Dataset for CDS HRK of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

24 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1U7R468_HRK-01      atgtgcccgtgtccccggcatcgcggccacgggcctccggccgtgtgcgg
P62816_HRK-03          atgtgcccgtgtccccggcatcgcggccgcgggcccccggccgtgtgcgg
P62817_HRK-01          atgtgcccgtgtccccggcatcgcggccgcgggcccccggccgtgtgcgg
F7G1G0_HRK-01          atgtgcccgtgtcccctgcaccgcggtcgcggtcccccggcggtgtgcgc
G3UH24_HRK-01          atgtgtccgtgccccctgcaccgtggccgcggccccccggccgtgtgcgc
A0A287A5N9_HRK-01      atgtgtccgtgccccctgcaccgcggccgcggccccccagccgtgtgcgc
G1T7W1_HRK-01          atgtgcccgtgccccctgcaccgtggccgcggccccccggccgtgtgcgc
H2NIS8_HRK-01          atgtgcccgtgtcccctgcaccgcgaccgcggccccccggccgtgtgcgc
A0A2K5KZ69_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcga
A0A096N944_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A0D9SC73_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A2K6AYL7_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A1D5R1E4_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
H2Q6Y8_HRK-01          atgtgcccgtgccccctgcaccgcggccgcgaccccccggccgtgtgcgc
G3QTJ6_HRK-01          atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
O00198_HRK-01          atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
G1QHD8_HRK-01          atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A2K5BYA0_HRK-01      atgtgcccgtgccccctgcaccgcggtcgcggccccccggccgtttgcgc
U3E722_HRK-01          atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtttgcgc
G3MWR6_HRK-01          atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
E2RLD4_HRK-01          atgtgcccgtgccccctgcaccgcggccgcgggcccccggccgtgtgcgc
A0A337SQ56_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
H0Y001_HRK-01          atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
A0A2K6GL98_HRK-01      atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgc
                       ***** ***** **** *** ** *  * **  ** ** ** ** **** 

A0A1U7R468_HRK-01      ttgcggcgacactcgccccgggctgcgc---tgggcggcggcacaggtga
P62816_HRK-03          ttgcggcgacgctcgccccgggctgcgc---tgggcggcggcgcaggtga
P62817_HRK-01          ttgcggcgacgctcgccccgggctgcgc---tgggcggcggcgcaggtga
F7G1G0_HRK-01          ctgcagctcggaccgcctggaacagcgcgcggcggcggcagcacagctca
G3UH24_HRK-01          ctgcagcgcaggtcgcctgggtctgcgc---tcgtccgccgcgcagctca
A0A287A5N9_HRK-01      ttgcagcgcgagccgcctgggtctgcgc---tcctccgccgcgcagctca
G1T7W1_HRK-01          ctgcagcgcgggccgcctggggctgcgc---tcggccgccgcgcagctca
H2NIS8_HRK-01          ctgcagcgcgggtcgcctggggctgcgc---tcgtccgccgcgcagctca
A0A2K5KZ69_HRK-01      ctgcagcgcgggtcgtttggggctgcgc---tcgtccgccgcgcagctca
A0A096N944_HRK-01      ctgcagcgcgggtcgtttggggctgcgc---tcgtccgccgcgcagctca
A0A0D9SC73_HRK-01      ctgcagcgcgggtcgcttggggctgcgc---tcgtccgccgcgcagctca
A0A2K6AYL7_HRK-01      ctgcagcgcgggtcgcttggggctgcgc---tcgtccgccgcgcagctca
A0A1D5R1E4_HRK-01      ctgcagcgcgggtcgcttggggctgcgc---tcgtccgccgcgcagctca
H2Q6Y8_HRK-01          ctgcagcgcgggtcgcctggggctgcgc---tcgtccgccgcgcagctca
G3QTJ6_HRK-01          ctgcagcgcgggtcgcctggggctgcgc---tcgtccgccgcgcagctca
O00198_HRK-01          ctgcagcgcgggtcgcctggggctgcgc---tcgtccgccgcgcagctca
G1QHD8_HRK-01          ctgcagcgcgggtcgcctggggctgcgc---tcgtccgccgcgcagctca
A0A2K5BYA0_HRK-01      ctgcagcgcgggtcgcctggggctgcgc---tcgtccgccgcgcagctca
U3E722_HRK-01          ctgcagcgcgggtcgcctggggctgcgc---tcgtccgccgcgcagctca
G3MWR6_HRK-01          ctgcagcgccggccgcctgggtctgcgc---tcgtccgccgcgcagctca
E2RLD4_HRK-01          ctgcagcgcgggccgcctggctctgcgc---tcgtccgccgcgcagctca
A0A337SQ56_HRK-01      ctgcagcgcgggccgcctgggtctgcgc---tcgtccgccgcgcagctca
H0Y001_HRK-01          ctgcagcgcgggtcgtctgggtctgcgc---tcgtctgccgcgcagctca
A0A2K6GL98_HRK-01      ctgcagcgcgggtcgcctgggtctgcgc---tcgtccgccgcgcagctca
                        *** **      **    *  * ****       * ** ** *** * *

