Dataset for CDS BMF of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

93 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5N4P7_BMF-01          --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
F6TGJ4_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A1S3WU31_BMF-01      --------------------------------------------------
A0A1U8CPE0_BMF-02      --------------------------------------------------
A0A1U8CPE0_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
A2AV74_BMF-01          atgcccggagcgggcgtattttggaaacaataccgcgcggtgtgccgtgg
A2AV74_BMF-02          atgtc---------------------------------------------
A0A1S3EQA2_BMF-01      --------------------------------------------------
A0A1S3EQA2_BMF-02      --------------------------------------------------
A0A286XXB0_BMF-02      --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
G3T7Z4_BMF-01          ------atgccccgagcgggggtattttggaaacaataccgcacggtgtt
G1PAU1_BMF-01          --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
I3MDS9_BMF-01          ------atgccccgagcgggcgtattttggaaacaataccgcgcggtgcg
I3MDS9_BMF-02          -----------------------gtttt----------------------
M3YAD5_BMF-01          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A287AIU8_BMF-03      --------------------------------------------------
A0A287AIU8_BMF-04      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-05      --------------------------------------------------
F6TJI0_BMF-01          --------------------------------------------------
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
F7CM09_BMF-02          --------------------------------------------------
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-04      --------------------------------------------------
A0A2K5Z4C3_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-03      --------------------------------------------------
A0A2K6L933_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-02      --------------------------------------------------
A0A2K6TW86_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          --------------------------------------------------
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
H0ZMX5_BMF-01          --------------------------------------------------
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A9XRG9_BMF-03          --------------------------------------------------
A9XRG9_BMF-02          --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
                                                                         

W5N4P7_BMF-01          --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
F6TGJ4_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A1S3WU31_BMF-01      --------------------------------------------------
A0A1U8CPE0_BMF-02      --------------------------------------------------
A0A1U8CPE0_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
A2AV74_BMF-01          cctcctcccgcgccagctcgcgcctgcagcagtcgctgccgcagcccgcg
A2AV74_BMF-02          --------------------------------------------------
A0A1S3EQA2_BMF-01      --------------------------------------------------
A0A1S3EQA2_BMF-02      --------------------------------------------------
A0A286XXB0_BMF-02      --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
G3T7Z4_BMF-01          gagtctcgtccaccagcgcccgccagcgcttgctgccgccgccgtccgtt
G1PAU1_BMF-01          --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
I3MDS9_BMF-01          cagtggcctcctccggcgcccgccagagtccgcagccgccgccggccctg
I3MDS9_BMF-02          --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A287AIU8_BMF-03      --------------------------------------------------
A0A287AIU8_BMF-04      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-05      --------------------------------------------------
F6TJI0_BMF-01          --------------------------------------------------
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
F7CM09_BMF-02          --------------------------------------------------
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-04      --------------------------------------------------
A0A2K5Z4C3_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-03      --------------------------------------------------
A0A2K6L933_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-02      --------------------------------------------------
A0A2K6TW86_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          --------------------------------------------------
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
H0ZMX5_BMF-01          --------------------------------------------------
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A9XRG9_BMF-03          --------------------------------------------------
A9XRG9_BMF-02          --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
                                                                         

W5N4P7_BMF-01          --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
F6TGJ4_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A1S3WU31_BMF-01      --------------------------------------------------
A0A1U8CPE0_BMF-02      --------------------------------------------------
A0A1U8CPE0_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
A2AV74_BMF-01          ccaccgcctcccaccgcagcccgctggagtttgcccccttcttcccaatc
A2AV74_BMF-02          --------------------------------------------------
A0A1S3EQA2_BMF-01      --------------------------------------------------
A0A1S3EQA2_BMF-02      --------------------------------------------------
A0A286XXB0_BMF-02      --atgcccggggcgggcgtattttggaaacaataccgcgcgcgccgccgc
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
G3T7Z4_BMF-01          cgccgcgcctgccgccgctgcccgctgagctttttccctccttcccaatc
G1PAU1_BMF-01          --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
I3MDS9_BMF-01          ccagcggc------------------------------tcccgcctccct
I3MDS9_BMF-02          --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A287AIU8_BMF-03      --------------------------------------------------
A0A287AIU8_BMF-04      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-05      --------------------------------------------------
F6TJI0_BMF-01          --------------------------------------------------
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
F7CM09_BMF-02          --------------------------------------------------
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-04      --------------------------------------------------
A0A2K5Z4C3_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-03      --------------------------------------------------
A0A2K6L933_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-02      --------------------------------------------------
A0A2K6TW86_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          --------------------------------------------------
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
H0ZMX5_BMF-01          --------------------------------------------------
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A9XRG9_BMF-03          --------------------------------------------------
A9XRG9_BMF-02          --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
                                                                         

W5N4P7_BMF-01          --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
F6TGJ4_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A1S3WU31_BMF-01      --------------------------------------------------
A0A1U8CPE0_BMF-02      --------------------------------------------------
A0A1U8CPE0_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
A2AV74_BMF-01          gagtgtgggcaccaagccccccgagtgttcttcaccctggaccctggcgc
A2AV74_BMF-02          --------------------------------------------------
A0A1S3EQA2_BMF-01      --------------------------------------------------
A0A1S3EQA2_BMF-02      --------------------------------------------------
A0A286XXB0_BMF-02      cgccgcggacccgaccccccccgagtgttcgtcacgctggaccctggcac
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
G3T7Z4_BMF-01          gaatctgggcgccaagccccccgagtgctcgtcacgctggaccctggcgc
G1PAU1_BMF-01          --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
I3MDS9_BMF-01          gggagcggagtctcgctcccccaagtgttcatcacgctggaccctggcgc
I3MDS9_BMF-02          --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A287AIU8_BMF-03      --------------------------------------------------
A0A287AIU8_BMF-04      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-05      --------------------------------------------------
F6TJI0_BMF-01          --------------------------------------------------
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
F7CM09_BMF-02          --------------------------------------------------
