Dataset for CDS PMAIP1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

47 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        atgcgttcttccggatcgcttggctctaggattcgggggctgttggaatc
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        ggcaggatgggaggaattggtaagaagccagccccgggcacatcaaggtc
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        -------------gcgcgggca------gcggcgggagc-----------
Q9GL49_PMAIP1-01        tcaccagtggccggtgtgggcagacgaggcgggaggagcttcgtggttcc
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        -----------------------------------gccaacctcagaggc
Q9GL49_PMAIP1-01        ttcggtccgcctcccgctgccgtccgaggaaaccaaccaacctcagaggc
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-01        -------------atgcccgggagaaaggcgcgtcggaacgcgccagtga
Q5U777_PMAIP1-01        -------------atgcccgggagaaaggcgcgtcggaacgcgccattga
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      ----------------atgcctggaaaggtgtgtaagagcgcgcagccga
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        ttttgggcgttcagggtgttgcttttctagctctctcccgcttgctcgct
Q9GL49_PMAIP1-01        ttttgggcgttcagggtgttgcttttctagctctctcccgcttgctcgct
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-01        acccaacgcgggcagagctaccacctgagttcgcagctcaactcaggaag
Q5U777_PMAIP1-01        acccaacgcgggcagagttaccgcctgaattcgcagctcagctcaggaag
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      actccacgcgggcagagctagaagttgagtgtgctgcccagctcaggaga
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        tctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgct
Q9GL49_PMAIP1-01        tctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgct
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A287AZR7_PMAIP1-      ------------ttatctaaggaaacatttatggccaaaggaaaagtgct
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-01        atcggagacaaagtgtattgcacgtggagtgcaccggacataactgtggt
Q5U777_PMAIP1-01        attggagataaagtgtactgcacgtggagtgcaccggacataactgcggt
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      gttggagacacactgaattccctgggttgcaccacggaggccttggaggt
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        cgggtccggggactgagttctcggagttttgcggcaaagttccggctgct
Q9GL49_PMAIP1-01        cgggtccggggactgagttctcggagttttgcggcaaagttccggctgct
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
                                                                          

A0A287AZR7_PMAIP1-      gtttgcaagtatgccacacagaagctccaataagaatacccag-------
A0A0P0HZF9_PMAIP1-      ----------atggcgaagaaagaga------------------------
Q0GKC8_PMAIP1-01        ----------atggcgaagaaagagc------------------------
A0A3B5RFA9_PMAIP1-      ----------cttcctgc--------------------cgctg-------
A0A1D5PAR2_PMAIP1-      -------atgatgcccggcaggacgattcgcaaacctgcgccg-------
Q9JM54_PMAIP1-01        tctggcgcagatgcctgg---gaagtcgcaaaagagcaggatg---agga
Q5U777_PMAIP1-01        tctggcgcagatgcctggcaagaagtcgcgaaagagcacgatgagaagaa
G1P8F9_PMAIP1-01        ----------atgcccgggaagaaggcgcgtaagaacgcgcag-------
G3T0P7_PMAIP1-01        ----------atgccggggaagaaggcacgcaagagcgcgcag-------
A0A286XF37_PMAIP1-      gcttgcagagatggctgggaagaaggcgcggaagagctcggag-------
A0A337SUX1_PMAIP1-      ----------atgcctgggaagaggacgcgtaagagcgcgcag-------
W5P738_PMAIP1-01        ----------atgcctggaaggagggctcgtaggagcgcccag-------
F1SMU1_PMAIP1-01        gtttgcggagatgcctggaaggaggtctcgtaggaacactcag-------
Q9GL49_PMAIP1-01        gtttgcggagatgcctggaaggaggtctcgtaggaacactcag-------
Q1PCT2_PMAIP1-01        ----------atgcccggccggaaggcgcgcaagagcgcgcag-------
A0A2K6EM90_PMAIP1-      ----------atgcccgtgaagaaggcgcgtaagaacgcgcaa-------
G1LIZ7_PMAIP1-01        ----------atgcctgggaagaaagcgcgtaagagcgcgcag-------
A0A2K6KJF2_PMAIP1-      ----------atgcctggaaagaaggcgcgcaagaacgcgcaa-------
A0A2K6NC45_PMAIP1-      ----------atgcctggaaagaaggcgcgcaagaacgcgcaa-------
A0A2K6KJF2_PMAIP1-      ----------atgcctggaaagaaggcgcgcaagaacgcgcaa-------
