Dataset for CDS classical BH3-containing proteins of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

570 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-02           --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           --------------------------------------------------
I3MBM5_BAD-02           --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           --------------------------------------------------
I3MDS9_BMF-02           --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          gttaggttgggggaggctccggggaagcccctctcgccaggttgcggcag
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-02           --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           --------------------------------------------------
I3MBM5_BAD-02           --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           --------------------------------------------------
I3MDS9_BMF-02           --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          cggccagcggggtccgggcggggcggggtcgggcggggcggggcggggcg
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-02           --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           --------------------------------------------------
I3MBM5_BAD-02           --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           --------------------------------------------------
I3MDS9_BMF-02           --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          gtgggagccgcagcaggcgccgcagcctcagcagcccggcgctggcaagt
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-02           --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           --------------------------------------------------
I3MBM5_BAD-02           --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           --------------------------------------------------
I3MDS9_BMF-02           --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          cccaactgcctcggcgcagacggctgcaggagggcgggagcggggggcgg
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-02           --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           --------------------------------------------------
I3MBM5_BAD-02           --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           --------------------------------------------------
I3MDS9_BMF-02           --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          gagcggggcggggcggtcggtgacgtcacgcgggagccggggcgcgcggc
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-02           --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           --------------------------------------------------
I3MBM5_BAD-02           --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           --------------------------------------------------
I3MDS9_BMF-02           --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          tgcagcgcgaggcggcggcggcggcggccgcggcagaaccagcctgggag
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-02           --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           --------------------------------------------------
I3MBM5_BAD-02           --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           --------------------------------------------------
I3MDS9_BMF-02           --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          ccggcggcgcaagacacatgcgtgcggcccgcgggagccacagcaggagc
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-02           --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           --------------------------------------------------
I3MBM5_BAD-02           --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           --------------------------------------------------
I3MDS9_BMF-02           --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          gggagcgggagcagtggcgagcggcggcggcgacagaggtggcggcagca
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-02           --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           --------------------------------------------------
I3MBM5_BAD-02           --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       --------------------------------------------------
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           --------------------------------------------------
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           --------------------------------------------------
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           --------------------------------------------------
I3MDS9_BMF-02           --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          gcagcagcagcagcagcagcagcagcagcagcagcagcagaggcagcagc
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       -----------------------atgggaaccccaaaacagccctcgctg
Q61337_BAD-02           -----------------------atgggaaccccaaagcagccctcgctg
Q61337_BAD-01           -----------------------atgggaaccccaaagcagccctcgctg
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           -----------------------atgggaaccccaaagcagccctcgctg
Q6P7C5_BAD-01           -----------------------atgggaaccccaaagcagccctcgctg
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------ggacccccagagaatccctcaccg
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           -----------------------atggggatcccagaaaaagccctcatc
I3MBM5_BAD-02           -----------------------atggggatcccagaaaaagccctcatc
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       -----------------------atgggcatcccagaaaatccctcatct
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           -----------------------gtggggaccccagagaatccctcatct
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       -----------------------atggggaccccagagaatcccttatct
F1PK10_BAD-01           -----------------------------accccagagaatccctcatct
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           -----------------------------------------atgcccgga
A2AV74_BMF-02           -----------------------------------------atgtc----
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           -----------------------------------------------atg
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           -----------------------------------------------atg
I3MDS9_BMF-02           --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          agaggcagcggtggagagcaggcagcgcggagccaggcgcccccgggccg
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       -------------------------------------------atggggc
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       -------atgttcccggcggcggcggccggggcagcgcgggccagaggcg
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       gctcctgcacacgccctaggcgtgaggaagtccgatcccggaatccgaag
Q61337_BAD-02           gctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggag
Q61337_BAD-01           gctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggag
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           gctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggag
Q6P7C5_BAD-01           gctcctgcacacgccctaggcttgaggaagtccgatcccggaatccggag
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           gcttccacacacgcccaaggcgtgaggatgtcgggagctgaacatccgga
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           gcttccacgcacgctccaggcgcgaggaagtcagggaaggagggaccggg
I3MBM5_BAD-02           gcttccacgcacgctccaggcgcgaggaagtcagggaaggagggaccggg
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           ---cctaca-----------------------------------------
A0A287AEF3_BAD-01       gcttccacacacacccaaggaataaggaagtccggagctgaaccagggac
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           gctcccacacatggcccaggcaaaaggaagtcgggaactgatcggcggga