A0A1U7R468_HRK-01      ccgcgctgaggctgcaggcgctgggcgacgagctgcaccgacgcgccat-
P62816_HRK-03          ccgcgctgcggctgcaggcgctgggcgacgagctgcaccgacgcgccat-
P62817_HRK-01          ccgcgctgcggctgcaggcgctgggcgacgagctgcaccgacgcgccat-
F7G1G0_HRK-01          cggccgcccgcctcaaggcgcttggggacgagctgcaggaacggaccatg
G3UH24_HRK-01          ccgctgctcggctcaaggcgcttggagacgagctgcaccagcgcaccatg
A0A287A5N9_HRK-01      ctgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
G1T7W1_HRK-01          ccgccgcccggctcaaggcactcggcgacgagctgcaccagcgcaccatg
H2NIS8_HRK-01          ccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatg
A0A2K5KZ69_HRK-01      ccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatg
A0A096N944_HRK-01      ccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatg
A0A0D9SC73_HRK-01      ccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatg
A0A2K6AYL7_HRK-01      ccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatg
A0A1D5R1E4_HRK-01      ccgccgcccggctcaaggcgcttggcgacgagctgcaccagcgcaccatg
H2Q6Y8_HRK-01          ccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatg
G3QTJ6_HRK-01          ccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatg
O00198_HRK-01          ccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatg
G1QHD8_HRK-01          ccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatg
A0A2K5BYA0_HRK-01      ccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
U3E722_HRK-01          ccgccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
G3MWR6_HRK-01          cggcagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
E2RLD4_HRK-01          cggccgctcggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
A0A337SQ56_HRK-01      cggccgctcggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
H0Y001_HRK-01          cagctgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
A0A2K6GL98_HRK-01      cagccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatg
                       * **     * **  **** ** ** ***********    **  **** 

A0A1U7R468_HRK-01      --gcggcgccgcgcgcggccccgggaccc----------gctgcctgcgc
P62816_HRK-03          --gcggcgtcgcgcgcggccccgggaccc----------gctgcccgcgc
P62817_HRK-01          --gaggcgtcgcgcgcggccccgggaccc----------gctgcccgcgc
F7G1G0_HRK-01          tggaggcgccgggcgcggagtcggcgggccgcagcggaggcggccggcag
G3UH24_HRK-01          tggcggcgtcgcgcgaggagccggagggc-------------gccggcgc
A0A287A5N9_HRK-01      tggcggcgcagcgcgcggagccggagggc-------------gccggcgc
G1T7W1_HRK-01          tggcggcgccgcgcgcggagccggagggc-------------gccggcgc
H2NIS8_HRK-01          tggcggcgccgcgcgcggagccggagggc-------------gccggcgc
A0A2K5KZ69_HRK-01      tggcggcgccgcgcgcggagccggagggc-------------gccggcgc
A0A096N944_HRK-01      tggcggcgccgcgcgcggagccggagggc-------------gccggcgc
A0A0D9SC73_HRK-01      tggcggcgccgcgcgcggagccggagggc-------------gccggcgc
A0A2K6AYL7_HRK-01      tggcggcgccgcgcgcggagccggagggc-------------gccggcgc
A0A1D5R1E4_HRK-01      tggcggcgccgcgcgcggagccggagggc-------------gccggcgt
H2Q6Y8_HRK-01          tggcggcgccgcgcgcggagccggagggc-------------gccggcgc
G3QTJ6_HRK-01          tggcggcgccgcgcgcggagccggagggc-------------gccggcgc
O00198_HRK-01          tggcggcgccgcgcgcggagccggagggc-------------gccggcgc
G1QHD8_HRK-01          tggcggcgccgcgcgcggagccggagggc-------------gccggcgc
A0A2K5BYA0_HRK-01      tggcggcgccgcgcgcggagccggagggc-------------gccagcgc
U3E722_HRK-01          tggcggcgccgcgcgcggagccggagggc-------------gccggcgc
G3MWR6_HRK-01          tggcggcgccgcgcgcggagccggagggc-------------gccggcgt
E2RLD4_HRK-01          tggcggcgccgcgcgcggagccggagggc-------------gccggcgc
A0A337SQ56_HRK-01      tggcggcgccgcgcgcggagccggagggc-------------gccggcgc
H0Y001_HRK-01          tggcggcgccgcgcgcggagccggagggc-------------gccagcgc
A0A2K6GL98_HRK-01      tggcggcgccgcgcgcggagccggagggc-------------gccagcgc
                         * ****  * *** **   ***    *             *** **  

