK-01      tggtttccttgtacgctgtggcgggagccttggcggtggactgtgtacgc
A0A3Q0S613_BOK-01      tggtgtccatgtatgcagtagctggagccctggcagtggactgtgtcaga
A0A3Q0R008_BAX-01      ttgtggctctcttccatctggcctatagattaatatacaaggctcttacc
A0A3Q0S1T8_BAX-01      tggttgcactgttctactttgcatgccgactcgtcatcaaagctcttgta
                       * **  *  * *      * **        *        *   * *    

A0A3Q0RFY4_BOK-01      cacggtcatccagcaatggtccataccattgttgactgcatgggggagtt
A0A3Q0S613_BOK-01      caaggccatccagccacagtacacatcttagtggacagtctgggacagtt
A0A3Q0R008_BAX-01      accaatcatttagagaacattcgaatggtcatcagctgggttcttcaagt
A0A3Q0S1T8_BAX-01      acccaaattcctgatattatcagaaccattatcgtttggaccatggacta
                               *   *  *   *    *   *  *     *        *   

A0A3Q0RFY4_BOK-01      tgtccgcaagagtctgaccgcctggttaaaaaggagaggaggctgggtgg
A0A3Q0S613_BOK-01      tgtccgcaaattcctggttccctggctgaagagacggggagggtgggtaa
A0A3Q0R008_BAX-01      catcagagagcagctccacacctggctcgtgcagcaagggggctgggagg
A0A3Q0S1T8_BAX-01      ccttcgggaacatgtgatcaactggatcagggagcaaggtggctgggagg
                         *  *  *     *      **** *          ** ** ****   

A0A3Q0RFY4_BOK-01      atgtaacgaagtgcgtggtgaacactgaccccagcttccactctcactgg
A0A3Q0S613_BOK-01      gtatcacaaaatgtgtggtgaagaaggatcttgctcctgaagaaaactgg
A0A3Q0R008_BAX-01      gggt-----------------g-attggtagtttttctcg-----a-tgg
A0A3Q0S1T8_BAX-01      gtat-----------------tcgctcctactttggcacacccaca-tgg
                          *                                         * ***

A0A3Q0RFY4_BOK-01      ctggtgtctgctgtctgtgccttcgggcactacctgaaggcggtcgtgct
A0A3Q0S613_BOK-01      ctgtcatccacctttgagtctctcaaatacttcctgaccacgctatatgt
A0A3Q0R008_BAX-01      aggacagtggccattgtagcatcagta---gcattggtggtagcctttgt
A0A3Q0S1T8_BAX-01      cagacggttggggttttcttggcggga---gtcctcaccactgttcttgt
                         *          *                    *              *

A0A3Q0RFY4_BOK-01      acacctcctccgggagaagtga
A0A3Q0S613_BOK-01      ctacatcatgaaggagccgtaa
A0A3Q0R008_BAX-01      ttactaccggaaagtacgatga
A0A3Q0S1T8_BAX-01      ---cattcgcaagatgtga---
                          *                  

© 1998-2019