A0A2K6NC45_PMAIP1-      ----------atgcctggaaagaaggcgcgcaagaacgcgcaa-------
A0A2K5JY52_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgcgcaa-------
A0A2K5JY52_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgcgcaa-------
A0A2K5NJZ2_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgcgcaa-------
A0A2K6BV75_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgcgcaa-------
A0A2K5VPX2_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgcgcaa-------
A0A2K6BV75_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgcgcaa-------
A0A096MPU8_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgcgcaa-------
A0A2K5ZWH1_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgcgcaa-------
A0A1D5QGJ8_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgcgcaa-------
A0A0D9S003_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgcgcaa-------
A0A2K5VPX2_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgcgcaa-------
A0A2K5ZWH1_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgcgcaa-------
A0A096MPU8_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgcgcaa-------
A0A2K5CFK7_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagagcgcgcaa-------
F7GW45_PMAIP1-01        ----------atgcctgggaagaaggcgcgcaagagcgcgcaa-------
A0A2K6S6C4_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagagcgcgcaa-------
A0A2I3HX97_PMAIP1-      ----------aagcctgg---gagagcgcgcaggaacgctcaa-------
H2NWG2_PMAIP1-01        ----------atgcctggaaagaaggcgcgcaagaacgctcaa-------
A0A2I3SX38_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgctcaa-------
A0A2R9AKC9_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgctcaa-------
Q13794_PMAIP1-02        ----------atgcctgggaagaaggcgcgcaagaacgctcaa-------
A0A2I2YVQ5_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgctcaa-------
Q13794_PMAIP1-01        ----------atgcctgggaagaaggcgcgcaagaacgctcaa-------
A0A2R9AKC9_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgctcaa-------
A0A2I3SX38_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgctcaa-------
A0A2I2YVQ5_PMAIP1-      ----------atgcctgggaagaaggcgcgcaagaacgctcaa-------
                                      *                                   

A0A287AZR7_PMAIP1-      --acaaatcctctgaggttggcgctcccgccgc-----------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --ctgagctctgcgctcg--------------------------------
A0A1D5PAR2_PMAIP1-      -------cccgccgcg----------cctgcag-----------------
Q9JM54_PMAIP1-01        gcccaagcccaacccggg------tgccagcag-----------------
Q5U777_PMAIP1-01        gcccaagcccaacccggg------tgccagcag-----------------
G1P8F9_PMAIP1-01        --cctagcccgacgcggg------ccccggcag-----------------
G3T0P7_PMAIP1-01        --cccggccctgccggga------ccccggcag-----------------
A0A286XF37_PMAIP1-      --ccggatccggcacggg------cgcgcgcgg-----------------
A0A337SUX1_PMAIP1-      --ccgagccccgcgcggg------ccccggcag-----------------
W5P738_PMAIP1-01        --ccgagccccacgcggg------tcccggcag-----------------
F1SMU1_PMAIP1-01        --acgaaccctacgcgggtggccctcccgccag-----------------
Q9GL49_PMAIP1-01        --acgaaccctacgcgggtggccctcccgccag-----------------
Q1PCT2_PMAIP1-01        --cccggccccacgcggg------cccccgaag-----------------
A0A2K6EM90_PMAIP1-      --ccgagcccgacgcgga------ctcgggcag-----------------
G1LIZ7_PMAIP1-01        --gcgagtcctgcgcgga------cccggggtc-----------------
A0A2K6KJF2_PMAIP1-      --ccgagcccagcgcggg------ctcaggcag---gacctgcagggacg
A0A2K6NC45_PMAIP1-      --ccgagcccagcgcggg------ctcaggcag---gacctgcagggacg
A0A2K6KJF2_PMAIP1-      --ccgagcccagcgcggg------ctcaggcag-----------------
A0A2K6NC45_PMAIP1-      --ccgagcccagcgcggg------ctcaggcag-----------------
A0A2K5JY52_PMAIP1-      --ccgagcccagcgcggg------ctcaggcag-----------------
A0A2K5JY52_PMAIP1-      --ccgagcccagcgcggg------ctcaggcag------gtactgacccg
A0A2K5NJZ2_PMAIP1-      --ccgagcccaatgcggg------ctcaggcag-----------------
A0A2K6BV75_PMAIP1-      --ccgagcccaacgcggg------ctcaggcag-----------------