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-04      --------------------------------------------------
A0A2K5Z4C3_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-03      --------------------------------------------------
A0A2K6L933_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-02      --------------------------------------------------
A0A2K6TW86_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          --------------------------------------------------
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
H0ZMX5_BMF-01          --------------------------------------------------
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A9XRG9_BMF-03          --------------------------------------------------
A9XRG9_BMF-02          --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
                                                                         

W5N4P7_BMF-01          --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
F6TGJ4_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A1S3WU31_BMF-01      --------------------------------------------------
A0A1U8CPE0_BMF-02      -------------------------------------------attttcc
A0A1U8CPE0_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
A2AV74_BMF-01          agagccctggcatcacaactcggaggctgagacgctgtcctggagtcacc
A2AV74_BMF-02          ------------------------------------------------cc
A0A1S3EQA2_BMF-01      --------------------------------------------------
A0A1S3EQA2_BMF-02      -------------------------------------------attgtcc
A0A286XXB0_BMF-02      agagccctggcaccacgactcggaggccgattctctctcctggagtcacc
A0A286XXB0_BMF-03      -------------------------------------------gttttcc
A0A286XXB0_BMF-01      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
G3T7Z4_BMF-01          ggagccctggcgtcacgacccggagactgacactctttcctggagtcacc
G1PAU1_BMF-01          --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
W5QFV1_BMF-01          ----------------------------------------------ctca
I3MDS9_BMF-01          agagccctggcatcacgactcggaggccgagactctctcctggagtcacc
I3MDS9_BMF-02          ------------------------------------------------cc
M3YAD5_BMF-01          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A287AIU8_BMF-03      --------------------------------------------------
A0A287AIU8_BMF-04      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-05      --------------------------------------------------
F6TJI0_BMF-01          ----------------------------------------------ctaa
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
F7CM09_BMF-02          --------------------------------------------------
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-04      --------------------------------------------------
A0A2K5Z4C3_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-03      --------------------------------------------------
A0A2K6L933_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-02      --------------------------------------------------
A0A2K6TW86_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          --------------------------------------------------
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
H0ZMX5_BMF-01          --------------------------------------------------
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A9XRG9_BMF-03          --------------------------------------------------
A9XRG9_BMF-02          --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
                                                                         

W5N4P7_BMF-01          --------atggaa---------------gagga----------------
A0A096LRV0_BMF-01      --------atggag---------------gatga----------------
I3K2D6_BMF-01          --------atggac---------------gatga----------------
A0A2U9CJH3_BMF-01      --------atggac---------------gatga----------------
A3KND0_BMF-01          --------------------------atggatga----------------
F6TGJ4_BMF-01          --------caggagagttacctgaatatggatga----------------
Q0GKC7_BMF-01          --------atggat---------------gagga----------------
F6X3N6_BMF-01          --------atggagcctcctcactatgtggaaga----------------
G3WDQ2_BMF-01          --------atggagtctcctcattatgtggaaga----------------
A0A1S3WU31_BMF-01      --------atggagctcccccagtgtgtggatga----------------
A0A1U8CPE0_BMF-02      caggagagatggagccacctcagtgtgtggagga----------------
A0A1U8CPE0_BMF-01      --------atggagccacctcagtgtgtggagga----------------
Q8K589_BMF-01          --------atggagccacctcagtgtgtggagga----------------
A2AV74_BMF-01          caggagagatggagccacctcagtgtgtggagga----------------
A2AV74_BMF-02          caggagagatggagccacctcagtgtgtggagga----------------
A0A1S3EQA2_BMF-01      --------atggagccgcctcagtgtgtggagga----------------
A0A1S3EQA2_BMF-02      caggggagatggagccgcctcagtgtgtggagga----------------
A0A286XXB0_BMF-02      caggggagatggagccacctcagtgtgtggagga----------------
A0A286XXB0_BMF-03      caagggagatggagccacctcagtgtgtggagga----------------
A0A286XXB0_BMF-01      --------atggagccacctcagtgtgtggagga----------------
G1SR62_BMF-01          --------atggagccacctcagtgtgtggagga----------------
G3T7Z4_BMF-01          caggggagatggagccatctcagtgtgtggagga----------------
G1PAU1_BMF-01          --------atggagccacctcagtgtgtggagga----------------
Q05KI3_BMF-01          --------atggagccaccccagtgtgtggagga----------------
W5QFV1_BMF-01          caggggagatggagccaccccagtgtgtggagga----------------
I3MDS9_BMF-01          caggtgagatggagccgcctcagtgtgtggagga----------------
I3MDS9_BMF-02          cagaggagatggagccgcctcagtgtgtggagga----------------
M3YAD5_BMF-01          --------atggagccgcctcagtgtgtggagga----------------
J9PB65_BMF-01          --------atggagccgcctcagtgtgtggagga----------------
M3WRS0_BMF-02          --------atggagccgcctcagtgtgtggagga----------------
M3WRS0_BMF-01          --------atggagccgcctcagtgtgtggagga----------------
H0WYH6_BMF-01          --------atggagccatcgcagtgtgtggagga----------------
A0A287AIU8_BMF-03      --------atggagccacctcagtgtgtggagga----------------
A0A287AIU8_BMF-04      --------atggagccacctcagtgtgtggagga----------------
A0A287AIU8_BMF-02      --------atggagccacctcagtgtgtggagga----------------
A0A287AIU8_BMF-01      --------atggagccacctcagtgtgtggagga----------------
A0A287AIU8_BMF-05      --------atggagccacctcagtgtgtggagga----------------
F6TJI0_BMF-01          caggggacatggagccgcctcagtgtgtagagga----------------
A0A2K6FFR1_BMF-02      --------atggagccatcccactgtgtggagga----------------
A0A2K6FFR1_BMF-01      --------atggagccatcccactgtgtggagga----------------
A0A2K5KGR6_BMF-01      --------atggagccatctcggtgtgtggagga----------------
A0A0D9R4R5_BMF-01      --------atggagccatctcggtgtgtggagga----------------
G7PAW6_BMF-01          --------atggagccatctcggtgtgtggagga----------------
G7PAW6_BMF-02          --------atggagccatctcggtgtgtggagga----------------
A0A096NTE9_BMF-01      --------atggagccatctcggtgtgtggagga----------------
A0A096NTE9_BMF-03      --------atggagccatctcggtgtgtggagga----------------
A0A096NTE9_BMF-02      --------atggagccatctcggtgtgtggagga----------------
F7CM09_BMF-02          --------atggagccatctcggtgtgtggagga----------------
A0A2K5MJY6_BMF-01      --------atggagccatctcggtgtgtggagga----------------
A0A2K6B5G4_BMF-03      --------atggagccatctcggtgtgtggagga----------------
A0A2K5Z4C3_BMF-02      --------atggagccatctcggtgtgtggagga----------------
A0A2K5MJY6_BMF-02      --------atggagccatctcggtgtgtggagga----------------
A0A2K6B5G4_BMF-02      --------atggagccatctcggtgtgtggagga----------------
A0A2K6B5G4_BMF-01      --------atggagccatctcggtgtgtggagga----------------
A0A2K6B5G4_BMF-04      --------atggagccatctcggtgtgtggagga----------------
A0A2K5Z4C3_BMF-01      --------atggagccatctcggtgtgtggagga----------------
A0A2K5KGR6_BMF-02      --------atggagccatctcggtgtgtggagga----------------
A0A2K6RAW8_BMF-02      --------atggagccatctcggtgtgtggagga----------------
A0A2K6RAW8_BMF-01      --------atggagccatctcggtgtgtggagga----------------
A0A2K6L933_BMF-03      --------atggagccatctcggtgtgtggagga----------------
A0A2K6L933_BMF-01      --------atggagccatctcggtgtgtggagga----------------
A0A2K6L933_BMF-02      --------atggagccatctcggtgtgtggagga----------------
A0A2K5E1W9_BMF-02      --------atggagccatctcagtgtgtggagga----------------
A0A2K5E1W9_BMF-01      --------atggagccatctcagtgtgtggagga----------------
A0A2K6TW86_BMF-02      --------atggagccatctcagtgtgtggagga----------------
A0A2K6TW86_BMF-01      --------atggagccatctcagtgtgtggagga----------------
A0A2K6TW86_BMF-03      --------atggagccatctcagtgtgtggagga----------------
F7HPK0_BMF-01          --------atggagccatctcagtgtgtggagga----------------
F7HPK0_BMF-02          --------atggagccatctcagtgtgtggagga----------------
A0A2J8T301_BMF-01      --------atggagccatctcagtgtgtggagga----------------