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       gctcccacacacgtcccaggcccagggatgtcgggaactgagcagcggga
F1PK10_BAD-01           gctcccgcgcaggacccaggcacaaggaagtcaggaaccgagcggcggga
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           gcgggcgtattttggaaacaataccgcgcggtgtgccgtggcctcctccc
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           ccccgagcgggggtattttggaaacaataccgcacggtgttgagtctcgt
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           ccccgagcgggcgtattttggaaacaataccgcgcggtgcgcagtggcct
I3MDS9_BMF-02           --------------gtttt-------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          gcccggaccccgcctgacagcccctcaggcccgcccccgaaggcgcgttc
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       gggcagggcgcgggccgggagctgcacaatcagtgcaggcgccgcgccgc
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       cggcgcgcggagccctcggctgccggacggctcgcggcggcgggcgggct
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       cctggggaacgacgcgggaggaaggcggcgaagaccagca----------
Q61337_BAD-02           cctggggagcgacgcgggaggaaggcggtggagaccagca----------
Q61337_BAD-01           cctggggagcgacgcgggaggaaggcggtggagaccagca----------
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           cctggggagcgacgcgggaggaaggcggtggagaccagca----------
Q6P7C5_BAD-01           cctggggagcgacgcgggaggaaggcggtggagaccagca----------
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           gaagaagaagggacgcaggagatcatcgggcggg----------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           gaggaaggcggtaggacccgcaggtcggcggcgagggtggcacccggcct
I3MBM5_BAD-02           gaggaaggcggtaggacccgcaggtcggcggcgagggtggcacccggcct
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       cccggaggaaggcggtgggcggggccggagccgtagcggccccgcc----
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           gacgaggaagggacccaggacgaccgcg----------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       ggcgaggaagggacccaggacgaaggcggtaggcagggagcaagtcccgc
F1PK10_BAD-01           gaagag--------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           gcgccagctcgcgcctgcagcagtcgctgccgcagcccgcgccaccgcct
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       -------------------------------------------atgcccg
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           ccaccagcgcccgccagcgcttgctgccgccgccgtccgttcgccgcgcc
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           cctccggcgcccgccagagtccgcagccgccgccggccctgccagcggc-
I3MDS9_BMF-02           --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          atgcccccggggggctcggcgtgggcctccgcagtggtgagtgtgcgccg
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        --------------------------------------------------
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       gtcccagccttttgtcccgtggcgggggggtccgagcgcgcggctgcccg
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       gccagtggccggctctgcgctgccccgggggctctgaaggcgagtcccag
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-02           --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           gg------------------------------------------------
I3MBM5_BAD-02           gg------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       ggcgggggcggagactgggtcggaagcggccacgccccctggccagccct
F1PK10_BAD-01           --------------------------------------------------
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           cccaccgcagcccgctggagtttgcccccttcttcccaatcgagtgtggg
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       gggcgggcgtattttggaaacaataccgcgcgcgccgccgccgccgcgga
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           tgccgccgctgcccgctgagctttttccctccttcccaatcgaatctggg
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           -----------------------------tcccgcctccctgggagcgga
I3MDS9_BMF-02           --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      --------------------------------------------------
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          cggctgggggtgcgcgtgccgtgccgtgagcgggggccgctgtcaccgcg
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        -----------------------------------------------atg
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       attcccagctccggccggggcggactcggagcgccggggtctggctgagg
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       gctttgtctcccgcgcttctttcgtgctgagggtcagggagctccgggtc
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           --------------------------------------------------
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           --------------------------------------------------
K7FRX2_BMF-01           --------------------------------------------------
U3JS06_BMF-01           --------------------------------------------------
H0ZMX5_BMF-01           --------------------------------------------------
A9XRG9_BMF-01           --------------------------------------------------
G1NHG8_BMF-01           --------------------------------------------------
A9XRG9_BMF-03           --------------------------------------------------
A9XRG9_BMF-02           --------------------------------------------------
A9XRH0_BMF-01           --------------------------------------------------
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-02           --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           --------------------------------------------------
I3MBM5_BAD-02           --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           --------------------------------------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       ggtgacatttcaaaagctgattgggccgggtcggtgacagttcccgttgc
F1PK10_BAD-01           -------------------------------------------ctgtgcc
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           --------------------------------------------------
G3WDQ2_BMF-01           --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       --------------------------------------------------
A0A1U8CPE0_BMF-02       --------------------------------------------------
A0A1U8CPE0_BMF-01       --------------------------------------------------
Q8K589_BMF-01           --------------------------------------------------
A2AV74_BMF-01           caccaagccccccgagtgttcttcaccctggaccctggcgcagagccctg
A2AV74_BMF-02           --------------------------------------------------
A0A1S3EQA2_BMF-01       --------------------------------------------------
A0A1S3EQA2_BMF-02       --------------------------------------------------
A0A286XXB0_BMF-02       cccgaccccccccgagtgttcgtcacgctggaccctggcacagagccctg
A0A286XXB0_BMF-03       --------------------------------------------------
A0A286XXB0_BMF-01       --------------------------------------------------
G1SR62_BMF-01           --------------------------------------------------
G3T7Z4_BMF-01           cgccaagccccccgagtgctcgtcacgctggaccctggcgcggagccctg
G1PAU1_BMF-01           --------------------------------------------------
Q05KI3_BMF-01           --------------------------------------------------
W5QFV1_BMF-01           --------------------------------------------------
I3MDS9_BMF-01           gtctcgctcccccaagtgttcatcacgctggaccctggcgcagagccctg
I3MDS9_BMF-02           --------------------------------------------------
M3YAD5_BMF-01           --------------------------------------------------
J9PB65_BMF-01           --------------------------------------------------
M3WRS0_BMF-02           --------------------------------------------------
M3WRS0_BMF-01           --------------------------------------------------
H0WYH6_BMF-01           --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------