A0A2K5VPX2_PMAIP1-      --ccgagcccaacgcggg------ctcaggcag---gacaggcagggacg
A0A2K6BV75_PMAIP1-      --ccgagcccaacgcggg------ctcaggcag---gaccggcagggacg
A0A096MPU8_PMAIP1-      --ccgagcccaacgcggg------ctcaggcag---gacaggcagggacg
A0A2K5ZWH1_PMAIP1-      --ccgagcccaacgcggg------ctcaggcag---gacaggcagggacg
A0A1D5QGJ8_PMAIP1-      --ccgagcccaacgcggg------ctcaggcagcggggactgcagggacg
A0A0D9S003_PMAIP1-      --ccgagcccaacgcggg------ctcaggcag-----------------
A0A2K5VPX2_PMAIP1-      --ccgagcccaacgcggg------ctcaggcag-----------------
A0A2K5ZWH1_PMAIP1-      --ccgagcccaacgcggg------ctcaggcag-----------------
A0A096MPU8_PMAIP1-      --ccgagcccaacgcggg------ctcaggcag-----------------
A0A2K5CFK7_PMAIP1-      --ccgagcccctcgcggg------ctccagcag-----------------
F7GW45_PMAIP1-01        --ccgagccccgcgcggg------ctccagcag-----------------
A0A2K6S6C4_PMAIP1-      --ccgagccccgcgcggg------ctccagcag-----------------
A0A2I3HX97_PMAIP1-      --ccgagccccgcgccgg------ctccagcag-----------------
H2NWG2_PMAIP1-01        --ccgagccccgcgcggg------ctccggcag-----------------
A0A2I3SX38_PMAIP1-      --ccgagccccgcgcggg------ctccagcag---gac---------cg
A0A2R9AKC9_PMAIP1-      --ccgagccccgcgcggg------ctccagcag---gac---------cg
Q13794_PMAIP1-02        --ccgagccccgcgcggg------ctccagcag---gaccggcgggtacg
A0A2I2YVQ5_PMAIP1-      --ccgagccccgcgcggg------ctccagcag-----------------
Q13794_PMAIP1-01        --ccgagccccgcgcggg------ctccagcag-----------------
A0A2R9AKC9_PMAIP1-      --ccgagccccgcgcggg------ctccagcag-----------------
A0A2I3SX38_PMAIP1-      --ccgagccccgcgcggg------ctccagcag-----------------
A0A2I2YVQ5_PMAIP1-      --ccgagccccgcgcggg------ctccagcag---gac---------cg
                                                                          

A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      gcagggacggcgagggaccaagccggattagggattgggatgcagctgca
A0A2K6NC45_PMAIP1-      gcagggacggcgagggaccaagccggattagggattgggatgcagctgca
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      ctggggccagcgaagacccaggctgg------------------gcgggg
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      gcagggacggcgagggaccaggccggatttgggattgggatgcagctgca
A0A2K6BV75_PMAIP1-      gcagggacggcgagggaccaggccggatttgggattgggatgcagctgca
A0A096MPU8_PMAIP1-      gcagggacggcgagggaccaggccggatttgggattgggatgcagctgca
A0A2K5ZWH1_PMAIP1-      gcagggacggcgagggaccaggccggatttgggattgggatgcaactgca
A0A1D5QGJ8_PMAIP1-      gcagggacggcgagggaccaggccggatttgggattgggatgcagctgca
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      gcgggtacggcgagggaccaagccggatttgggattgggatgcagctgcg
A0A2R9AKC9_PMAIP1-      gcgggtacggcgagggaccaagccggatttgggattgggatgcagctgcg
Q13794_PMAIP1-02        gcgggtacggcgagggaccaagccggatttgcgattgggatgcagctgcg
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      gcgggtacggcgagggaccaagccggctttgggattgagatgcagctgcg
                                                                          

A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      tttcaccagaggcaaaaagctc------------ctctcctcctccccac
A0A2K6NC45_PMAIP1-      tttcaccagaggcaaaaagctc------------ctctcctcctccccac
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      tcggggccggggcaaaaagctc------------ct---ctcctccccac
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      ttacaccagaggcaaaaagctc------------gtctcctcctccccac
A0A2K6BV75_PMAIP1-      ttacaccagaggcaaaaagctc------------gtctcctcctccccac
A0A096MPU8_PMAIP1-      tttcaccagaagcaaaaagctc------------gtctcctcctccccac
A0A2K5ZWH1_PMAIP1-      tttcaccagaggcaaaaagctc------------gtctcctcctccccac
A0A1D5QGJ8_PMAIP1-      ttacaccagaggcaaaaagctc------------gtctcctcctccccac
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      tttcaccaggggcaaaaagctcctttcctcctctctttcctcctggccac
A0A2R9AKC9_PMAIP1-      tttcaccaggggcaaaaagctcctttcctcctc---ttcctcctcgccac
Q13794_PMAIP1-02        tttcaccaggggcaaaaagctcctttcctcctctctttcctcctcgccac