A0A2I3HD83_BMF-01      --------atggagccatctcagtgtgtggagga----------------
Q96LC9_BMF-05          --------atggagccatctcagtgtgtggagga----------------
Q96LC9_BMF-07          --------atggagccatctcagtgtgtggagga----------------
Q96LC9_BMF-01          --------atggagccatctcagtgtgtggagga----------------
Q96LC9_BMF-03          --------atggagccatctcagtgtgtggagga----------------
Q96LC9_BMF-04          --------atggagccatctcagtgtgtggagga----------------
Q96LC9_BMF-02          --------atggagccatctcagtgtgtggagga----------------
Q96LC9_BMF-06          --------atggagccatctcagtgtgtggagga----------------
G3QIN5_BMF-02          --------atggagccatctcagtgtgtggagga----------------
A0A2R9BS98_BMF-02      --------atggagccatctcagtgtgtggagga----------------
A0A2J8QDD5_BMF-01      --------atggagccatctcagtgtgtggagga----------------
G3QIN5_BMF-01          --------atggagccatctcagtgtgtggagga----------------
A0A2R9BS98_BMF-01      --------atggagccatctcagtgtgtggagga----------------
A0A2J8QDD5_BMF-02      --------atggagccatctcagtgtgtggagga----------------
H9GL49_BMF-01          --------atggatcctcccggctacttggatgatgacttctccactttg
K7FRX2_BMF-01          --------atggatccccccagctacctggaagaagactattctagcctg
U3JS06_BMF-01          --------atggatcgccccagctacctggaagaggactattctagcctg
H0ZMX5_BMF-01          --------atggatcgccccagctacctggaagaggactattctagcctg
A9XRG9_BMF-01          --------atggatcgccccagctacctggaagaggactattctagcctg
G1NHG8_BMF-01          --------atggatcgccccagctacctggaagaggactattctagcctg
A9XRG9_BMF-03          --------atggatcgccccagctacctggaagaggactattctagcctg
A9XRG9_BMF-02          --------atggatcgccccagctacctggaagaggactattctagcctg
A9XRH0_BMF-01          --------atggatcgccccagctacctggaagaggactattctagcctg
                                                    ** **                

W5N4P7_BMF-01          --------tgaagatgacgtgttccacccg--------------------
A0A096LRV0_BMF-01      --------ggaggatgatgtgtttgagccaga------------------
I3K2D6_BMF-01          --------ggaggacgatgtgtttgagccaaa------------------
A0A2U9CJH3_BMF-01      --------ggaggatgatgtctttgagccaga------------------
A3KND0_BMF-01          -----gttagatgatgatgtgttttatcctgatgc-----atttggatac
F6TGJ4_BMF-01          -----gttagatgacgatgtgttttatcctgatga-----atttggatac
Q0GKC7_BMF-01          --------cgaggatgatgtgttc-------aggaagggtctccagc---
F6X3N6_BMF-01          -----gctagaggacgatgtgttccacccggaggactcagagcctggtgc
G3WDQ2_BMF-01          -----gctggaggacgatgtgttccacccagaggactcagagcctggtgc
A0A1S3WU31_BMF-01      -----gctagaggatgacgtgttccagcctgaggatggggagccagggac
A0A1U8CPE0_BMF-02      -----gctggaagatgatgtgttccagtcagaggatggggagccagggac
A0A1U8CPE0_BMF-01      -----gctggaagatgatgtgttccagtcagaggatggggagccagggac
Q8K589_BMF-01          -----actagaagatgatgtgttccagccagaggatggggagccagggac
A2AV74_BMF-01          -----gctagaagatgatgtgttccagtcagaggatggggagccagggac
A2AV74_BMF-02          -----gctagaagatgatgtgttccagtcagaggatggggagccagggac
A0A1S3EQA2_BMF-01      -----gctggaggacgatgtgttccaagcagaagacggggagccagggac
A0A1S3EQA2_BMF-02      -----gctggaggacgatgtgttccaagcagaagacggggagccagggac
A0A286XXB0_BMF-02      -----gctggaggatgatgtgttccaacccgaggatggggagccggggac
A0A286XXB0_BMF-03      -----gctggaggatgatgtgttccaacccgaggatggggagccggggac
A0A286XXB0_BMF-01      -----gctggaggatgatgtgttccaacccgaggatggggagccggggac
G1SR62_BMF-01          -----gctggaggatgacgtgttccagccagaggacggggagccggggac
G3T7Z4_BMF-01          -----gctggaggatgatgtattccaaccagaggagggggagcctgggac
G1PAU1_BMF-01          -----gctggaggatgatgtgtttcagccagaggat---gagctggggac
Q05KI3_BMF-01          -----gctggaggatgacgtattccagcccgaggatggggagccggggac
W5QFV1_BMF-01          -----gctggaggatgacgtattccagccagaggatggggagccaggggc
I3MDS9_BMF-01          -----gctggaagatgatgtgttccagccagaggatggggagccagggac
I3MDS9_BMF-02          -----gctggaagatgatgtgttccagccagaggatggggagccagggac
M3YAD5_BMF-01          -----gctggaggatgacgtgttccagccagaggatggggagccggggac
J9PB65_BMF-01          -----gctggaggatgatgtgttccagccagaggatggggagccggggac
M3WRS0_BMF-02          -----gctagaggatgatgtgttccagccagaggatgtggagccggggac
M3WRS0_BMF-01          -----gctagaggatgatgtgttccagccagaggatgtggagccggggac
H0WYH6_BMF-01          -----actggaggatgacgtgttccaaccagaggatggggagctgggga-
A0A287AIU8_BMF-03      -----gctggaggatgatgtgttccagccagaggaaggggagccggggac
A0A287AIU8_BMF-04      -----gctggaggatgatgtgttccagccagaggaaggggagccggggac
A0A287AIU8_BMF-02      -----gctggaggatgatgtgttccagccagaggaaggggagccggggac
A0A287AIU8_BMF-01      -----gctggaggatgatgtgttccagccagaggaaggggagccggggac
A0A287AIU8_BMF-05      -----gctggaggatgatgtgttccagccagaggaaggggagccggggac
F6TJI0_BMF-01          -----gctggaggatgatgtgttccagccagaggatggggagccggggac
A0A2K6FFR1_BMF-02      -----gctggaggatgatgtgttccagccagaggatggggagtcggggac
A0A2K6FFR1_BMF-01      -----gctggaggatgatgtgttccagccagaggatggggagtcggggac
A0A2K5KGR6_BMF-01      -----gctggaggatgacgtgttccagccggaggacggggagccgggggc
A0A0D9R4R5_BMF-01      -----gctggaggatgatgtgttccagccggaggacggagagccgggggc
G7PAW6_BMF-01          -----gctggaggatgatgtgttccagccggaggacggggagccggggtc
G7PAW6_BMF-02          -----gctggaggatgatgtgttccagccggaggacggggagccggggtc
A0A096NTE9_BMF-01      -----gctggaggatgatgtgttccagccggaggacggggagccgggggc
A0A096NTE9_BMF-03      -----gctggaggatgatgtgttccagccggaggacggggagccgggggc
A0A096NTE9_BMF-02      -----gctggaggatgatgtgttccagccggaggacggggagccgggggc
F7CM09_BMF-02          -----gctggaggatgatgtgttccagccggaggacggggagccgggggc
A0A2K5MJY6_BMF-01      -----gctggaggatgatgtgttccagccggaggacggggagccaggggc
A0A2K6B5G4_BMF-03      -----gctggaggatgatgtgttccagccggaggacggggagccgggggc
A0A2K5Z4C3_BMF-02      -----gctggaggatgatgtgttccagccggaggacggggagccgggggc
A0A2K5MJY6_BMF-02      -----gctggaggatgatgtgttccagccggaggacggggagccaggggc
A0A2K6B5G4_BMF-02      -----gctggaggatgatgtgttccagccggaggacggggagccgggggc
A0A2K6B5G4_BMF-01      -----gctggaggatgatgtgttccagccggaggacggggagccgggggc
A0A2K6B5G4_BMF-04      -----gctggaggatgatgtgttccagccggaggacggggagccgggggc
A0A2K5Z4C3_BMF-01      -----gctggaggatgatgtgttccagccggaggacggggagccgggggc
A0A2K5KGR6_BMF-02      -----gctggaggatgacgtgttccagccggaggacggggagccgggggc
A0A2K6RAW8_BMF-02      -----gctggaagatgatgtgttccagccggaggacggggagccgggggc
A0A2K6RAW8_BMF-01      -----gctggaagatgatgtgttccagccggaggacggggagccgggggc
A0A2K6L933_BMF-03      -----gctggaggatgatgtgttccagccggaggacggggagccgggggc
A0A2K6L933_BMF-01      -----gctggaggatgatgtgttccagccggaggacggggagccgggggc
A0A2K6L933_BMF-02      -----gctggaggatgatgtgttccagccggaggacggggagccgggggc
A0A2K5E1W9_BMF-02      -----gctggaggatgatgtgttccagtcagaggatggggagccagggac
A0A2K5E1W9_BMF-01      -----gctggaggatgatgtgttccagtcagaggatggggagccagggac
A0A2K6TW86_BMF-02      -----gctggaggatgatgtgttccagccagaggatggggagccagggac
A0A2K6TW86_BMF-01      -----gctggaggatgatgtgttccagccagaggatggggagccagggac
A0A2K6TW86_BMF-03      -----gctggaggatgatgtgttccagccagaggatggggagccagggac
F7HPK0_BMF-01          -----gctggaggatgatgtgttccagccagaggatggggagccagggac
F7HPK0_BMF-02          -----gctggaggatgatgtgttccagccagaggatggggagccagggac
A0A2J8T301_BMF-01      -----gctggaggatgatgtgttccaaccagaggatggggagccggggac
A0A2I3HD83_BMF-01      -----gctagaggatgatgtgttccaaccagaggatggggagccgggcac
Q96LC9_BMF-05          -----gctggaggatgatgtgttccaaccagaggatggggagccggtgac
Q96LC9_BMF-07          -----gctggaggatgatgtgttccaaccagaggatggggagccggtgac
Q96LC9_BMF-01          -----gctggaggatgatgtgttccaaccagaggatggggagccggtgac
Q96LC9_BMF-03          -----gctggaggatgatgtgttccaaccagaggatggggagccggtgac
Q96LC9_BMF-04          -----gctggaggatgatgtgttccaaccagaggatggggagccggtgac
Q96LC9_BMF-02          -----gctggaggatgatgtgttccaaccagaggatggggagccggtgac
Q96LC9_BMF-06          -----gctggaggatgatgtgttccaaccagaggatggggagccggtgac
G3QIN5_BMF-02          -----gctggaggatgatgtgttccaaccagaggatggggagccggtgac
A0A2R9BS98_BMF-02      -----gctggaggatgatgtgttccaaccagaggatggggagccggtgac
A0A2J8QDD5_BMF-01      -----gctggaggatgatgtgttccaaccagaggatggggagccggtgac
G3QIN5_BMF-01          -----gctggaggatgatgtgttccaaccagaggatggggagccggtgac
A0A2R9BS98_BMF-01      -----gctggaggatgatgtgttccaaccagaggatggggagccggtgac
A0A2J8QDD5_BMF-02      -----gctggaggatgatgtgttccaaccagaggatggggagccggtgac
H9GL49_BMF-01          gatgggctggaggatgatgtgttccatgcagaagactgtggacttgccag
K7FRX2_BMF-01          gacgggctggacgatgacgtgtttcactctgatgactttggactcacagg
U3JS06_BMF-01          gatgggctggacgatgacgtgtttcactctgatgactttggacttgcagg
H0ZMX5_BMF-01          gatgggctggacgatgacgtgtttcactctgatgactttggacttgcagg
A9XRG9_BMF-01          gatgggctggacgatgacgtgtttcactctgatgactttggacttgcagg
G1NHG8_BMF-01          gatgggctggacgatgacgtgtttcactctgatgactttggacttgcagg
A9XRG9_BMF-03          gatgggctggacgatgacgtgtttcactctgatgactttggacttgcagg
A9XRG9_BMF-02          gatgggctggacgatgacgtgtttcactctgatgactttggacttgcagg
A9XRH0_BMF-01          gatgggctggacgatgacgtgtttcactctgatgactttggacttgca--
                                ** ** ** ** **                           