F6TJI0_BMF-01           --------------------------------------------------
A0A2K6FFR1_BMF-02       --------------------------------------------------
A0A2K6FFR1_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-01       --------------------------------------------------
A0A0D9R4R5_BMF-01       --------------------------------------------------
G7PAW6_BMF-01           --------------------------------------------------
G7PAW6_BMF-02           --------------------------------------------------
A0A096NTE9_BMF-01       --------------------------------------------------
A0A096NTE9_BMF-03       --------------------------------------------------
A0A096NTE9_BMF-02       --------------------------------------------------
F7CM09_BMF-02           --------------------------------------------------
A0A2K5MJY6_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-03       --------------------------------------------------
A0A2K5Z4C3_BMF-02       --------------------------------------------------
A0A2K5MJY6_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-02       --------------------------------------------------
A0A2K6B5G4_BMF-01       --------------------------------------------------
A0A2K6B5G4_BMF-04       --------------------------------------------------
A0A2K5Z4C3_BMF-01       --------------------------------------------------
A0A2K5KGR6_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-02       --------------------------------------------------
A0A2K6RAW8_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-03       --------------------------------------------------
A0A2K6L933_BMF-01       --------------------------------------------------
A0A2K6L933_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-02       --------------------------------------------------
A0A2K5E1W9_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
F7HPK0_BMF-01           --------------------------------------------------
F7HPK0_BMF-02           --------------------------------------------------
A0A2J8T301_BMF-01       --------------------------------------------------
A0A2I3HD83_BMF-01       --------------------------------------------------
Q96LC9_BMF-05           --------------------------------------------------
Q96LC9_BMF-07           --------------------------------------------------
Q96LC9_BMF-01           --------------------------------------------------
Q96LC9_BMF-03           --------------------------------------------------
Q96LC9_BMF-04           --------------------------------------------------
Q96LC9_BMF-02           --------------------------------------------------
Q96LC9_BMF-06           --------------------------------------------------
G3QIN5_BMF-02           --------------------------------------------------
A0A2R9BS98_BMF-02       --------------------------------------------------
A0A2J8QDD5_BMF-01       --------------------------------------------------
G3QIN5_BMF-01           --------------------------------------------------
A0A2R9BS98_BMF-01       --------------------------------------------------
A0A2J8QDD5_BMF-02       --------------------------------------------------
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      ------------------------------atgaaatgtg----------
A0A2K5F6X4_BBC3-02      ---------------------------------aaatgtg----------
A0A2R8MW85_BBC3-03      ------------------------------atgaaatgtg----------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      ------------------------------atgaaatttg----------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      ------------------------------ataaaatttg----------
A0A2K5P2T8_BBC3-03      ------------------------------ataaaatttg----------
A0A2K5V8J3_BBC3-03      ------------------------------ataaaatttg----------
F7FFP6_BBC3-03          ------------------------------ataaaatttg----------
A0A2K6ASP2_BBC3-03      ------------------------------ataaaatttg----------
A0A2I3N2Z9_BBC3-03      ------------------------------ataaaatttg----------
A0A2I3HWI8_BBC3-03      ------------------------------atgaaatttg----------
A0A2R9BZA9_BBC3-01      ------------------------------atgaaatttg----------
A0A2I3RGH5_BBC3-03      ------------------------------atgaaatttg----------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          ------------------------------atgaaatttg----------
Q9BXH1_BBC3-05          ------------------------------atgaaatttg----------
Q9BXH1_BBC3-03          ------------------------------atgaaatttggcatggggtc
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      ------------------------------------------------gt
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          ctgctgctgccgctgtgagtgcggggccggactggggaaactgaggcggg
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           --------------------------------------------------
F6Z067_BAD-01           --------------------------------------------------
A0A287AZR7_PMAIP1-      --------------------------------------------------
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------------------------------------
A0A087X8P8_BAD-01       --------------------------------------------------
A0A2U9BAC9_BAD-01       --------------------------------------------------
G3Q8B3_BAD-01           --------------------------------------------------
H3D8J8_BAD-01           --------------------------------------------------
E7FBJ6_BAD-01           --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
B5X1T1_BAD-01           --------------------------------------------------
B5XEF1_BAD-01           --------------------------------------------------
A7MCM4_BAD-01           --------------------------------------------------
Q4V925_BAD-01           --------------------------------------------------
Q4V925_BAD-04           --------------------------------------------------
Q4V925_BAD-03           --------------------------------------------------
Q4V925_BAD-02           --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
H3ANP3_BAD-03           --------------------------------------------------
H3ANP3_BAD-04           --------------------------------------------------
H3ANP3_BAD-02           --------------------------------------------------
H3ANP3_BAD-01           --------------------------------------------------
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        cgttcttccggatcgcttggctctaggattcgggggctgttggaatcggc
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       aattgctcttggagcctgactcgcttttgttcagacaaagcctttctgcg
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       ggcgaaggacgcgagcgggacgccgcggggctcgggcccggacgcgacgg
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A3KND0_BMF-01           --------------------------------------------------
F6TGJ4_BMF-01           -------------------------------------------------c
W5QCU2_BIK-01           --------------------------------------------------
F1PUF4_BIK-01           --------------------------------------------------
F6RS78_BIK-01           --------------------------------------------------
A0A096LRV0_BMF-01       --------------------------------------------------
I3K2D6_BMF-01           --------------------------------------------------
A0A2U9CJH3_BMF-01       --------------------------------------------------
H9GL49_BMF-01           ----------------------------atggatcctcccggctacttgg
K7FRX2_BMF-01           ----------------------------atggatccccccagctacctgg
U3JS06_BMF-01           ----------------------------atggatcgccccagctacctgg
H0ZMX5_BMF-01           ----------------------------atggatcgccccagctacctgg
A9XRG9_BMF-01           ----------------------------atggatcgccccagctacctgg