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      tttcaccaggggcaaaaagctc------------ctttcctcctcgccac
                                                                          

A0A287AZR7_PMAIP1-      -------------------------------------tgcccgc---ggt
A0A0P0HZF9_PMAIP1-      -------------------------------------aaaccgctgttgt
Q0GKC8_PMAIP1-01        -------------------------------------aaaccgctgtagt
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      -------------------------------------agcgggacgcggt
Q9JM54_PMAIP1-01        -------------------------------------acttgaa---gga
Q5U777_PMAIP1-01        -------------------------------------acctgaa---gga
G1P8F9_PMAIP1-01        -------------------------------------aggctga---aat
G3T0P7_PMAIP1-01        ----------------------------gtactcaacagcgcgatgttgt
A0A286XF37_PMAIP1-      -------------------------------------agctgga---agt
A0A337SUX1_PMAIP1-      -------------------------------------agcccga---agt
W5P738_PMAIP1-01        -------------------------------------atcctga---agt
F1SMU1_PMAIP1-01        -------------------------------------atcctga---agt
Q9GL49_PMAIP1-01        -------------------------------------atcctga---agt
Q1PCT2_PMAIP1-01        -------------------------------------agctcga---agt
A0A2K6EM90_PMAIP1-      -------------------------------------agatcga---aga
G1LIZ7_PMAIP1-01        -------------------------------------agcccga---agt
A0A2K6KJF2_PMAIP1-      ttgcccttccgcggggccacgaggaacaagtgcaagtagctcga---agt
A0A2K6NC45_PMAIP1-      ttgcccttccgcggggccacgaggaacaagtgcaagtagctcga---agt
A0A2K6KJF2_PMAIP1-      -------------------------------------agctcga---agt
A0A2K6NC45_PMAIP1-      -------------------------------------agctcga---agt
A0A2K5JY52_PMAIP1-      -------------------------------------agctcga---agt
A0A2K5JY52_PMAIP1-      ttgcccttccgcggggccacgaggaacaagtgcaagtagctcga---agt
A0A2K5NJZ2_PMAIP1-      -------------------------------------agctcga---agt
A0A2K6BV75_PMAIP1-      -------------------------------------agctcga---agt
A0A2K5VPX2_PMAIP1-      ttgtccttccgcggggccacgaggaacaagtgcaagtagctcga---agt
A0A2K6BV75_PMAIP1-      ttgtccttccgcggggccacgaggaacaagtgcaagtagctcga---agt
A0A096MPU8_PMAIP1-      ttgcccttccgcggggccacgaggaacaagtgcaagtagctcga---agt
A0A2K5ZWH1_PMAIP1-      ttgcccttccgcggggccacgaggaacaagtgcaagtagctcga---agt
A0A1D5QGJ8_PMAIP1-      ttgtccttccgcggggccacgaggaacaagtgcaagtagctcga---agt
A0A0D9S003_PMAIP1-      -------------------------------------agctcga---agt
A0A2K5VPX2_PMAIP1-      -------------------------------------agctcga---agt
A0A2K5ZWH1_PMAIP1-      -------------------------------------agctcga---agt
A0A096MPU8_PMAIP1-      -------------------------------------agctcga---agt
A0A2K5CFK7_PMAIP1-      -------------------------------------accttga---agt
F7GW45_PMAIP1-01        -------------------------------------accttga---agt
A0A2K6S6C4_PMAIP1-      -------------------------------------accttga---agt
A0A2I3HX97_PMAIP1-      -------------------------------------agctgga---agt
H2NWG2_PMAIP1-01        -------------------------------------agctgga---agt
A0A2I3SX38_PMAIP1-      ttgcccttccccgggggcacgaggaacaagtgcaagtagctgga---agt
A0A2R9AKC9_PMAIP1-      ttgcccttccccggggccacgaggaacaagcgcaagtagctgga---agt
Q13794_PMAIP1-02        ttgcccttccccggggccacgaggaacaagtgcaagtagctgga---agt
A0A2I2YVQ5_PMAIP1-      -------------------------------------agctgga---agt
Q13794_PMAIP1-01        -------------------------------------agctgga---agt
A0A2R9AKC9_PMAIP1-      -------------------------------------agctgga---agt
A0A2I3SX38_PMAIP1-      -------------------------------------agctgga---agt
A0A2I2YVQ5_PMAIP1-      ttgcccttccccggggccacgaggaacaagtgcaagtagctgga---agt
                                                                          

A0A287AZR7_PMAIP1-      ---caaatgcagaatagggctaaggcgtgtgggcacaaagctggctatca
A0A0P0HZF9_PMAIP1-      ---cgagtgcgcgcaacagttgcgcacaattggagatctctttgactgga