W5N4P7_BMF-01          --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A3KND0_BMF-01          ccagatcag-accataacttcctcctcattattcaaccagagccagtcct
F6TGJ4_BMF-01          ccagatcag-accatgacttcctccacagtattcaaccagagccagtcct
Q0GKC7_BMF-01          -----------actggcctcctccccacctg--cagataaagcagactga
F6X3N6_BMF-01          tcagccagggggcctgacctcagctgctctgtttgcccagagccagcctg
G3WDQ2_BMF-01          tcagccagggggcctgacctcgccagctctgtttgcccagagccagcctg
A0A1S3WU31_BMF-01      cacaccagggagcttgctctcctctgacctgttcgcccagagcccgatgg
A0A1U8CPE0_BMF-02      acaacctgggagcttgctctctgctgacccgtttgcccagagccagctgg
A0A1U8CPE0_BMF-01      acaacctgggagcttgctctctgctgacccgtttgcccagagccagctgg
Q8K589_BMF-01          acagcctgggagcttgctctctgctgacctgtttgcccagagccagctgg
A2AV74_BMF-01          acagcctgggggcttgctctctgctgacctgtttgcccagagccagctgg
A2AV74_BMF-02          acagcctgggggcttgctctctgctgacctgtttgcccagagccagctgg
A0A1S3EQA2_BMF-01      ccagccggggagcctgctctctgctaccctgtttgcccagagtcagctgg
A0A1S3EQA2_BMF-02      ccagccggggagcctgctctctgctaccctgtttgcccagagtcagctgg
A0A286XXB0_BMF-02      ccagcctgggagcctgctctctgctgatctctttgcccagagccagctgg
A0A286XXB0_BMF-03      ccagcctgggagcctgctctctgctgatctctttgcccagagccagctgg
A0A286XXB0_BMF-01      ccagcctgggagcctgctctctgctgatctctttgcccagagccagctgg
G1SR62_BMF-01          ccagccccaaagcttgctctctgctgacccgtttgcccagagccagctgg
G3T7Z4_BMF-01          ccagcccgggggcttgctctctgctgacctgtttgcccagagccagctgg
G1PAU1_BMF-01          ccagcctgggagtttgccctctgctgacctgtttgcccagagccagctgg
Q05KI3_BMF-01          ccagcccaggagcttgctctctgctgacctgtttgcccagagccagctgg
W5QFV1_BMF-01          ccagcccaggaggttgctctctgctgacctgtttgcccagagccagctgg
I3MDS9_BMF-01          ccagcctgggagcttgctctctgctgacttgtttgcccagagccagctgg
I3MDS9_BMF-02          ccagcctgggagcttgctctctgctgacttgtttgcccagagccagctgg
M3YAD5_BMF-01          ccagcctgggagcttgctctctgctgacctgtttgcccagagccagctgg
J9PB65_BMF-01          ccagcctgggagcttgctctctgctgacctgtttgcccagagccagctgg
M3WRS0_BMF-02          ccagcctgggagcttgctgtctgctaacctgtttgcccagagccagctgg
M3WRS0_BMF-01          ccagcctgggagcttgctgtctgctaacctgtttgcccagagccagctgg
H0WYH6_BMF-01          -----ctgggaatgtgctctctgctgacctgtttgcccagagccagctgg
A0A287AIU8_BMF-03      ccagcccaggag---ggtctctgctgacccgtttgtccagagccagctgg
A0A287AIU8_BMF-04      ccagcccaggag---ggtctctgctgacccgtttgtccagagccagctgg
A0A287AIU8_BMF-02      ccagcccaggag---ggtctctgctgacccgtttgtccagagccagctgg
A0A287AIU8_BMF-01      ccagcccaggag---ggtctctgctgacccgtttgtccagagccagctgg
A0A287AIU8_BMF-05      ccagcccaggag---ggtctctgctgacccgtttgtccagagccagctgg
F6TJI0_BMF-01          ccagcccaggagcttgctctctgctgacctgtttgccccgagccagctgg
A0A2K6FFR1_BMF-02      ccagcccgggagcgtgctctctgctgacctgtttgcccagagccagctgg
A0A2K6FFR1_BMF-01      ccagcccgggagcgtgctctctgctgacctgtttgcccagagccagctgg
A0A2K5KGR6_BMF-01      ccaacccgggagctcgctctctgccgatctgtttgcccagagcttacttg
A0A0D9R4R5_BMF-01      ccaacccgggagctcgctctctgccgatctgtttgcccagagcctacttg
G7PAW6_BMF-01          ccaacccgggagctctctctctgccgatctgtttgcccagagcctacttg
G7PAW6_BMF-02          ccaacccgggagctctctctctgccgatctgtttgcccagagcctacttg
A0A096NTE9_BMF-01      ccaacccgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A096NTE9_BMF-03      ccaacccgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A096NTE9_BMF-02      ccaacccgggagctcgctctctgccgatctgtttgcccagagcctacttg
F7CM09_BMF-02          ccaacccgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K5MJY6_BMF-01      ccaacccgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K6B5G4_BMF-03      ccaacccgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K5Z4C3_BMF-02      ccaacccgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K5MJY6_BMF-02      ccaacccgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K6B5G4_BMF-02      ccaacccgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K6B5G4_BMF-01      ccaacccgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K6B5G4_BMF-04      ccaacccgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K5Z4C3_BMF-01      ccaacccgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K5KGR6_BMF-02      ccaacccgggagctcgctctctgccgatctgtttgcccagagcttacttg
A0A2K6RAW8_BMF-02      ccaacctgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K6RAW8_BMF-01      ccaacctgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K6L933_BMF-03      ccaacctgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K6L933_BMF-01      ccaacctgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K6L933_BMF-02      ccaacctgggagctcgctctctgccgatctgtttgcccagagcctacttg
A0A2K5E1W9_BMF-02      ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
A0A2K5E1W9_BMF-01      ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
A0A2K6TW86_BMF-02      ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
A0A2K6TW86_BMF-01      ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
A0A2K6TW86_BMF-03      ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
F7HPK0_BMF-01          ccaacccgggagcttgctctctgctgacctatttgcccagagcctactgg
F7HPK0_BMF-02          ccaacccgggagcttgctctctgctgacctatttgcccagagcctactgg
A0A2J8T301_BMF-01      ccaatccggaagcttgctctctgctgacctgtttgcccagagcctactgg
A0A2I3HD83_BMF-01      ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
Q96LC9_BMF-05          ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
Q96LC9_BMF-07          ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
Q96LC9_BMF-01          ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
Q96LC9_BMF-03          ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
Q96LC9_BMF-04          ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
Q96LC9_BMF-02          ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
Q96LC9_BMF-06          ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
G3QIN5_BMF-02          ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
A0A2R9BS98_BMF-02      ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
A0A2J8QDD5_BMF-01      ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
G3QIN5_BMF-01          ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
A0A2R9BS98_BMF-01      ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
A0A2J8QDD5_BMF-02      ccaacccgggagcttgctctctgctgacctgtttgcccagagcctactgg
H9GL49_BMF-01          tcaacccagtgagatgacctttcctggcattttcactcagagcaaatcct
K7FRX2_BMF-01          tcagcctggtgagatgactcctactggcattttcacacagaaccaatcgt
U3JS06_BMF-01          tcagcctggtgagatgactgcaactggctttttcacacagaaccagtcct
H0ZMX5_BMF-01          tcagcctggtgagatgactgcaactggctttttcacacagaaccagtcct
A9XRG9_BMF-01          tcagcctggtgagatgactgcaactggcattttcacacagaaccagtcct
G1NHG8_BMF-01          tcagcctggtgagatgactgcaactggcattttcacacagaaccagtcct
A9XRG9_BMF-03          tcagcctggtgagatgactgcaactggcattttcacacagaaccagtcct
A9XRG9_BMF-02          tcagcctggtgagatgactgcaactggcattttcacacagaaccagtcct
A9XRH0_BMF-01          --------------------------------------------------
                                                                         

W5N4P7_BMF-01          -----------------------------tcacatt----tctcacactg
A0A096LRV0_BMF-01      -----------------------------------------tcccaactg
I3K2D6_BMF-01          -----------------------------------------agccaactg
A0A2U9CJH3_BMF-01      -----------------------------------------cccccactg
A3KND0_BMF-01          acacatgcctgctcggccgctttcacctcttcccat----tttctcactg
F6TGJ4_BMF-01          acacatgcctgctgagccgctttcacctcttcccac----tttctcactg
Q0GKC7_BMF-01          g---ttg---------------gcaggacgtcccgctgggtcacgcaacg
F6X3N6_BMF-01          a---ctatatgctggatgggctgcagcttttccctc----ttactcactg
G3WDQ2_BMF-01          a---ctatatgctggatgggctgcagcttttccctc----ttacccactg
A0A1S3WU31_BMF-01      a---ctgctccctcagccggctgcagctcttcccac----tcacgcactg
A0A1U8CPE0_BMF-02      a---ttgtcccctcagccggcttcagctcttccctc----tcactcactg
A0A1U8CPE0_BMF-01      a---ttgtcccctcagccggcttcagctcttccctc----tcactcactg
Q8K589_BMF-01          a---ttgtcccctcagtcggcttcagctcttcccgc----ttacccactg
A2AV74_BMF-01          a---ctgtcccctcagtcgactccagctcttccctc----tcacccattg
A2AV74_BMF-02          a---ctgtcccctcagtcgactccagctcttccctc----tcacccattg
A0A1S3EQA2_BMF-01      a---ctgccccctcagccggcttcagctcttccctc----tcacccactg
A0A1S3EQA2_BMF-02      a---ctgccccctcagccggcttcagctcttccctc----tcacccactg
A0A286XXB0_BMF-02      a---ctgtccccttggtcggctgcacctctttcctc----tcacccactg
A0A286XXB0_BMF-03      a---ctgtccccttggtcggctgcacctctttcctc----tcacccactg
A0A286XXB0_BMF-01      a---ctgtccccttggtcggctgcacctctttcctc----tcacccactg
G1SR62_BMF-01          a---ctgccccctggggcggctgcacctcttccctc----tcacccactg
G3T7Z4_BMF-01          a---ctgccccctcagccggcttcagctcttccctc----tcacccactg
G1PAU1_BMF-01          a---ctgccccctcagccgtctgcagctcttccctc----tcacccactg
Q05KI3_BMF-01          a---ctgccccctcagccgtctgcagctcttccctc----tcacgcactg
W5QFV1_BMF-01          a---ctgccccctcagccgtctgcagctcttccctc----tcacgcactg