G1NHG8_BMF-01           ----------------------------atggatcgccccagctacctgg
A9XRG9_BMF-03           ----------------------------atggatcgccccagctacctgg
A9XRG9_BMF-02           ----------------------------atggatcgccccagctacctgg
A9XRH0_BMF-01           ----------------------------atggatcgccccagctacctgg
Q925D2_BIK-01           --------------------------------------------------
O70337_BIK-01           --------------------------------------------------
O70337_BIK-02           --------------------------------------------------
O70337_BIK-04           --------------------------------------------------
Q0GKC7_BMF-01           --------------------------------------------------
G1S1X2_BIK-01           --------------------------------------------------
A0A2K6MCW0_BIK-01       --------------------------------------------------
A0A2K6QK74_BIK-01       --------------------------------------------------
A0A2K5J4Q7_BIK-01       --------------------------------------------------
A0A0D9QZY8_BIK-01       --------------------------------------------------
A0A2K5VW94_BIK-01       --------------------------------------------------
A0A2K6DBJ4_BIK-01       --------------------------------------------------
A0A2K5LDM6_BIK-01       --------------------------------------------------
A0A2K5XSA1_BIK-01       --------------------------------------------------
A0A096NKG5_BIK-01       --------------------------------------------------
H2P4N6_BIK-01           --------------------------------------------------
G3QCT2_BIK-01           --------------------------------------------------
Q13323_BIK-01           --------------------------------------------------
A0A2R8ZXD2_BIK-01       --------------------------------------------------
H2QLU7_BIK-01           --------------------------------------------------
A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K5CLG5_BIK-01       --------------------------------------------------
F7FUT7_BIK-01           --------------------------------------------------
H0XAE7_BIK-01           --------------------------------------------------
A0A2K6FM79_BIK-01       --------------------------------------------------
G3VRY4_BAD-01           --------------------------------------------------
G3VRY4_BAD-02           --------------------------------------------------
A0A1U7Q4V0_BAD-01       --------------------------------------------------
Q61337_BAD-02           --------------------------------------------------
Q61337_BAD-01           --------------------------------------------------
Q61337_BAD-03           --------------------------------------------------
O35147_BAD-01           --------------------------------------------------
Q6P7C5_BAD-01           --------------------------------------------------
G1SS60_BAD-01           --------------------------------------------------
G3TP47_BAD-01           --------------------------------------------------
A0A1S3FL84_BAD-01       --------------------------------------------------
H0V608_BAD-01           --------------------------------------------------
A0A091DDU4_BAD-01       --------------------------------------------------
F7GVS7_BAD-04           --------------------------------------------------
H0WVR2_BAD-01           --------------------------------------------------
A0A2K6GWV0_BAD-01       --------------------------------------------------
I3MBM5_BAD-01           --------------------------------------------------
I3MBM5_BAD-02           --------------------------------------------------
A0A2I2Z8C7_BAD-03       --------------------------------------------------
A0A2R8Z697_BAD-02       --------------------------------------------------
Q92934_BAD-03           --------------------------------------------------
A0A2I3TBK7_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-03       --------------------------------------------------
A0A2K5VCD8_BAD-02       --------------------------------------------------
F7GVS7_BAD-02           --------------------------------------------------
A0A2K6E7J3_BAD-02       --------------------------------------------------
A0A2K5M0C1_BAD-02       --------------------------------------------------
A0A2K5XJR2_BAD-02       --------------------------------------------------
A0A2K5E6K7_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2R8Z697_BAD-03       --------------------------------------------------
A0A2I2Z8C7_BAD-04       --------------------------------------------------
Q92934_BAD-04           --------------------------------------------------
A0A2I3TBK7_BAD-03       --------------------------------------------------
A0A2K5M0C1_BAD-03       --------------------------------------------------
A0A2K5XJR2_BAD-03       --------------------------------------------------
A0A2I3MCN5_BAD-02       --------------------------------------------------
A0A2K5VCD8_BAD-03       --------------------------------------------------
F7GVS7_BAD-03           --------------------------------------------------
A0A2K6E7J3_BAD-03       --------------------------------------------------
A0A2K5HKW9_BAD-02       --------------------------------------------------
A0A2K6N1A1_BAD-02       --------------------------------------------------
A0A2K6PUM5_BAD-02       --------------------------------------------------
A0A2K5HKW9_BAD-01       --------------------------------------------------
A0A2K6N1A1_BAD-01       --------------------------------------------------
A0A2K6PUM5_BAD-01       --------------------------------------------------
A0A0D9R491_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-01       --------------------------------------------------
A0A2I3MCN5_BAD-04       --------------------------------------------------
A0A2K5M0C1_BAD-01       --------------------------------------------------
A0A2K5XJR2_BAD-01       --------------------------------------------------
A0A2K5VCD8_BAD-01       --------------------------------------------------
F7GVS7_BAD-01           --------------------------------------------------
A0A2K6E7J3_BAD-01       --------------------------------------------------
Q2PG01_BAD-01           --------------------------------------------------
A0A2J8TYJ3_BAD-01       --------------------------------------------------
B4DZQ9_BAD-01           --------------------------------------------------
A0A2I3H4B2_BAD-01       --------------------------------------------------
A0A2R8Z697_BAD-01       --------------------------------------------------
A0A2I3TBK7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-02       --------------------------------------------------
A0A2I2Z8C7_BAD-01       --------------------------------------------------
Q92934_BAD-01           --------------------------------------------------
Q92934_BAD-02           --------------------------------------------------
A0A2K5E6K7_BAD-01       --------------------------------------------------
F6SJL0_BAD-01           --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K5E6K7_BAD-03       --------------------------------------------------
F6SJL0_BAD-02           --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
W5P8G9_BAD-01           --------------------------------------------------
F1MUT9_BAD-01           --------------------------------------------------
Q3SYZ0_BAD-01           --------------------------------------------------
G1P8C5_BAD-01           --------------------------------------------------
A0A287AEF3_BAD-01       --------------------------------------------------
A0A287AEF3_BAD-02       --------------------------------------------------
F7DN67_BAD-01           --------------------------------------------------