Q0GKC8_PMAIP1-01        ---agagtgcgcgcagcagttgcgaaacattggagatctgttgaactgga
A0A3B5RFA9_PMAIP1-      ---cgag------------ctgcggcaagttggagataaattgtactgga
A0A1D5PAR2_PMAIP1-      ggctgagtgcgcgctggagctgcgcaggatcggagacaaggcggacctgc
Q9JM54_PMAIP1-01        ---cgagtgtgc---tcaactccggaggattggagacaaagtgaatttac
Q5U777_PMAIP1-01        ---cgagtgtga---tcaactgcggagaattggagacaaagtgaatttac
G1P8F9_PMAIP1-01        ---tgagtgtgcccttcaattaaggagaattggagacaagctgagtttcc
G3T0P7_PMAIP1-01        ---cgagtgtgctattcaactcaggagaattggagacaaaattaatttcc
A0A286XF37_PMAIP1-      ---cgagtgtgctgctcagttgagaagaattggagataaactgaatttcc
A0A337SUX1_PMAIP1-      ---ggaatgtgccatgcagctccggagatttggagacaaactgaatttcc
W5P738_PMAIP1-01        ---tgagtgtgccattcagttgaggagaattggagacaaactgaatttcc
F1SMU1_PMAIP1-01        ---cgagtgtgccattcagttcagaaggattggagacaaactgaacttcc
Q9GL49_PMAIP1-01        ---cgagtgtgccattcagttcagaaggattggagacaaactgaacttcc
Q1PCT2_PMAIP1-01        ---ggagtgtgccattcagctcaggaaatttggagacaaactgaatttcc
A0A2K6EM90_PMAIP1-      ---ggagtgtgcccttcaactcaggagacttggagacaaactgcatttcc
G1LIZ7_PMAIP1-01        ---ggagtgcgccattcaactcaggagatttggagacaaactgaatttcc
A0A2K6KJF2_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2K6NC45_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2K6KJF2_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2K6NC45_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2K5JY52_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2K5JY52_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2K5NJZ2_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2K6BV75_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactaaacttcc
A0A2K5VPX2_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2K6BV75_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactaaacttcc
A0A096MPU8_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2K5ZWH1_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A1D5QGJ8_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A0D9S003_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2K5VPX2_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2K5ZWH1_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A096MPU8_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2K5CFK7_PMAIP1-      ---cgagtgtgccactcaactcaggagatttggagacaaactaaatttcc
F7GW45_PMAIP1-01        ---cgagtgtgccactcaactcaggagatttggagacaaactgaatttcc
A0A2K6S6C4_PMAIP1-      ---cgagtgtgccattcaactcaggagatttggagacaaactgaatttcc
A0A2I3HX97_PMAIP1-      ---tgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
H2NWG2_PMAIP1-01        ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2I3SX38_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2R9AKC9_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
Q13794_PMAIP1-02        ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2I2YVQ5_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
Q13794_PMAIP1-01        ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2R9AKC9_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2I3SX38_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
A0A2I2YVQ5_PMAIP1-      ---cgagtgtgctactcaactcaggagatttggagacaaactgaacttcc
                             *              *  *     * **                 

A0A287AZR7_PMAIP1-      ggcagcagataacaaatttcataatcttttttt---------ttttttta
A0A0P0HZF9_PMAIP1-      aatacaagttactggaaatcataatcgcgctcc----------------a
Q0GKC8_PMAIP1-01        aatataagttactggagctcatagtaacactcc----------------a
A0A3B5RFA9_PMAIP1-      gatacaaactcctggaaatgctgctcaagaactatgagactctcaacaaa
A0A1D5PAR2_PMAIP1-      agcagaaagtcctgaacctcatcacgaaactgt---------tctgcccc
Q9JM54_PMAIP1-01        ggcagaaacttctgaatttgatttccaagctct---------tcaattta
Q5U777_PMAIP1-01        ggcagaaacttctgaattttatttccaagctct---------tcaattta
G1P8F9_PMAIP1-01        tgcagaaacttctgaatctgatgtacaaactct---------ttggctca
G3T0P7_PMAIP1-01        ggcagaaacttctgaatgtgatatgcaagctct---------tctgctca
A0A286XF37_PMAIP1-      agcagaaacttatgtatttgatttccaaactca---------tcagtttg