I3MDS9_BMF-01          a---ctgccccctcagcaggcttcagctcttccctc----tcacccactg
I3MDS9_BMF-02          a---ctgccccctcagcaggcttcagctcttccctc----tcacccactg
M3YAD5_BMF-01          a---ctgccctcttagccgtctgcatctcttccctc----tcacccactg
J9PB65_BMF-01          a---ctgccccctcagccgtctgcatctcttccctc----tcacccactg
M3WRS0_BMF-02          a---ctgccccctcagccatctgcagctcttccctc----tcacccactg
M3WRS0_BMF-01          a---ctgccccctcagccatctgcagctcttccctc----tcacccactg
H0WYH6_BMF-01          a---ctgtccccttagccggcttcagctcttccctc----tcacccactg
A0A287AIU8_BMF-03      a---ctgccccctcagccgtctgcagctcttccctc----tcacgcactg
A0A287AIU8_BMF-04      a---ctgccccctcagccgtctgcagctcttccctc----tcacgcactg
A0A287AIU8_BMF-02      a---ctgccccctcagccgtctgcagctcttccctc----tcacgcactg
A0A287AIU8_BMF-01      a---ctgccccctcagccgtctgcagctcttccctc----tcacgcactg
A0A287AIU8_BMF-05      a---ctgccccctcagccgtctgcagctcttccctc----tcacgcactg
F6TJI0_BMF-01          a---ctgccccctcagccatctgcggctcttccctc----tcacccactg
A0A2K6FFR1_BMF-02      a---ctgccccctcagccggcttcagctcttccctc----tcacccactg
A0A2K6FFR1_BMF-01      a---ctgccccctcagccggcttcagctcttccctc----tcacccactg
A0A2K5KGR6_BMF-01      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A0D9R4R5_BMF-01      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
G7PAW6_BMF-01          a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
G7PAW6_BMF-02          a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A096NTE9_BMF-01      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A096NTE9_BMF-03      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A096NTE9_BMF-02      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
F7CM09_BMF-02          a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K5MJY6_BMF-01      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K6B5G4_BMF-03      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K5Z4C3_BMF-02      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K5MJY6_BMF-02      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K6B5G4_BMF-02      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K6B5G4_BMF-01      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K6B5G4_BMF-04      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K5Z4C3_BMF-01      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K5KGR6_BMF-02      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K6RAW8_BMF-02      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K6RAW8_BMF-01      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K6L933_BMF-03      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K6L933_BMF-01      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K6L933_BMF-02      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2K5E1W9_BMF-02      a---ctgccccctcagccggcttcagctcttccctc----tcacccactg
A0A2K5E1W9_BMF-01      a---ctgccccctcagccggcttcagctcttccctc----tcacccactg
A0A2K6TW86_BMF-02      a---ctgccccctcagccggcttcagctcttccctc----tcacccactg
A0A2K6TW86_BMF-01      a---ctgccccctcagccggcttcagctcttccctc----tcacccactg
A0A2K6TW86_BMF-03      a---ctgccccctcagccggcttcagctcttccctc----tcacccactg
F7HPK0_BMF-01          a---ctgccccctcagtcggcttcagctcttccctc----tcacccactg
F7HPK0_BMF-02          a---ctgccccctcagtcggcttcagctcttccctc----tcacccactg
A0A2J8T301_BMF-01      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2I3HD83_BMF-01      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
Q96LC9_BMF-05          a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
Q96LC9_BMF-07          a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
Q96LC9_BMF-01          a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
Q96LC9_BMF-03          a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
Q96LC9_BMF-04          a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
Q96LC9_BMF-02          a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
Q96LC9_BMF-06          a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
G3QIN5_BMF-02          a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2R9BS98_BMF-02      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2J8QDD5_BMF-01      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
G3QIN5_BMF-01          a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2R9BS98_BMF-01      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
A0A2J8QDD5_BMF-02      a---ctgccccctcagccgacttcagctcttccctc----tcacccactg
H9GL49_BMF-01          acaactgtcttctggggaggttccagctcttcccac----ttacacactg
K7FRX2_BMF-01          acagctgcctcctggggaggtttcaactgttcccac----tcacacactg
U3JS06_BMF-01          acagctgccttctggggaggtttcaactattccccc----tcacacactg
H0ZMX5_BMF-01          acagctgccttctggggaggtttcaactattccccc----tcacacactg
A9XRG9_BMF-01          acagctgccttctggggaggtttcaactatttcccc----tcacacactg
G1NHG8_BMF-01          acagctgccttctggggaggtttcaactatttcccc----tcacacactg
A9XRG9_BMF-03          acagctgccttctggggaggtttcaactatttcccc----tcacacactg
A9XRG9_BMF-02          acagctgccttctggggaggtttcaactatttcccc----tcacacactg
A9XRH0_BMF-01          --------------------------------------------------
                                                                         

W5N4P7_BMF-01          ctggg--gaacccaattcagggaaataaagtacgagga----------ca
A0A096LRV0_BMF-01      ctggc--gcacgcccttcagggagataaagtgtgaaga----------cc
I3K2D6_BMF-01          ttggc--gcaccacattcagggagataaagtgtgaaca----------tc
A0A2U9CJH3_BMF-01      ctggc--gcaccacattcagggagataaagtgtgaaga----------cc
A3KND0_BMF-01          ttgtg--gccctggatgcaggggcacagacaacgagga----------ca
F6TGJ4_BMF-01          ttgtg--gccctggatgcaggggcgcagactacgaaga----------ca
Q0GKC7_BMF-01          gtatgctgctctg----ccggcatctccagcagcacggacactttctcta
F6X3N6_BMF-01          ctgtg--gcccagggcttcggtcagttggccaggaaga----------ta
G3WDQ2_BMF-01          ctgtg--gcccagggcttcgctcagttggccaggaaga----------ca
A0A1S3WU31_BMF-01      ctgcg--gccctgggcttcgacctgccagccaggagga----------ca
A0A1U8CPE0_BMF-02      ctgtg--gtcctgggctccggcccataagccaggaaga----------ca
A0A1U8CPE0_BMF-01      ctgtg--gtcctgggctccggcccataagccaggaaga----------ca
Q8K589_BMF-01          ctgtg--gtcctgggctccggcctgtaagccaggaaga----------ca
A2AV74_BMF-01          ctgtg--gtcccggactccggcccataagccaggaaga----------ca
A2AV74_BMF-02          ctgtg--gtcccggactccggcccataagccaggaaga----------ca
A0A1S3EQA2_BMF-01      ctgtg--gcccaggacttcgacccaccagccaggaaga----------ca
A0A1S3EQA2_BMF-02      ctgtg--gcccaggacttcgacccaccagccaggaaga----------ca
A0A286XXB0_BMF-02      ctgtg--gccctgggcttcgccccaccagccaggaaga----------ca
A0A286XXB0_BMF-03      ctgtg--gccctgggcttcgccccaccagccaggaaga----------ca
A0A286XXB0_BMF-01      ctgtg--gccctgggcttcgccccaccagccaggaaga----------ca
G1SR62_BMF-01          ctgtg--gtcctgggctgcgacccaccagccaggaaga----------ca
G3T7Z4_BMF-01          ctgtg--gccctgggcttcgacacaccagccaggagga----------ca
G1PAU1_BMF-01          ctgtg--gccctgggcttcgacccatcagccaggaaga----------ca
Q05KI3_BMF-01          ctgtg--gccctgggcttcgacccaccagccaggaaga----------ca
W5QFV1_BMF-01          ctgtg--gccctgggcttcgacccaccagccaggaaga----------ca
I3MDS9_BMF-01          ctgtg--gtcctgggcttcgacctaccagccaggaaga----------ca
I3MDS9_BMF-02          ctgtg--gtcctgggcttcgacctaccagccaggaaga----------ca
M3YAD5_BMF-01          ctgtg--gccctgggcttcgacccaccagccaggagga----------ca
J9PB65_BMF-01          ctgtg--gccctgggcttcgacccaccagccaggaaga----------ca
M3WRS0_BMF-02          ctgtg--gtcctgggcttcgacccaccagccaggaaga----------ca
M3WRS0_BMF-01          ctgtg--gtcctgggcttcgacccaccagccaggaaga----------ca
H0WYH6_BMF-01          ctgtg--gccctgggctccgaccaaccagccaggaaga----------ca
A0A287AIU8_BMF-03      ctgtg--gccctgggcttcgacccaccagccaggaaga----------ca
A0A287AIU8_BMF-04      ctgtg--gccctgggcttcgacccaccagccaggaaga----------ca
A0A287AIU8_BMF-02      ctgtg--gccctgggcttcgacccaccagccaggaaga----------ca
A0A287AIU8_BMF-01      ctgtg--gccctgggcttcgacccaccagccaggaaga----------ca
A0A287AIU8_BMF-05      ctgtg--gccctgggcttcgacccaccagccaggaaga----------ca
F6TJI0_BMF-01          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K6FFR1_BMF-02      ctgtg--gccctgggcttcgacccaccagccaggaaga----------ca
A0A2K6FFR1_BMF-01      ctgtg--gccctgggcttcgacccaccagccaggaaga----------ca
A0A2K5KGR6_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A0D9R4R5_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
G7PAW6_BMF-01          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
G7PAW6_BMF-02          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A096NTE9_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A096NTE9_BMF-03      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A096NTE9_BMF-02      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