G1MI17_BAD-01           ---------------cttgcccccaca-----------------------
M3YNE7_BAD-01           --------------------------------------------------
A0A337SAW2_BAD-01       ccaggcaactagggccgggctccctcagtactggagggaggcggcaggcc
F1PK10_BAD-01           ctaactacctgctgtcttgcccccaca-----------------------
Q45KI9_BAD-01           --------------------------------------------------
H0W025_BIK-01           --------------------------------------------------
F6X3N6_BMF-01           -------------------------------------------------a
G3WDQ2_BMF-01           -------------------------------------------------a
U3IW89_BCL2L11-01       --------------------------------------------------
A0A1S3WU31_BMF-01       -------------------------------------------------a
A0A1U8CPE0_BMF-02       ----------------------------------attttcccaggagaga
A0A1U8CPE0_BMF-01       -------------------------------------------------a
Q8K589_BMF-01           -------------------------------------------------a
A2AV74_BMF-01           gcatcacaactcggaggctgagacgctgtcctggagtcacccaggagaga
A2AV74_BMF-02           ---------------------------------------cccaggagaga
A0A1S3EQA2_BMF-01       -------------------------------------------------a
A0A1S3EQA2_BMF-02       ----------------------------------attgtcccaggggaga
A0A286XXB0_BMF-02       gcaccacgactcggaggccgattctctctcctggagtcacccaggggaga
A0A286XXB0_BMF-03       ----------------------------------gttttcccaagggaga
A0A286XXB0_BMF-01       -------------------------------------------------a
G1SR62_BMF-01           -------------------------------------------------a
G3T7Z4_BMF-01           gcgtcacgacccggagactgacactctttcctggagtcacccaggggaga
G1PAU1_BMF-01           -------------------------------------------------a
Q05KI3_BMF-01           -------------------------------------------------a
W5QFV1_BMF-01           -------------------------------------ctcacaggggaga
I3MDS9_BMF-01           gcatcacgactcggaggccgagactctctcctggagtcacccaggtgaga
I3MDS9_BMF-02           ---------------------------------------cccagaggaga
M3YAD5_BMF-01           -------------------------------------------------a
J9PB65_BMF-01           -------------------------------------------------a
M3WRS0_BMF-02           -------------------------------------------------a
M3WRS0_BMF-01           -------------------------------------------------a
H0WYH6_BMF-01           -------------------------------------------------a
A0A287AIU8_BMF-03       -------------------------------------------------a
A0A287AIU8_BMF-04       -------------------------------------------------a
A0A287AIU8_BMF-02       -------------------------------------------------a
A0A287AIU8_BMF-01       -------------------------------------------------a
A0A287AIU8_BMF-05       -------------------------------------------------a
F6TJI0_BMF-01           -------------------------------------ctaacaggggaca
A0A2K6FFR1_BMF-02       -------------------------------------------------a
A0A2K6FFR1_BMF-01       -------------------------------------------------a
A0A2K5KGR6_BMF-01       -------------------------------------------------a
A0A0D9R4R5_BMF-01       -------------------------------------------------a
G7PAW6_BMF-01           -------------------------------------------------a
G7PAW6_BMF-02           -------------------------------------------------a
A0A096NTE9_BMF-01       -------------------------------------------------a
A0A096NTE9_BMF-03       -------------------------------------------------a
A0A096NTE9_BMF-02       -------------------------------------------------a
F7CM09_BMF-02           -------------------------------------------------a
A0A2K5MJY6_BMF-01       -------------------------------------------------a
A0A2K6B5G4_BMF-03       -------------------------------------------------a
A0A2K5Z4C3_BMF-02       -------------------------------------------------a
A0A2K5MJY6_BMF-02       -------------------------------------------------a
A0A2K6B5G4_BMF-02       -------------------------------------------------a
A0A2K6B5G4_BMF-01       -------------------------------------------------a
A0A2K6B5G4_BMF-04       -------------------------------------------------a
A0A2K5Z4C3_BMF-01       -------------------------------------------------a
A0A2K5KGR6_BMF-02       -------------------------------------------------a
A0A2K6RAW8_BMF-02       -------------------------------------------------a
A0A2K6RAW8_BMF-01       -------------------------------------------------a
A0A2K6L933_BMF-03       -------------------------------------------------a
A0A2K6L933_BMF-01       -------------------------------------------------a
A0A2K6L933_BMF-02       -------------------------------------------------a
A0A2K5E1W9_BMF-02       -------------------------------------------------a
A0A2K5E1W9_BMF-01       -------------------------------------------------a
A0A2K6TW86_BMF-02       -------------------------------------------------a
A0A2K6TW86_BMF-01       -------------------------------------------------a
A0A2K6TW86_BMF-03       -------------------------------------------------a
F7HPK0_BMF-01           -------------------------------------------------a
F7HPK0_BMF-02           -------------------------------------------------a
A0A2J8T301_BMF-01       -------------------------------------------------a
A0A2I3HD83_BMF-01       -------------------------------------------------a
Q96LC9_BMF-05           -------------------------------------------------a
Q96LC9_BMF-07           -------------------------------------------------a
Q96LC9_BMF-01           -------------------------------------------------a
Q96LC9_BMF-03           -------------------------------------------------a
Q96LC9_BMF-04           -------------------------------------------------a
Q96LC9_BMF-02           -------------------------------------------------a
Q96LC9_BMF-06           -------------------------------------------------a
G3QIN5_BMF-02           -------------------------------------------------a
A0A2R9BS98_BMF-02       -------------------------------------------------a
A0A2J8QDD5_BMF-01       -------------------------------------------------a
G3QIN5_BMF-01           -------------------------------------------------a
A0A2R9BS98_BMF-01       -------------------------------------------------a
A0A2J8QDD5_BMF-02       -------------------------------------------------a
I3LVX0_BIK-01           --------------------------------------------------
G1TZR9_BIK-01           --------------------------------------------------
A0A1S3FUQ7_BIK-01       --------------------------------------------------
A0A1D5PAR2_PMAIP1-      --------------------------------------------------
G3T2N1_BBC3-01          --------------------------------------------------
A0A1U7R468_HRK-01       --------------------------------------------------
P62816_HRK-03           --------------------------------------------------
P62817_HRK-01           --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          tgcccaggcatgtccatgccaggtgcccagggctgcttccacgacgtggg
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
A0A337SQV0_BBC3-01      gtacctcagtgcaggggctgcccgggcatgtccccgtcaggtgcctgggg
F7G1G0_HRK-01           --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
K7E5Y2_BBC3-01          gccgggcccgaggggtggcaccgccgctcacctgctccgcccacctgtct
G3UH24_HRK-01           --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
G1T7W1_HRK-01           --------------------------------------------------
H2NIS8_HRK-01           --------------------------------------------------
A0A2K5KZ69_HRK-01       --------------------------------------------------
A0A096N944_HRK-01       --------------------------------------------------