A0A337SUX1_PMAIP1-      gacagaagcttatgaatctgatatccaaactct---------tccgctcg
W5P738_PMAIP1-01        ggcagaaacttgtgaatctgatagccaaactcc---------tccgctca
F1SMU1_PMAIP1-01        ggcagaaacttctgaatctgatagccaaactct---------tccgccta
Q9GL49_PMAIP1-01        ggcagaaacttctgaatctgatagccaaactct---------tccgtcta
Q1PCT2_PMAIP1-01        ggcagaaacttctgaatctgttatccaaactct---------tccgctca
A0A2K6EM90_PMAIP1-      agcagaaacttctgaatctgatagccaaacttt---------tccgctca
G1LIZ7_PMAIP1-01        ggcagaaacttctgaatctgatatccaaactct---------tccgctca
A0A2K6KJF2_PMAIP1-      ggcagaaacttttgaatctgatagccaaactct---------tctgctca
A0A2K6NC45_PMAIP1-      ggcagaaacttttgaatctgatagccaaactct---------tctgctca
A0A2K6KJF2_PMAIP1-      ggcagaaacttttgaatctgatagccaaactct---------tctgctca
A0A2K6NC45_PMAIP1-      ggcagaaacttttgaatctgatagccaaactct---------tctgctca
A0A2K5JY52_PMAIP1-      ggcagaaacttctgaatctgatagccaaactct---------tctgctca
A0A2K5JY52_PMAIP1-      ggcagaaacttctgaatctgatagccaaactct---------tctgctca
A0A2K5NJZ2_PMAIP1-      ggcagaaacttctgaatctgatagccaaactct---------tctgctca
A0A2K6BV75_PMAIP1-      ggcagaaacttctgaatctgatagccaaactct---------tctgctca
A0A2K5VPX2_PMAIP1-      ggcagaaacttctgaatctgatagccaaactct---------tctgctca
A0A2K6BV75_PMAIP1-      ggcagaaacttctgaatctgatagccaaactct---------tctgctca
A0A096MPU8_PMAIP1-      ggcagaaacttctgaatctgatagccaaactct---------tctgctca
A0A2K5ZWH1_PMAIP1-      ggcagaaacttctgaatctgatagccaaactct---------tctgctca
A0A1D5QGJ8_PMAIP1-      ggcagaaacttctgaatctgatagccaaactct---------tctgctca
A0A0D9S003_PMAIP1-      ggcagaaacttctgaatctgatagccaaactct---------tctgctca
A0A2K5VPX2_PMAIP1-      ggcagaaacttctgaatctgatagccaaactct---------tctgctca
A0A2K5ZWH1_PMAIP1-      ggcagaaacttctgaatctgatagccaaactct---------tctgctca
A0A096MPU8_PMAIP1-      ggcagaaacttctgaatctgatagccaaactct---------tctgctca
A0A2K5CFK7_PMAIP1-      ggcagaaacttctgaatctgatatccaaactct---------tctgctca
F7GW45_PMAIP1-01        ggcagaaacttctgaatctgatatccaaactct---------tctgctca
A0A2K6S6C4_PMAIP1-      ggcagaaacttctgaatctgatatccaaactct---------tctgctca
A0A2I3HX97_PMAIP1-      ggcagaaacttctgaatctgatatccaaactct---------tctgctca
H2NWG2_PMAIP1-01        ggcagaaacttctgaatctgatatccaaactct---------tctgctca
A0A2I3SX38_PMAIP1-      ggcagaaacttctgaatctgatatccaaactct---------tctgctca
A0A2R9AKC9_PMAIP1-      ggcagaaacttctgaatctgatatccaaactct---------tctgctca
Q13794_PMAIP1-02        ggcagaaacttctgaatctgatatccaaactct---------tctgctca
A0A2I2YVQ5_PMAIP1-      ggcagaaacttctgaatctgatatccaaactct---------tctgctca
Q13794_PMAIP1-01        ggcagaaacttctgaatctgatatccaaactct---------tctgctca
A0A2R9AKC9_PMAIP1-      ggcagaaacttctgaatctgatatccaaactct---------tctgctca
A0A2I3SX38_PMAIP1-      ggcagaaacttctgaatctgatatccaaactct---------tctgctca
A0A2I2YVQ5_PMAIP1-      ggcagaaacttctgaatctgatatccaaactct---------tctgctca
                           *  *  *     *  *  *                            

A0A287AZR7_PMAIP1-      gggccg--------------------------------------------
A0A0P0HZF9_PMAIP1-      gaaagcgcagacggacggaaaaagatga----------------------
Q0GKC8_PMAIP1-01        gaaaatacaaatggaggggaagcgatga----------------------
A0A3B5RFA9_PMAIP1-      ataaaa-------------------tga----------------------
A0A1D5PAR2_PMAIP1-      aaaacg-------------------tga----------------------
Q9JM54_PMAIP1-01        gtaacc-------------------tga----------------------
Q5U777_PMAIP1-01        ataacc-------------------tga----------------------
G1P8F9_PMAIP1-01        ggaacc-------------------tga----------------------
G3T0P7_PMAIP1-01        ggcacc-------------------tga----------------------
A0A286XF37_PMAIP1-      gtaacc-------------------tga----------------------
A0A337SUX1_PMAIP1-      ggaacc-------------------tga----------------------
W5P738_PMAIP1-01        ggaact-------------------tga----------------------
F1SMU1_PMAIP1-01        ggaacc-------------------tga----------------------
Q9GL49_PMAIP1-01        ggaacc-------------------tga----------------------