F7CM09_BMF-02          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K5MJY6_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K6B5G4_BMF-03      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K5Z4C3_BMF-02      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K5MJY6_BMF-02      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K6B5G4_BMF-02      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K6B5G4_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K6B5G4_BMF-04      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K5Z4C3_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K5KGR6_BMF-02      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K6RAW8_BMF-02      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K6RAW8_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K6L933_BMF-03      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K6L933_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K6L933_BMF-02      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K5E1W9_BMF-02      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K5E1W9_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K6TW86_BMF-02      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K6TW86_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2K6TW86_BMF-03      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
F7HPK0_BMF-01          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
F7HPK0_BMF-02          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2J8T301_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2I3HD83_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
Q96LC9_BMF-05          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
Q96LC9_BMF-07          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
Q96LC9_BMF-01          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
Q96LC9_BMF-03          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
Q96LC9_BMF-04          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
Q96LC9_BMF-02          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
Q96LC9_BMF-06          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
G3QIN5_BMF-02          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2R9BS98_BMF-02      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2J8QDD5_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
G3QIN5_BMF-01          ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2R9BS98_BMF-01      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
A0A2J8QDD5_BMF-02      ctgtg--gccctggccttcgacccaccagccaggaaga----------ca
H9GL49_BMF-01          ttgtg--gccctggcagtaggcaggccaggcagcaaga----------ca
K7FRX2_BMF-01          ctgtg--gtccaggtatcaggcatgctgagcagcagga----------ca
U3JS06_BMF-01          ctgtg--gtcccggtatcaggcatcctgagcagcagga----------ca
H0ZMX5_BMF-01          ctgtg--gtcccggtatcaggcatcctgagcagcagga----------ca
A9XRG9_BMF-01          ctgtg--gtcccggtgtcaggcatcctgagcagcagga----------ca
G1NHG8_BMF-01          ctgtg--gtcccggtgtcaggcatcctgagcagcagga----------ca
A9XRG9_BMF-03          ctgtg--gtcccggtgtcaggcatcctgagcagcagga----------ca
A9XRG9_BMF-02          ctgtg--gtcccggtgtcaggcatcctgagcagcagga----------ca
A9XRH0_BMF-01          --------------------------------------------------
                                                                         

W5N4P7_BMF-01          agggcacgcaga--cgccaagtccagccttggtacatggtgacaacatgt
A0A096LRV0_BMF-01      ggggcacgcaga--cgcccggtccgggccaggcgctacacaacggcatgc
I3K2D6_BMF-01          gaggcacacaga--cacccggtcctgccctggtaccaaacaacggcatgc
A0A2U9CJH3_BMF-01      ggggcacacaga--cacctggccctgccctggcactgaacaacggcatgc
A3KND0_BMF-01          aggctacacaga--ctctggggtcaccttc------tcaggacatcatgc
F6TGJ4_BMF-01          aggctacgcaga--ctctgggttccccttccatcagccaggacatcatgc
Q0GKC7_BMF-01          cggtaacgcagaattgctggttctagctgcgtccagccgcgct------c
F6X3N6_BMF-01          aggccactcaga--ctctcagtccagcatcccccagccaaggtgtcatgc
G3WDQ2_BMF-01          aggccactcaga--ccctcagtccagcctccccaagccagggtgtcatgc
A0A1S3WU31_BMF-01      aggccacccaga--ccctcagcccagcctccccaagccagggtgtcatgc
A0A1U8CPE0_BMF-02      aggccacccaga--ccctcagcccagcctccccaagccagggtgttatgc
A0A1U8CPE0_BMF-01      aggccacccaga--ccctcagcccagcctccccaagccagggtgttatgc
Q8K589_BMF-01          aggccacccaga--ccctcagcccagcctccccaagccagggtgtcatgc
A2AV74_BMF-01          aggccactcaga--ccctcagtccagcttccccaagccagggtgtcatgc
A2AV74_BMF-02          aggccactcaga--ccctcagtccagcttccccaagccagggtgtcatgc
A0A1S3EQA2_BMF-01      aggccactcaga--ccctcagcccggcctcccccagccagggtgtcatgc
A0A1S3EQA2_BMF-02      aggccactcaga--ccctcagcccggcctcccccagccagggtgtcatgc
A0A286XXB0_BMF-02      aggccactcaga--ccctcagcccatcctctccaagccagggtgtcatgc
A0A286XXB0_BMF-03      aggccactcaga--ccctcagcccatcctctccaagccagggtgtcatgc
A0A286XXB0_BMF-01      aggccactcaga--ccctcagcccatcctctccaagccagggtgtcatgc
G1SR62_BMF-01          aggccacccaga--ccctcagccccgcctccccgagccaaggggtcatgc
G3T7Z4_BMF-01          aggcaactcaga--ctctcagcccagcctccccaagccagggtgtcatgc
G1PAU1_BMF-01          aggccacccaga--ccctcagtccagcctccccgagccagggtgtcatgc
Q05KI3_BMF-01          aggctacccaga--ctctcagcccagcttccccgagccagggtgtcatgc
W5QFV1_BMF-01          aggctacccaga--ctctcagcccagcttccccgagccagggtgtcatgc
I3MDS9_BMF-01          aggccactcaga--ccctcagcccagcctccccaagccagggtgtcatgc
I3MDS9_BMF-02          aggccactcaga--ccctcagcccagcctccccaagccagggtgtcatgc
M3YAD5_BMF-01          aggccacccaga--ccctcagtccagcctccccgagtcagggtgtcatgc
J9PB65_BMF-01          aggccacccaga--ccctcagtccggcctccccaagtcagggtgtcatgc
M3WRS0_BMF-02          aggccacccaga--ccctcagtccggcctccccgagtcagggtgtcatgc
M3WRS0_BMF-01          aggccacccaga--ccctcagtccggcctccccgagtcagggtgtcatgc
H0WYH6_BMF-01          aagccactcaga--ccctcagcccagcctccccaagccagggtgtcatgc
A0A287AIU8_BMF-03      aggccacccaga--ctctcagtccagcctccccgagccagggtgtcatgc
A0A287AIU8_BMF-04      aggccacccaga--ctctcagtccagcctccccgagccagggtgtcatgc
A0A287AIU8_BMF-02      aggccacccaga--ctctcagtccagcctccccgagccagggtgtcatgc
A0A287AIU8_BMF-01      aggccacccaga--ctctcagtccagcctccccgagccagggtgtcatgc
A0A287AIU8_BMF-05      aggccacccaga--ctctcagtccagcctccccgagccagggtgtcatgc
F6TJI0_BMF-01          aggccacccaga--ccctcagtccagcctccccaagccagggtgtcatgc
A0A2K6FFR1_BMF-02      aggccacccaga--ccctcagcccagcctccccaagccagggtgtcatgc
A0A2K6FFR1_BMF-01      aggccacccaga--ccctcagcccagcctccccaagccagggtgtcatgc
A0A2K5KGR6_BMF-01      aggctacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A0D9R4R5_BMF-01      aggctacccaga--cccttggcccagcctcccccagccaaggtgtcatgc
G7PAW6_BMF-01          aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
G7PAW6_BMF-02          aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A096NTE9_BMF-01      aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A096NTE9_BMF-03      aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A096NTE9_BMF-02      aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
F7CM09_BMF-02          aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K5MJY6_BMF-01      aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K6B5G4_BMF-03      aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K5Z4C3_BMF-02      aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K5MJY6_BMF-02      aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K6B5G4_BMF-02      aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K6B5G4_BMF-01      aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K6B5G4_BMF-04      aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K5Z4C3_BMF-01      aggccacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K5KGR6_BMF-02      aggctacccaga--ccctcggcccagcctcccccagccaaggtgtcatgc
A0A2K6RAW8_BMF-02      aggctacccaga--ccctcggcccagcctcccccagccaaggtgttatgc
A0A2K6RAW8_BMF-01      aggctacccaga--ccctcggcccagcctcccccagccaaggtgttatgc
A0A2K6L933_BMF-03      aggctacccaga--ccctcggcccagcctcccccagccaaggtgttatgc
A0A2K6L933_BMF-01      aggctacccaga--ccctcggcccagcctcccccagccaaggtgttatgc
A0A2K6L933_BMF-02      aggctacccaga--ccctcggcccagcctcccccagccaaggtgttatgc
A0A2K5E1W9_BMF-02      aggctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
A0A2K5E1W9_BMF-01      aggctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
A0A2K6TW86_BMF-02      aggctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
A0A2K6TW86_BMF-01      aggctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
A0A2K6TW86_BMF-03      aggctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
F7HPK0_BMF-01          aggctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
F7HPK0_BMF-02          aggctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
A0A2J8T301_BMF-01      aagctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
A0A2I3HD83_BMF-01      aagctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
Q96LC9_BMF-05          aagctacccaga--ctctcagcccagcctcccccagccaaggtgtcatgc
Q96LC9_BMF-07          aagctacccaga--ctctcagcccagcctcccccagccaaggtgtcatgc
Q96LC9_BMF-01          aagctacccaga--ctctcagcccagcctcccccagccaaggtgtcatgc