A0A0D9SC73_HRK-01       --------------------------------------------------
A0A2K6AYL7_HRK-01       --------------------------------------------------
A0A1D5R1E4_HRK-01       --------------------------------------------------
H2Q6Y8_HRK-01           --------------------------------------------------
G3QTJ6_HRK-01           --------------------------------------------------
O00198_HRK-01           --------------------------------------------------
G1QHD8_HRK-01           --------------------------------------------------
A0A2K5BYA0_HRK-01       --------------------------------------------------
U3E722_HRK-01           --------------------------------------------------
G3MWR6_HRK-01           --------------------------------------------------
E2RLD4_HRK-01           --------------------------------------------------
A0A337SQ56_HRK-01       --------------------------------------------------
H0Y001_HRK-01           --------------------------------------------------
A0A2K6GL98_HRK-01       --------------------------------------------------
                                                                          

O61667_EGL1-01          --------------------------------------------------
C1C3S9_BAD-01           ---------------------------------atgggggattctcctca
F6Z067_BAD-01           -----------------------------atggcagattcatccccttca
A0A287AZR7_PMAIP1-      ----------------------------------------ttatctaagg
A0A0P0HZF9_PMAIP1-      --------------------------------------------------
Q0GKC8_PMAIP1-01        --------------------------------------------------
I3K7B6_BAD-01           --------------------atggctgcaaacttcacaattt---cagac
A0A087X8P8_BAD-01       --------------------atggacgcaaaatttacaattt---cagac
A0A2U9BAC9_BAD-01       --------------------atggcggcaaacttcacaatat---cagac
G3Q8B3_BAD-01           --------------------atggctgcacatttcaccattt---ccgac
H3D8J8_BAD-01           --------------------atggctgcaaagttcagtctgtgcagcgac
E7FBJ6_BAD-01           -----------------------------atggagaacacctcgcatgac
Q4KMV9_BCL2L11-01       ---------------------------------atggcc--------aaa
B5X1T1_BAD-01           --------------------------------------atggaccacaca
B5XEF1_BAD-01           --------------------------------------atggactacaca
A7MCM4_BAD-01           --------------------atggcacatatgtttaatatctccgatgat
Q4V925_BAD-01           --------------------atggcacatatgtttaatatctctgatgat
Q4V925_BAD-04           --------------------atggcacatatgtttaatatctctgatgat
Q4V925_BAD-03           --------------------atggcacatatgtttaatatctctgatgat
Q4V925_BAD-02           --------------------atggcacatatgtttaatatctctgatgat
M3XHJ5_BCL2L11-01       ---------------------------------atgcca----acagagg
H3ANP3_BAD-03           --------------------------------------atgttccagatt
H3ANP3_BAD-04           --------------------------------------atgttccagatt
H3ANP3_BAD-02           --------------------------------------atgttccagatt
H3ANP3_BAD-01           --------------------------------------atgttccagatt
Q9JM54_PMAIP1-01        --------------------------------------------------
Q5U777_PMAIP1-01        --------------------------------------------------
A0A1U7QLK6_PMAIP1-      --------------------------------------------------
G1P8F9_PMAIP1-01        --------------------------------------------------
G3T0P7_PMAIP1-01        --------------------------------------------------
A0A286XF37_PMAIP1-      --------------------------------------------------
A0A337SUX1_PMAIP1-      --------------------------------------------------
W5P738_PMAIP1-01        --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        aggatgggaggaattggtaagaagccagccccgggcacatcaaggtctca
Q1PCT2_PMAIP1-01        --------------------------------------------------
A0A2K6EM90_PMAIP1-      --------------------------------------------------
G1LIZ7_PMAIP1-01        --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K6KJF2_PMAIP1-      --------------------------------------------------
A0A2K6NC45_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5JY52_PMAIP1-      --------------------------------------------------
A0A2K5NJZ2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K6BV75_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A1D5QGJ8_PMAIP1-      --------------------------------------------------
A0A0D9S003_PMAIP1-      --------------------------------------------------
A0A2K5VPX2_PMAIP1-      --------------------------------------------------
A0A2K5ZWH1_PMAIP1-      --------------------------------------------------
A0A096MPU8_PMAIP1-      --------------------------------------------------
A0A2K5CFK7_PMAIP1-      --------------------------------------------------
F7GW45_PMAIP1-01        --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2I3HX97_PMAIP1-      --------------------------------------------------
H2NWG2_PMAIP1-01        --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-02        --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
Q13794_PMAIP1-01        --------------------------------------------------
A0A2R9AKC9_PMAIP1-      --------------------------------------------------
A0A2I3SX38_PMAIP1-      --------------------------------------------------
A0A2I2YVQ5_PMAIP1-      --------------------------------------------------
W5N4P7_BMF-01           -----------------atggaagaggatgaagatgacgtgttccacccg
B2KKY9_BCL2L11-01       -----------------------------atgtctgacacgtccagagag
B8JK68_BCL2L11-01       -----------------------------atgtctgacacgtccagagag
R4G9R5_BCL2L11-01       ---------------------------------atgctggtcgttggaag
F7FTC8_BCL2L11-01       ---------------------------------atggcc--------aag
G1MV54_BCL2L11-01       ------tttttg--------------------------------------
K7GA86_BCL2L11-01       agttactctttggacgcaggaaaaggcgaccaaatggca--------aag
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       ---------------------------------atggca--------aaa
G3W979_BCL2L11-01       ---------------------------------atggca--------aag
O43521_BCL2L11-11       ---------------------------------atggca--------aag
F7HHA9_BCL2L11-08       ---------------------------------atggca--------aag
Q2YDF0_BCL2L11-01       ---------------------------------atggca--------aag
W5PY58_BCL2L11-01       ---------------------------------atggca--------aag
A0A1U8BW10_BCL2L11      ---------------------------------atggcc--------aag
A0A1U8BW10_BCL2L11      ---------------------------------atggcc--------aag
A0A1U8BW10_BCL2L11      ---------------------------------atggcc--------aag
O54918_BCL2L11-03       ---------------------------------atggcc--------aag
O88498_BCL2L11-01       ---------------------------------atggcc--------aag
O88498_BCL2L11-02       ---------------------------------atggcc--------aag
O54918_BCL2L11-01       ---------------------------------atggcc--------aag
O54918_BCL2L11-05       ---------------------------------atggcc--------aag
O54918_BCL2L11-06       ---------------------------------atggcc--------aag
O54918_BCL2L11-08       ---------------------------------atggcc--------aag
G1SSY0_BCL2L11-01       ---------------------------------atggcc--------aag
A0A286XJN2_BCL2L11      ---------------------------------atggcc--------aag
A0A286XJN2_BCL2L11      ---------------------------------atggcc--------aag
A0A286XJN2_BCL2L11      ---------------------------------atggcc--------aag
F7A7D2_BCL2L11-01       ---------------------------------atggcc--------aaa
F1SU81_BCL2L11-01       ---------------------------------atggca--------aag
C1KGB8_BCL2L11-01       ---------------------------------atggca--------aag
F1SU81_BCL2L11-02       ---------------------------------atggca--------aag
F1SU81_BCL2L11-03       ---------------------------------atggca--------aag
