Dataset for CDS BAX-like of Organism Ailuropoda melanoleuca

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G1MDG6_BOK-01       a-------tggaggtgctgcggcgctcctc----------------------ggtcttcg
G1L3H7_BAK1-01      atggcatccgggcaaggcccaggtcctccc--aggcaggagtgtggagagacggccccat
G1M7S3_BAX-01       a------cccggcgagaggcggaacaacccagaggcagg-------------gggcccac
                    *         *    *   * *  *  * *                      ** *    

G1MDG6_BOK-01       cggc-------------ggagatcat--------ggacgcc-------tttgaccgc---
G1L3H7_BAK1-01      cttctacttctgcctcagaggagcaggtagcccgggacaccgaggaggtttt-ccgcagc
G1M7S3_BAX-01       cagct--------ctgagcagatcatgaagacaggggccct-------tttg-cttcag-
                    *  *             *  ** **         ** * *        ***  *  *   

G1MDG6_BOK-01       -------tcgcccaccgacaa--ggagctggtggcccaggccaaggcgccggcgcctgtc
G1L3H7_BAK1-01      tatgttttttaccgccatcggcaggagcaggaggctgagg---gggcggctgcgcctgct
G1M7S3_BAX-01       ---ggtttcatccaagatcgagcagggcgaatggggggag---agacacctgagctggc-
                           *   **     *     * **    **     *    * *  * * **  *  

G1MDG6_BOK-01       --cccggaggccg----------cctggcggaggtgtgcgccgtgctgc---tgcgcctg
G1L3H7_BAK1-01      gacccagaaatggtctccttgtccctagaacctagcagcaccatggggcaggtgggtcgg
G1M7S3_BAX-01       --cctggagcaggt-------gccccaggacgcatc--caccaagaagc---tgagcgag
                      **  **    *          **  *          * **  *  **   ** *   *

G1MDG6_BOK-01       ggggacga----gctggagctgatccggcccagcgtctaccgcaacgtggctcgccagct
G1L3H7_BAK1-01      cagctcgccatcatcggggatgacatcaaccagcg----ctacgactctgagttccagac
G1M7S3_BAX-01       tgtctcaaacgcatcggagatga-actggacagta----acatg-----gagttacagag
                         *         ** * ***       ***                *     ***  

G1MDG6_BOK-01       gaacat---ctccctgcagtctgaaaccgtggtgaccgacg------------------c
G1L3H7_BAK1-01      catgctgcagcacctacagccaacagcagagaacgcctatgagtatttcaccaagatcgc
G1M7S3_BAX-01       gatgat--------cgcagccgtggacacagactccccgcg----------cgaggtctt
                     *   *          *** *     *   *    **   *                   

G1MDG6_BOK-01       cttcctggctgtggcgtctcagatcttctctggaggcatcacatggggcaaggtggtgtc
G1L3H7_BAK1-01      ct--cgagctgcagcc----tgttt---gagagcggcatcaactggggccgagtggtggc
G1M7S3_BAX-01       tttccgagtggcagctgacatgttttccgatggcaacttcaactggggccgggttgttgc
                     *  *  *  *  **      * *        *   * ***  ******   ** **  *

G1MDG6_BOK-01       cctgtactcggtggccgcggggctggccgtagactgtgtgcggcaggcccagcctgccat
G1L3H7_BAK1-01      tct-----------cctgggcttcggctaccgcctg-gccct-----acacgtctacca-
G1M7S3_BAX-01       cct-----------cttctactttgccagcaaactg-gtgctcaaggccctgtgtaccaa
                     **           *         * *      *** *  *       *  *  * *** 

G1MDG6_BOK-01       ggtccacgctctcgtcgactgccttggggagtttgtgcgcaagaccctggcaccctggct
G1L3H7_BAK1-01      ---gcgtggactgacc---------gg---cttcctgggccaggt----g---acccgct
G1M7S3_BAX-01       ggtgcccgagctgatc---------aggaccatcatgggctggacactgg---acttcct
                        *  *  **   *          *     *  ** **  *      *    *   **

G1MDG6_BOK-01       gcgaagacg--------------------------cggtggatggaccgacgtcctcaag
G1L3H7_BAK1-01      tcgtagccgacttcatgctgcatcattgcattgcccggtggat---------tgcgcaga
G1M7S3_BAX-01       tcgagagcggc----tgctg---------------ggctggat---------ccaggacc
                     **    **                           * *****              *  

G1MDG6_BOK-01       tgtgtggtcagcacggagcccggcttccgctcccac--tggctcgtggccgcactctgca
G1L3H7_BAK1-01      ggggcggctggca--------ggtggcagccctgaacttgggaaatggccccatcct-ca
G1M7S3_BAX-01       agggtggttggga-------cggcctcctctcctactttggga--------caccc----
                     * * **   * *        **   *  * *  *   ***          **  *    

G1MDG6_BOK-01       gctttggccgcttcctgaaggctgctttcttcgtgct----gttgcc-------------
G1L3H7_BAK1-01      acgt-g--------ctgatagtt-ctgtctttg--------gttctc-ttgggccagtt-
G1M7S3_BAX-01       acgtgg--------cagacagtgaccatctttgtggctggagtgctcactgcgtcactca
                     * * *        * **  *   *  **** *        **   *             

G1MDG6_BOK-01       ---------ggagagatga---------
G1L3H7_BAK1-01      ---tgtggtacgaagattcttcaaatca
G1M7S3_BAX-01       ccatctgg-aaaaagatgggctga----
                                 ****           

© 1998-2018