Q96LC9_BMF-03          aagctacccaga--ctctcagcccagcctcccccagccaaggtgtcatgc
Q96LC9_BMF-04          aagctacccaga--ctctcagcccagcctcccccagccaaggtgtcatgc
Q96LC9_BMF-02          aagctacccaga--ctctcagcccagcctcccccagccaaggtgtcatgc
Q96LC9_BMF-06          aagctacccaga--ctctcagcccagcctcccccagccaaggtgtcatgc
G3QIN5_BMF-02          aagctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
A0A2R9BS98_BMF-02      aagctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
A0A2J8QDD5_BMF-01      aagctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
G3QIN5_BMF-01          aagctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
A0A2R9BS98_BMF-01      aagctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
A0A2J8QDD5_BMF-02      aagctacccaga--ccctcagcccagcctcccccagccaaggtgtcatgc
H9GL49_BMF-01          aggcaacacaaa--cactcaacccatcctcttccagccaggatgtgatgt
K7FRX2_BMF-01          aggcaacccaaa--cactcagcccatcctcttccactcaggatgtcatgt
U3JS06_BMF-01          aggcaactcaaa--cactcagcccatcctcttccagtcaggatgttatgt
H0ZMX5_BMF-01          aggcaactcaaa--cactcagcccatcctcttccagtcaggatgttatgt
A9XRG9_BMF-01          aggcaactcaaa--cactcagcccgtcctcttccagtcaggatgttatgt
G1NHG8_BMF-01          aggcaactcaaa--cactcagcccgtcctcttccagtcaggatgttatgt
A9XRG9_BMF-03          aggcaactcaaa--cactcagcccgtcctcttccagtcaggatgttatgt
A9XRG9_BMF-02          aggcaactcaaa--cactcagcccgtcctcttccagtcaggatgttatgt
A9XRH0_BMF-01          --------------------------------------------------
                                                                         

W5N4P7_BMF-01          tgccg-----tgtggtgtcggagcagagcctcgccgactcttctatggta
A0A096LRV0_BMF-01      tgccc-----tgtggtgttgcggaggagcccagacgactattctacggta
I3K2D6_BMF-01          tgccc-----tgtggagtcgcagaggagcccagaccactcttctacggta
A0A2U9CJH3_BMF-01      tgccc-----tgtggagttgcagaggagcccagaccactcttctacggca
A3KND0_BMF-01          tacca-----tgtggggtgtctgaaactcctcaaagacttttttatgg--
F6TGJ4_BMF-01          taccc-----tgtggggtgtctgaaacccctcaaagacttttttatggac
Q0GKC7_BMF-01          agcctccagacgtggtgttacggcagaac------gtctcaccgatgg--
F6X3N6_BMF-01          tgcct-----tgtggagtgactgaagagccccaccgactcttttatggca
G3WDQ2_BMF-01          tgcct-----tgtggagttaccgaagaaccccaccgactcttttatggca
A0A1S3WU31_BMF-01      taccc-----tgtggggtgacagaggaaccccagcgactcttctacggca
A0A1U8CPE0_BMF-02      tgcct-----tgtggggtgacagaggaaccccagagactcttttacggca
A0A1U8CPE0_BMF-01      tgcct-----tgtggggtgacagaggaaccccagagactcttttacggca
Q8K589_BMF-01          tgcct-----tgtggggtgacagaggaaccccagagactcttttacggca
A2AV74_BMF-01          tgcct-----tgtggggtgacagaggaaccccagagactcttttacggca
A2AV74_BMF-02          tgcct-----tgtggggtgacagaggaaccccagagactcttttacggca
A0A1S3EQA2_BMF-01      tgccc-----tgtggggtgactgaagagccccagcgactcttttatggca
A0A1S3EQA2_BMF-02      tgccc-----tgtggggtgactgaagagccccagcgactcttttatggca
A0A286XXB0_BMF-02      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
A0A286XXB0_BMF-03      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
A0A286XXB0_BMF-01      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
G1SR62_BMF-01          tgcct-----tgtggggtgaccgaggaaccccagcgactcttttatggca
G3T7Z4_BMF-01          tgcct-----tgtggggtgaccgaggaaccccagcgactcttttatggca
G1PAU1_BMF-01          tgcct-----tgtggggtgaccgaggaaccccagcgactcttttatggca
Q05KI3_BMF-01          tgcct-----tgtggggtgactgaggagccccagcgactcttttatggcc
W5QFV1_BMF-01          tgcct-----tgtggggtgactgaggagccccagcgactcttttatggca
I3MDS9_BMF-01          tgcct-----tgtggagtgactgaagaaccccagcgactcttttatggca
I3MDS9_BMF-02          tgcct-----tgtggagtgactgaagaaccccagcgactcttttatggca
M3YAD5_BMF-01          tgcct-----tgtggggtgaccgaagaaccccagcgactcttttatggca
J9PB65_BMF-01          tgcct-----tgtggggtgaccgaagagccccagcgactcttttatggca
M3WRS0_BMF-02          tgcct-----tgtggggtgaccgaagaaccccagcgactcttttatg---
M3WRS0_BMF-01          tgcct-----tgtggggtgaccgaagaaccccagcgactcttttatggca
H0WYH6_BMF-01          tgcct-----tgtggggtgactgaagaaccccagagactcttttatggta
A0A287AIU8_BMF-03      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
A0A287AIU8_BMF-04      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
A0A287AIU8_BMF-02      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
A0A287AIU8_BMF-01      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
A0A287AIU8_BMF-05      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
F6TJI0_BMF-01          tgcct-----tgtggggtgaccgaggaaccccagcgactcttttatggca
A0A2K6FFR1_BMF-02      tgcct-----tgtggggtgaccgaggaaccccagagactcttttatg---
A0A2K6FFR1_BMF-01      tgcct-----tgtggggtgaccgaggaaccccagagactcttttatggca
A0A2K5KGR6_BMF-01      tgcct-----tgtggggtaactgaggaaccccagcgactgttttatg---
A0A0D9R4R5_BMF-01      tgcct-----tgtggggtaactgaggaaccccagcgactcttttacggca
G7PAW6_BMF-01          tgccc-----tgtggggtaactgaggaaccccagcgactcttttacg---
G7PAW6_BMF-02          tgccc-----tgtggggtaactgaggaaccccagcgactcttttacggca
A0A096NTE9_BMF-01      tgcct-----tgtggggtaactgaggaaccccagcgactcttttacggca
A0A096NTE9_BMF-03      tgcct-----tgtggggtaactgaggaaccccagcgactcttttacg---
A0A096NTE9_BMF-02      tgcct-----tgtggggtaactgaggaaccccagcgactcttttacggca
F7CM09_BMF-02          tgccc-----tgtggggtaactgaggaaccccagcgactcttttacggca
A0A2K5MJY6_BMF-01      tgcct-----tgtggggtaactgaggaaccccagcgactcttttacg---
A0A2K6B5G4_BMF-03      tgcct-----tgtggggtaactgaggaaccccagcgactcttttacg---
A0A2K5Z4C3_BMF-02      tgcct-----tgtggggtaactgaggaaccccagcgactcttttacg---
A0A2K5MJY6_BMF-02      tgcct-----tgtggggtaactgaggaaccccagcgactcttttacggca
A0A2K6B5G4_BMF-02      tgcct-----tgtggggtaactgaggaaccccagcgactcttttacggca
A0A2K6B5G4_BMF-01      tgcct-----tgtggggtaactgaggaaccccagcgactcttttacggca
A0A2K6B5G4_BMF-04      tgcct-----tgtggggtaactgaggaaccccagcgactcttttacggca
A0A2K5Z4C3_BMF-01      tgcct-----tgtggggtaactgaggaaccccagcgactcttttacggca
A0A2K5KGR6_BMF-02      tgcct-----tgtggggtaactgaggaaccccagcgactgttttatggca
A0A2K6RAW8_BMF-02      tgcct-----tgtggggtaactgaggaaccccagcgactgttttatg---
A0A2K6RAW8_BMF-01      tgcct-----tgtggggtaactgaggaaccccagcgactgttttatggca
A0A2K6L933_BMF-03      tgcct-----tgtggggtaactgaggaaccccagcgactgttttatggca
A0A2K6L933_BMF-01      tgcct-----tgtggggtaactgaggaaccccagcgactgttttatggca
A0A2K6L933_BMF-02      tgcct-----tgtggggtaactgaggaaccccagcgactgttttatggca
A0A2K5E1W9_BMF-02      tgcct-----tgtggggtgactgaggaaccccagcgactcttttacg---
A0A2K5E1W9_BMF-01      tgcct-----tgtggggtgactgaggaaccccagcgactcttttacggca
A0A2K6TW86_BMF-02      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
A0A2K6TW86_BMF-01      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
A0A2K6TW86_BMF-03      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatg---
F7HPK0_BMF-01          tgcct-----tgtggggtgactgaggaaccccagcgactcttttacggca
F7HPK0_BMF-02          tgcct-----tgtggggtgactgaggaaccccagcgactcttttacg---
A0A2J8T301_BMF-01      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
A0A2I3HD83_BMF-01      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatg---
Q96LC9_BMF-05          tgcct-----tgtggggtgactgaggaaccccagcgactcttttatg---
Q96LC9_BMF-07          tgcct-----tgtggggtgactgaggaaccccagcgactcttttatg---
Q96LC9_BMF-01          tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
Q96LC9_BMF-03          tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
Q96LC9_BMF-04          tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
Q96LC9_BMF-02          tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
Q96LC9_BMF-06          tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
G3QIN5_BMF-02          tgcct-----tgtggggtgactgaggaaccccagcgactcttttatg---
A0A2R9BS98_BMF-02      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatg---
A0A2J8QDD5_BMF-01      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatg---
G3QIN5_BMF-01          tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
A0A2R9BS98_BMF-01      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
A0A2J8QDD5_BMF-02      tgcct-----tgtggggtgactgaggaaccccagcgactcttttatggca
H9GL49_BMF-01          tacct-----tgtggagtcacagaagaaccccagagactcttctatggga
K7FRX2_BMF-01          tgcca-----tgtggagtcactgaagagccccagagactcttctatggga
U3JS06_BMF-01          tgcct-----tgtggagtcactgaagagccacggagactcttctatggga
H0ZMX5_BMF-01          tgcct-----tgtggagtcactgaagagccaaggagactcttctatggga
A9XRG9_BMF-01          tgcct-----tgtggagtcactgaagagccccggagactcttctatggta
G1NHG8_BMF-01          tgcct-----tgtggagtcactgaagagccccggagactcttctatggga
A9XRG9_BMF-03          tgcct-----tgtggagtcactgaagagccccggagactcttctatggga
A9XRG9_BMF-02          tgcct-----tgtggagtcactgaagagccccggagactcttctatggga
A9XRH0_BMF-01          ----------------------------------------------ggga
                                                                     *   

W5N4P7_BMF-01          atgctgcctttcgattgc---------------acttccctgcacatttt
A0A096LRV0_BMF-01      acgcaggttttcgattgc---------------acttcccagcgcatttt