A0A287DFJ0_BCL2L11      ---------------------------------atggca--------aag
A0A287DFJ0_BCL2L11      ---------------------------------atggca--------aag
H0XW23_BCL2L11-01       ---------------------------------atggca--------aag
A0A1S3FHA8_BCL2L11      ---------------------------------atggca--------aag
A0A1S3FHA8_BCL2L11      ---------------------------------atggca--------aag
A0A2K6GE31_BCL2L11      ---------------------------------atggca--------aag
A0A2K6GE31_BCL2L11      ---------------------------------atggca--------aag
A0A2K6GE31_BCL2L11      ---------------------------------atggca--------aag
A0A2K6GE31_BCL2L11      ---------------------------------atggca--------aag
A0A2K6GE31_BCL2L11      ---------------------------------atggca--------aag
A0A2K6GE31_BCL2L11      ---------------------------------atggca--------aag
A0A2I3HW02_BCL2L11      ---------------------------------atggca--------aag
A0A2R9CA99_BCL2L11      ---------------------------------atggca--------aag
A0A2J8JCT2_BCL2L11      ---------------------------------atggca--------aag
A0A2I2YQ13_BCL2L11      ---------------------------------atggca--------aag
O43521_BCL2L11-06       ---------------------------------atggca--------aag
O43521_BCL2L11-15       ---------------------------------atggca--------aag
A0A2K5X2I7_BCL2L11      ---------------------------------atggca--------aag
F7HHA9_BCL2L11-09       ---------------------------------atggca--------aag
A0A2K6E226_BCL2L11      ---------------------------------atggca--------aag
A0A2K5NU92_BCL2L11      ---------------------------------atggca--------aag
A0A2K5Z8B6_BCL2L11      ---------------------------------atggca--------aag
A0A2I3M6I1_BCL2L11      ---------------------------------atggca--------aag
A0A2K5HZI7_BCL2L11      ---------------------------------atggca--------aag
A0A2K6KJP8_BCL2L11      ---------------------------------atggca--------aag
A0A2K6QIL2_BCL2L11      ---------------------------------atggca--------aag
F6XMC1_BCL2L11-09       ---------------------------------atggca--------aag
A0A2K5CAB2_BCL2L11      ---------------------------------atggca--------aag
A0A2K6TRZ5_BCL2L11      ---------------------------------atggca--------aag
A0A2K5NU92_BCL2L11      ---------------------------------atggca--------aag
A0A2K5X2I7_BCL2L11      ---------------------------------atggca--------aag
F7HHA9_BCL2L11-05       ---------------------------------atggca--------aag
A0A2K5Z8B6_BCL2L11      ---------------------------------atggca--------aag
A0A2K5HZI7_BCL2L11      ---------------------------------atggca--------aag
A0A2K6QIL2_BCL2L11      ---------------------------------atggca--------aag
A0A2K6KJP8_BCL2L11      ---------------------------------atggca--------aag
O43521_BCL2L11-13       ---------------------------------atggca--------aag
O43521_BCL2L11-17       ---------------------------------atggca--------aag
A0A2J8JCT2_BCL2L11      ---------------------------------atggca--------aag
A0A2I3HW02_BCL2L11      ---------------------------------atggca--------aag
A0A2I2YQ13_BCL2L11      ---------------------------------atggca--------aag
A0A2R9CA99_BCL2L11      ---------------------------------atggca--------aag
F6XMC1_BCL2L11-01       ---------------------------------atggca--------aag
F6XMC1_BCL2L11-02       ---------------------------------atggca--------aag
F6XMC1_BCL2L11-06       ---------------------------------atggca--------aag
A0A2K5CAB2_BCL2L11      ---------------------------------atggca--------aag
A0A2K6TRZ5_BCL2L11      ---------------------------------atggca--------aag
F6XMC1_BCL2L11-08       ---------------------------------atggca--------aag
A0A2K5CAB2_BCL2L11      ---------------------------------atggca--------aag
A0A2K6TRZ5_BCL2L11      ---------------------------------atggca--------aag
F6XMC1_BCL2L11-04       ---------------------------------atggca--------aag
F6XMC1_BCL2L11-03       ---------------------------------atggca--------aag
A0A2K5CAB2_BCL2L11      ---------------------------------atggca--------aag
A0A2K5CAB2_BCL2L11      ---------------------------------atggca--------aag
A0A2K5CAB2_BCL2L11      ---------------------------------atggca--------aag
A0A2K5CAB2_BCL2L11      ---------------------------------atggca--------aag
A0A2K6TRZ5_BCL2L11      ---------------------------------atggca--------aag
A0A2K6TRZ5_BCL2L11      ---------------------------------atggca--------aag
A0A2K6TRZ5_BCL2L11      ---------------------------------atggca--------aag
A0A2K6TRZ5_BCL2L11      ---------------------------------atggca--------aag
A0A2K5CAB2_BCL2L11      ---------------------------------atggca--------aag
A0A2K6TRZ5_BCL2L11      ---------------------------------atggca--------aag
F6XMC1_BCL2L11-05       ---------------------------------atggca--------aag
F6XMC1_BCL2L11-07       ---------------------------------atggca--------aag
A0A2K5CAB2_BCL2L11      ---------------------------------atggca--------aag
A0A2K6TRZ5_BCL2L11      ---------------------------------atggca--------aag
H2P5E2_BCL2L11-01       ---------------------------------atggca--------aag
A0A2K6E226_BCL2L11      ---------------------------------atggca--------aag
O43521_BCL2L11-21       ---------------------------------atggca--------aag
O43521_BCL2L11-02       ---------------------------------atggca--------aag
O43521_BCL2L11-03       ---------------------------------atggca--------aag
A0A2J8JCT2_BCL2L11      ---------------------------------atggca--------aag
A0A2J8JCT2_BCL2L11      ---------------------------------atggca--------aag
A0A2I3HW02_BCL2L11      ---------------------------------atggca--------aag
A0A2I2YQ13_BCL2L11      ---------------------------------atggca--------aag
A0A2I3HW02_BCL2L11      ---------------------------------atggca--------aag
A0A2R9CA99_BCL2L11      ---------------------------------atggca--------aag
A0A2J8JCT2_BCL2L11      ---------------------------------atggca--------aag
A0A2I2YQ13_BCL2L11      ---------------------------------atggca--------aag
A0A2R9CA99_BCL2L11      ---------------------------------atggca--------aag
A0A2I2YQ13_BCL2L11      ---------------------------------atggca--------aag
A0A2R9CA99_BCL2L11      ---------------------------------atggca--------aag
A0A2I3M6I1_BCL2L11      ---------------------------------atggca--------aag
A0A2I3M6I1_BCL2L11      ---------------------------------atggca--------aag
A0A2I3M6I1_BCL2L11      ---------------------------------atggca--------aag
A0A2K5NU92_BCL2L11      ---------------------------------atggca--------aag
A0A2K5X2I7_BCL2L11      ---------------------------------atggca--------aag
F7HHA9_BCL2L11-01       ---------------------------------atggca--------aag
A0A2K6E226_BCL2L11      ---------------------------------atggca--------aag
A0A2K5Z8B6_BCL2L11      ---------------------------------atggca--------aag
A0A2I3M6I1_BCL2L11      ---------------------------------atggca--------aag
A0A2K5NU92_BCL2L11      ---------------------------------atggca--------aag
A0A2K5X2I7_BCL2L11      ---------------------------------atggca--------aag
A0A2K6E226_BCL2L11      ---------------------------------atggca--------aag
A0A2K6E226_BCL2L11      ---------------------------------atggca--------aag
A0A2K5Z8B6_BCL2L11      ---------------------------------atggca--------aag
A0A2K5NU92_BCL2L11      ---------------------------------atggca--------aag
A0A2K5X2I7_BCL2L11      ---------------------------------atggca--------aag
A0A2K6E226_BCL2L11      ---------------------------------atggca--------aag
A0A2K5Z8B6_BCL2L11      ---------------------------------atggca--------aag
A0A2K5HZI7_BCL2L11      ---------------------------------atggca--------aag