A0A1U7R468_HRK-01      tgctgcc--cgcactccgcgcccgctggccctggctgtgcgcggccgcgc
P62816_HRK-03          tgctgcc--cgcgctccgcgcccgctggccctggctgtgcgcggccgcgc
P62817_HRK-01          tgctgcc--cgcgctccgcgcccgctggccctggctgtgcgcggccgcgc
F7G1G0_HRK-01          cggcggcggcgggctccccgcctactgggcttggctgtgcgcggccgctc
G3UH24_HRK-01          c-----cggcgcgctccccacctactggccctggctgtgcgcggcggcgc
A0A287A5N9_HRK-01      c-----cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
G1T7W1_HRK-01          c-----cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
H2NIS8_HRK-01          c-----cagcgcgctcccaacctactggccctggctgtgcgcggccgcgc
A0A2K5KZ69_HRK-01      c-----cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A096N944_HRK-01      c-----cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A0D9SC73_HRK-01      c-----cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A2K6AYL7_HRK-01      c-----cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A1D5R1E4_HRK-01      c-----cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
H2Q6Y8_HRK-01          c-----cggcgcgctccccacctactggccttggctgtgcgcggccgcgc
G3QTJ6_HRK-01          c-----cggcgcgctccccacctactggccttggctgtgcgcggccgcgc
O00198_HRK-01          c-----cggcgcgctccccacctactggccttggctgtgcgcggccgcgc
G1QHD8_HRK-01          c-----cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A2K5BYA0_HRK-01      c-----cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
U3E722_HRK-01          c-----cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
G3MWR6_HRK-01          c-----cggcgcgctccctacctactggccctggctgtgcgcggccgcgc
E2RLD4_HRK-01          c-----ccgcgcgctccccacctactggccctggctgtgcgcggccgcgc
A0A337SQ56_HRK-01      c-----cggcgcgctccccacctactggccctggctgtgcgcggccgcgc
H0Y001_HRK-01          c-----cggcgcgctcaccacctactggccctggctgtgcgctgccgcgc
A0A2K6GL98_HRK-01      c-----cggcgcgctcaccacctactggccctggctgtgcgcggccgcgc
                             *  **  ***    **  **** * *********** ** ** *

A0A1U7R468_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggagcgcgtag
P62816_HRK-03          aggtggcggcgctggcggcctggctgctcggcaggcggagcgcgtag
P62817_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggagcgcgtag
F7G1G0_HRK-01          atgtggcggcgctggcggcctggctgctccggaggagaaacttg---
G3UH24_HRK-01          aggtggcggcgctggcggcctggctgctccgcaggcggaacttg---
A0A287A5N9_HRK-01      aggtggcggcgctggcagcctggctgctcggcaggcggaacttgtag
G1T7W1_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttg---
H2NIS8_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A2K5KZ69_HRK-01      aggtggcggcgctggcggcctggctgctcagcaggcggaacttgtag
A0A096N944_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A0D9SC73_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A2K6AYL7_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A1D5R1E4_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
H2Q6Y8_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
G3QTJ6_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
O00198_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
G1QHD8_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A2K5BYA0_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
U3E722_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
G3MWR6_HRK-01          aggtggcagcgctggcggcctggctgctcggcaggcggaacttgtag
E2RLD4_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttg---
A0A337SQ56_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
H0Y001_HRK-01          aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
A0A2K6GL98_HRK-01      aggtggcggcgctggcggcctggctgctcggcaggcggaacttgtag
                       * ***** ******** ************ * *** * * *  *   

© 1998-2019