Q1PCT2_PMAIP1-01        ggaacc-------------------tga----------------------
A0A2K6EM90_PMAIP1-      ggaact-------------------tga----------------------
G1LIZ7_PMAIP1-01        ggaacc--------------------------------------------
A0A2K6KJF2_PMAIP1-      ggaacc-------------------tgactgcatcaaaaacttgcataag
A0A2K6NC45_PMAIP1-      ggaacc-------------------tgactgcatcaaaaacttgcataag
A0A2K6KJF2_PMAIP1-      ggaacc-------------------tga----------------------
A0A2K6NC45_PMAIP1-      ggaacc-------------------tga----------------------
A0A2K5JY52_PMAIP1-      ggaacc-------------------tga----------------------
A0A2K5JY52_PMAIP1-      ggaacc-------------------tgactgcaacaaaaacttgcatgag
A0A2K5NJZ2_PMAIP1-      ggaacc-------------------tga----------------------
A0A2K6BV75_PMAIP1-      ggaacc-------------------tga----------------------
A0A2K5VPX2_PMAIP1-      ggaacc-------------------tgactgcatcaaaaacttgcataag
A0A2K6BV75_PMAIP1-      ggaacc-------------------tgactgcatcaaaaacttgcataag
A0A096MPU8_PMAIP1-      ggaacc-------------------tgactgcatcaaaaacttgcatagg
A0A2K5ZWH1_PMAIP1-      ggaacc-------------------tgactgcatcaaaaacttgcataag
A0A1D5QGJ8_PMAIP1-      ggaacc-------------------tgactgcatcaaaaacttgcataag
A0A0D9S003_PMAIP1-      ggaacc--------------------------------------------
A0A2K5VPX2_PMAIP1-      ggaacc-------------------tga----------------------
A0A2K5ZWH1_PMAIP1-      ggaacc-------------------tga----------------------
A0A096MPU8_PMAIP1-      ggaacc-------------------tga----------------------
A0A2K5CFK7_PMAIP1-      ggaacc-------------------tga----------------------
F7GW45_PMAIP1-01        ggaacc-------------------tga----------------------
A0A2K6S6C4_PMAIP1-      ggaacc-------------------tga----------------------
A0A2I3HX97_PMAIP1-      ggaacc-------------------tga----------------------
H2NWG2_PMAIP1-01        ggaacc-------------------tga----------------------
A0A2I3SX38_PMAIP1-      ggaacc-------------------tgactgcatcaaaaacttgcatgag
A0A2R9AKC9_PMAIP1-      ggaacc-------------------tgactgcatcaaaaacttgcatgag
Q13794_PMAIP1-02        ggaacc-------------------tgactgcatcaaaaacttgcatgag
A0A2I2YVQ5_PMAIP1-      ggaacc-------------------tga----------------------
Q13794_PMAIP1-01        ggaacc-------------------tga----------------------
A0A2R9AKC9_PMAIP1-      ggaacc-------------------tga----------------------
A0A2I3SX38_PMAIP1-      ggaacc-------------------tga----------------------
A0A2I2YVQ5_PMAIP1-      ggaacc-------------------tgactgcatcaaaaacttgcatgag
                                                                          

A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      gggactccaaacgagaatttttctcaggaggtgcacgtttcatcaatttg
A0A2K6NC45_PMAIP1-      gggactccaaacgagaatttttctcaggaggtgcacgtttcatcaatttg
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      gggactccaaaagagaatttttctcaggaggtgcacatttcatcaatttg
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      gggactccaaaagagactttttctcaggaggtgcacacttcatcaatttg
A0A2K6BV75_PMAIP1-      gggactccaaaagagactttttctcaggaggtgcacacttcatcaatttg
A0A096MPU8_PMAIP1-      gggactccaaaagagactttttctcaggagatgcacacttcatcaatttg
A0A2K5ZWH1_PMAIP1-      gggactccaaaagagactttttctcaggaggtgcatacttcataaatttg
A0A1D5QGJ8_PMAIP1-      gggactccaaaagagactttttctcaggaggtgcacacttcatcaatttg
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      gggactccttcaaaagagttttctcaggaggtgcacgtttcatcaatttg
A0A2R9AKC9_PMAIP1-      gggactccttcaaaagagttttctcaggaggtgcacgtttcatcaatttg
Q13794_PMAIP1-02        gggactccttcaaaagagttttctcaggaggtgcacgtttcatcaatttg
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      gggactccttcaaaagagttttctcaggaggtgcacatttcatcagtttg
                                                                          

A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
A0A3B5RFA9_PMAIP1-      --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      aagaaagattgcattgtaattgg---------------------------