A0A2K5HZI7_BCL2L11      ---------------------------------atggca--------aag
A0A2K5HZI7_BCL2L11      ---------------------------------atggca--------aag
A0A2K6QIL2_BCL2L11      ---------------------------------atggca--------aag
A0A2K6QIL2_BCL2L11      ---------------------------------atggca--------aag
A0A2K6QIL2_BCL2L11      ---------------------------------atggca--------aag
A0A2K6KJP8_BCL2L11      ---------------------------------atggca--------aag
A0A2K6QIL2_BCL2L11      ---------------------------------atggca--------aag
A0A2K6KJP8_BCL2L11      ---------------------------------atggca--------aag
A0A2K6KJP8_BCL2L11      ---------------------------------atggca--------aag
A0A2K6KJP8_BCL2L11      ---------------------------------atggca--------aag
Q6JTU4_BCL2L11-01       ---------------------------------atg--------------
O43521_BCL2L11-25       ---------------------------------atggca--------aag
O43521_BCL2L11-05       ---------------------------------atggca--------aag
O43521_BCL2L11-18       ---------------------------------atggca--------aag
O43521_BCL2L11-10       ---------------------------------atggca--------aag
O43521_BCL2L11-20       ---------------------------------atggca--------aag
O43521_BCL2L11-09       ---------------------------------atggca--------aag
O43521_BCL2L11-16       ---------------------------------atggca--------aag
A0A2K6KJP8_BCL2L11      ---------------------------------atggca--------aag
A0A2K6QIL2_BCL2L11      ---------------------------------atggca--------aag
A0A2K5HZI7_BCL2L11      ---------------------------------atggca--------aag
O43521_BCL2L11-22       ---------------------------------atggca--------aag
O43521_BCL2L11-08       ---------------------------------atggca--------aag
A0A2I2YQ13_BCL2L11      ---------------------------------atggca--------aag
A0A2I3HW02_BCL2L11      ---------------------------------atggca--------aag
A0A2R9CA99_BCL2L11      ---------------------------------atggca--------aag
A0A2J8JCT2_BCL2L11      ---------------------------------atggca--------aag
A0A2K5NU92_BCL2L11      ---------------------------------atggca--------aag
A0A2K5X2I7_BCL2L11      ---------------------------------atggca--------aag
F7HHA9_BCL2L11-03       ---------------------------------atggca--------aag
A0A2K6E226_BCL2L11      ---------------------------------atggca--------aag
A0A2K5Z8B6_BCL2L11      ---------------------------------atggca--------aag
A0A2I3M6I1_BCL2L11      ---------------------------------atggca--------aag
O43521_BCL2L11-19       ---------------------------------atggca--------aag
O43521_BCL2L11-07       ---------------------------------atggca--------aag
A0A2I2YQ13_BCL2L11      ---------------------------------atggca--------aag
A0A2R9CA99_BCL2L11      ---------------------------------atggca--------aag
A0A2J8JCT2_BCL2L11      ---------------------------------atggca--------aag
A0A2J8JCT2_BCL2L11      ---------------------------------atggca--------aag
A0A2I2YQ13_BCL2L11      ---------------------------------atggca--------aag
A0A2R9CA99_BCL2L11      ---------------------------------atggca--------aag
A0A2I3HW02_BCL2L11      ---------------------------------atggca--------aag
A0A2K6KJP8_BCL2L11      ---------------------------------atggca--------aag
A0A2K6QIL2_BCL2L11      ---------------------------------atggca--------aag
O43521_BCL2L11-12       ---------------------------------atggca--------aag
O43521_BCL2L11-24       ---------------------------------atggca--------aag
A0A2I2YQ13_BCL2L11      ---------------------------------atggca--------aag
A0A2I3HW02_BCL2L11      ---------------------------------atggca--------aag
A0A2R9CA99_BCL2L11      ---------------------------------atggca--------aag
A0A2J8JCT2_BCL2L11      ---------------------------------atggca--------aag
A0A2K5NU92_BCL2L11      ---------------------------------atggca--------aag
A0A2K5X2I7_BCL2L11      ---------------------------------atggca--------aag
F7HHA9_BCL2L11-06       ---------------------------------atggca--------aag
A0A2K6E226_BCL2L11      ---------------------------------atggca--------aag
A0A2K5Z8B6_BCL2L11      ---------------------------------atggca--------aag
A0A2I3M6I1_BCL2L11      ---------------------------------atggca--------aag
A0A2K5HZI7_BCL2L11      ---------------------------------atggca--------aag
A0A2K6KJP8_BCL2L11      ---------------------------------atggca--------aag
A0A2K6QIL2_BCL2L11      ---------------------------------atggca--------aag
A0A2K5HZI7_BCL2L11      ---------------------------------atggca--------aag
A0A2K5NU92_BCL2L11      ---------------------------------atggca--------aag
A0A2K5X2I7_BCL2L11      ---------------------------------atggca--------aag
F7HHA9_BCL2L11-04       ---------------------------------atggca--------aag
A0A2K6E226_BCL2L11      ---------------------------------atggca--------aag
A0A2K5Z8B6_BCL2L11      ---------------------------------atggca--------aag
A0A2I3M6I1_BCL2L11      ---------------------------------atggca--------aag
A0A0D9RWE0_BCL2L11      ---------------------------------atggca--------aag
A0A2K5NU92_BCL2L11      ---------------------------------atggca--------aag
A0A2K5X2I7_BCL2L11      ---------------------------------atggca--------aag
F7HHA9_BCL2L11-02       ---------------------------------atggca--------aag
A0A2K6E226_BCL2L11      ---------------------------------atggca--------aag
A0A2K5Z8B6_BCL2L11      ---------------------------------atggca--------aag
A0A2I3M6I1_BCL2L11      ---------------------------------atggca--------aag
A0A2K6KJP8_BCL2L11      ---------------------------------atggca--------aag
A0A2K6QIL2_BCL2L11      ---------------------------------atggca--------aag
A0A2K5HZI7_BCL2L11      ---------------------------------atggca--------aag
A0A2I3HW02_BCL2L11      ---------------------------------atggca--------aag
A0A2I2YQ13_BCL2L11      ---------------------------------atggca--------aag
O43521_BCL2L11-23       ---------------------------------atggca--------aag
A0A2R9CA99_BCL2L11      ---------------------------------atggca--------aag
A0A2J8JCT2_BCL2L11      ---------------------------------atggca--------aag
A0A2I3M6I1_BCL2L11      ---------------------------------atggca--------aag
A0A2K5X2I7_BCL2L11      ---------------------------------atggca--------aag
F7HHA9_BCL2L11-07       ---------------------------------atggca--------aag
A0A2K5HZI7_BCL2L11      ---------------------------------atggca--------aag
A0A2K5NU92_BCL2L11      ---------------------------------atggca--------aag
A0A2K5Z8B6_BCL2L11      ---------------------------------atggca--------aag
A0A2K5CAB2_BCL2L11      ---------------------------------atggca--------aag
A0A2K6TRZ5_BCL2L11      ---------------------------------atggca--------aag
G3SU55_BCL2L11-01       ---------------------------------atggca--------aag
M3YDI3_BCL2L11-01       tcggaagggaaggggcggacaaaaaaagaccaaatggca--------aag
A0A337SW42_BCL2L11      ---------------------------------atggca--------aag
G1LDR8_BCL2L11-01       ---------------------------------atggca--------aag
J9NWV6_BCL2L11-01       ---------------------------------atggca--------aag
A0A337SW42_BCL2L11      ---------------------------------atggca--------aag
A0A337SW42_BCL2L11      ---------------------------------atggca--------aag
A0A337SW42_BCL2L11      ---------------------------------atggca--------aag
A0A337SW42_BCL2L11      ---------------------------------atggca--------aag
A0A337SW42_BCL2L11      ---------------------------------atggca--------aag
A3KND0_BMF-01           -----------------atggatgagttagatgatgatgtgttttatcct
F6TGJ4_BMF-01           aggagagttacctgaatatggatgagttagatgacgatgtgttttatcct
W5QCU2_BIK-01           --------------------------------------atgtatcaagc-
F1PUF4_BIK-01        &nbs