A0A2K6NC45_PMAIP1-      aagaaagattgcattgtaattgg---------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      aagcaagattgcattgtaat------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      aagaaagattgcattgtaattgg---------------------------
A0A2K6BV75_PMAIP1-      aagaaagattgcattgtaattgg---------------------------
A0A096MPU8_PMAIP1-      aagaaagattgcattgtaattgg---------------------------
A0A2K5ZWH1_PMAIP1-      aagaaagattgcattgtaattgg---------------------------
A0A1D5QGJ8_PMAIP1-      aagaaagattgcattgtaat------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      aagaaagactgcattgtaattgg---------------------------
A0A2R9AKC9_PMAIP1-      aagaaagactgcattgtaattgg---------------------------
Q13794_PMAIP1-02        aagaaagactgcattgtaattga---------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      aagaaagactgcattgtaattgggaggaatgtgaaggtgcattcatgggt
                                                                          

A0A287AZR7_PMAIP1-      ------------------------------------
A0A0P0HZF9_PMAIP1-      ------------------------------------
Q0GKC8_PMAIP1-01        ------------------------------------
A0A3B5RFA9_PMAIP1-      ------------------------------------
A0A1D5PAR2_PMAIP1-      ------------------------------------
Q9JM54_PMAIP1-01        ------------------------------------
Q5U777_PMAIP1-01        ------------------------------------
G1P8F9_PMAIP1-01        ------------------------------------
G3T0P7_PMAIP1-01        ------------------------------------
A0A286XF37_PMAIP1-      ------------------------------------
A0A337SUX1_PMAIP1-      ------------------------------------
W5P738_PMAIP1-01        ------------------------------------
F1SMU1_PMAIP1-01        ------------------------------------
Q9GL49_PMAIP1-01        ------------------------------------
Q1PCT2_PMAIP1-01        ------------------------------------
A0A2K6EM90_PMAIP1-      ------------------------------------
G1LIZ7_PMAIP1-01        ------------------------------------
A0A2K6KJF2_PMAIP1-      ------------------------------------
A0A2K6NC45_PMAIP1-      ------------------------------------
A0A2K6KJF2_PMAIP1-      ------------------------------------
A0A2K6NC45_PMAIP1-      ------------------------------------
A0A2K5JY52_PMAIP1-      ------------------------------------
A0A2K5JY52_PMAIP1-      ------------------------------------
A0A2K5NJZ2_PMAIP1-      ------------------------------------
A0A2K6BV75_PMAIP1-      ------------------------------------
A0A2K5VPX2_PMAIP1-      ------------------------------------
A0A2K6BV75_PMAIP1-      ------------------------------------
A0A096MPU8_PMAIP1-      ------------------------------------
A0A2K5ZWH1_PMAIP1-      ------------------------------------
A0A1D5QGJ8_PMAIP1-      ------------------------------------
A0A0D9S003_PMAIP1-      ------------------------------------
A0A2K5VPX2_PMAIP1-      ------------------------------------
A0A2K5ZWH1_PMAIP1-      ------------------------------------
A0A096MPU8_PMAIP1-      ------------------------------------
A0A2K5CFK7_PMAIP1-      ------------------------------------
F7GW45_PMAIP1-01        ------------------------------------
A0A2K6S6C4_PMAIP1-      ------------------------------------
A0A2I3HX97_PMAIP1-      ------------------------------------
H2NWG2_PMAIP1-01        ------------------------------------
A0A2I3SX38_PMAIP1-      ------------------------------------
A0A2R9AKC9_PMAIP1-      ------------------------------------
Q13794_PMAIP1-02        ------------------------------------
A0A2I2YVQ5_PMAIP1-      ------------------------------------
Q13794_PMAIP1-01        ------------------------------------
A0A2R9AKC9_PMAIP1-      ------------------------------------
A0A2I3SX38_PMAIP1-      ------------------------------------
A0A2I2YVQ5_PMAIP1-      gcccttggaaacggaagatggaatacatcaaagtga
                                                            

© 1998-2019