I3K2D6_BMF-01          acgcaggttttcgattgc---------------acttcccggcacgcttc
A0A2U9CJH3_BMF-01      acgcgggttttcgattgc---------------acttcccggcacacttt
A3KND0_BMF-01          --taaggaggcct-------------tatcagagatataccgtatgtt--
F6TGJ4_BMF-01          atgcaggatacctattat---atctccctcagaattctccggcccgtt--
Q0GKC7_BMF-01          --------------------------------------------------
F6X3N6_BMF-01          atgctggatatcgacttc---ccctcccagccagttttcctgctagcctg
G3WDQ2_BMF-01          acgctggatatcgacttc---ccctcccagctaattttccttcgagcctg
A0A1S3WU31_BMF-01      atgcaggctaccggctgc---cgctccccaacagcttccctgcaggctct
A0A1U8CPE0_BMF-02      atgctggctacaggcttc---ctctccctgccagtttccccgcaggcttg
A0A1U8CPE0_BMF-01      atgctggctacaggcttc---ctctccctgccagtttccccgcaggcttg
Q8K589_BMF-01          acgctggctacaggcttc---ctctccctgccagtttccccgcaggctca
A2AV74_BMF-01          acgctggctacaggcttc---ctctccctgccagtttccctgcaggctca
A2AV74_BMF-02          acgctggctacaggcttc---ctctccctgccagtttccctgcaggctca
A0A1S3EQA2_BMF-01      gtgctggctaccggctcc---cactccctgccggtttccccgcagccc--
A0A1S3EQA2_BMF-02      gtgctggctaccggctcc---cactccctgccggtttccccgcagccc--
A0A286XXB0_BMF-02      atgctggctaccggcttc---ctctccctgccagtttccctgcaggcttg
A0A286XXB0_BMF-03      atgctggctaccggcttc---ctctccctgccagtttccctgcaggcttg
A0A286XXB0_BMF-01      atgctggctaccggcttc---ctctccctgccagtttccctgcaggcttg
G1SR62_BMF-01          atgctggctaccggctcc---ctctccctgccagtttccctgcaaacttc
G3T7Z4_BMF-01          atgctggctaccggctcc---ctctccctgccagtttccctgcaggcttg
G1PAU1_BMF-01          atgctggctaccggctcc---ctctccctgccagtttccctgcaggctcg
Q05KI3_BMF-01          atgctggctaccggctcc---cccttcctgccagtttccctgcaggcttg
W5QFV1_BMF-01          atgctggctaccggctcc---cccttcctgccagtttccctgcaggcttg
I3MDS9_BMF-01          atgctggctaccggcttc---ctctccctgctagtttccctgcaggcttg
I3MDS9_BMF-02          atgctggctaccggcttc---ctctccctgctagtttccctgcaggcttg
M3YAD5_BMF-01          acgctggctaccggctcc---ctctccctgccagcttccctgcaggcttg
J9PB65_BMF-01          acgctggctaccggctcc---ctctccctgccagtttccctgcaggcttg
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          acgctggctaccggctcc---ctctccctgccagtttccctgcaggcttg
H0WYH6_BMF-01          atgttggctaccggcttc---ctctccctgccagtttccctgcaggcttg
A0A287AIU8_BMF-03      atgctggctaccggctcc---ctctccctgccggtttccccgcaggcttg
A0A287AIU8_BMF-04      atgctggctaccggctcc---ctctccctgccggtttccccgcaggcttg
A0A287AIU8_BMF-02      atgctggctaccggctcc---ctctccctgccggtttccccgcaggcttg
A0A287AIU8_BMF-01      atgctggctaccggctcc---ctctccctgccggtttccccgcaggcttg
A0A287AIU8_BMF-05      atgctggctaccggctcc---ctctccctgccggtttccccgcaggcttg
F6TJI0_BMF-01          atgctggctaccggctcc---ctctccctgccagtttccctgcaggcttg
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      atgctggctaccggcttc---ctctccctgccagtttccctgcaggcttg
A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A096NTE9_BMF-01      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
F7CM09_BMF-02          atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2K6B5G4_BMF-02      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2K6B5G4_BMF-01      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2K6B5G4_BMF-04      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2K5Z4C3_BMF-01      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2K5KGR6_BMF-02      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2K6L933_BMF-03      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2K6L933_BMF-01      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2K6L933_BMF-02      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      atgctggctatcggcttc---ctctccctgccagtttcccagcagtcttg
A0A2K6TW86_BMF-02      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2K6TW86_BMF-01      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      atgctggctaccggcttc---ctctccctgccagtttcccggcagtcttg
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          atgctggctatcggcttc---ctctccctgccagtttcccagcagtcttg
Q96LC9_BMF-03          atgctggctatcggcttc---ctctccctgccagtttcccagcagtcttg
Q96LC9_BMF-04          atgctggctatcggcttc---ctctccctgccagtttcccagcagtcttg
Q96LC9_BMF-02          atgctggctatcggcttc---ctctccctgccagtttcccagcagtcttg
Q96LC9_BMF-06          atgctggctatcggcttc---ctctccctgccagtttcccagcagtcttg
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          atgctggctatcggcttc---ctctccctgccagtttcccagcagtcttg
A0A2R9BS98_BMF-01      atgctggctatcggcttc---ctctccctgccagtttcccagcagtcttg
A0A2J8QDD5_BMF-02      atgctggctatcggcttc---ctctccctgccagtttcccagcagtcttg
H9GL49_BMF-01          atgctgggtaccgtttacacgtcagcccaattggtttctcattgaatcca
K7FRX2_BMF-01          atgctgggtaccgtttacatgaacccccagttggcttcgcattgaatccg
U3JS06_BMF-01          gtgctggttaccgtttacatgtccctccagctggctttgtgttggatccg
H0ZMX5_BMF-01          gtgctggttaccgtttacatgtccctccagctgggtttgtgttggatccg
A9XRG9_BMF-01          a-------gagcactccaacgtcacc------agcttttca---------
G1NHG8_BMF-01          atgctggttaccgcttacatgtccccccagttggctttgcattggatcca
A9XRG9_BMF-03          atgctggttaccgcttacatgtccctccagttggctttgcattggatcca
A9XRG9_BMF-02          atgctggttaccgcttacatgtccctccagttggctttgcattggatcca
A9XRH0_BMF-01          atgctggttaccgcttacatgtccctccagttggctttgcattggatcca
                                                                         

W5N4P7_BMF-01          gaacagggcggggatgaggaagaggagacgggtgaag-------------
A0A096LRV0_BMF-01      gaacttgtcggggattttgacgcgaggcaaca---------agaggagca
I3K2D6_BMF-01          gaactcgtcggggatcacagagcgaggcgacaagaaatcgcggagcagca
A0A2U9CJH3_BMF-01      gagctttttggggatcaggaagtgaggggacacgagagcgaagaggagcg
A3KND0_BMF-01          ----t---------------------------------------------
F6TGJ4_BMF-01          ----ttggagaaga------------------------------------
Q0GKC7_BMF-01          ------agcgacca------------------------------------
F6X3N6_BMF-01          cggcttggagagga------------------------------------
G3WDQ2_BMF-01          aggcttggagcgga------------------------------------
A0A1S3WU31_BMF-01      ccctttgcagagca------------------------------------
A0A1U8CPE0_BMF-02      cccctcggggagca------------------------------------
A0A1U8CPE0_BMF-01      cccctcggggagca------------------------------------
Q8K589_BMF-01          gcccttggggagca------------------------------------
A2AV74_BMF-01          ccccttggggagca------------------------------------
A2AV74_BMF-02          ccccttggggagca------------------------------------
A0A1S3EQA2_BMF-01      ----------agca------------------------------------
A0A1S3EQA2_BMF-02      ----------agca------------------------------------
A0A286XXB0_BMF-02      ccccttggggagca------------------------------------
A0A286XXB0_BMF-03      ccccttggggagca------------------------------------
A0A286XXB0_BMF-01      ccccttggggagca------------------------------------
G1SR62_BMF-01          gcgctgggggagca------------------------------------
G3T7Z4_BMF-01          ccacttggggagca------------------------------------
G1PAU1_BMF-01          ccccttggtgagca------------------------------------
Q05KI3_BMF-01          ccccttggtgagca------------------------------------
W5QFV1_BMF-01          ccccttggtgagca------------------------------------
I3MDS9_BMF-01          ccccttggagagca------------------------------------
I3MDS9_BMF-02          ccccttggagagca------------------------------------
M3YAD5_BMF-01          cctctcggggacca------------------------------------
J9PB65_BMF-01          cctctcctcgagca------------------------------------
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          ccccttggtgagca------------------------------------
H0WYH6_BMF-01          cccattggggagca------------------------------------
A0A287AIU8_BMF-03      ccccttggcgaaca------------------------------------
A0A287AIU8_BMF-04      ccccttggcgaaca------------------------------------
A0A287AIU8_BMF-02      ccccttggcgaaca------------------------------------
A0A287AIU8_BMF-01      ccccttggcgaaca------------------------------------
A0A287AIU8_BMF-05      ccccttggcgaaca------------------------------------
F6TJI0_BMF-01          ccccttggtgagca------------------------------------
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      ccccttggggaaca------------------------------------
A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      cccatcggggagca------------------------------------
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          cccatcggggagca------------------------------------
A0A096NTE9_BMF-01      cccatcggggagca------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      cccatcggggagca------------------------------------
F7CM09_BMF-02          cccatcggggagca------------------------------------
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      cccatcggggagca------------------------------------
A0A2K6B5G4_BMF-02      cccatcggggagca------------------------------------
A0A2K6B5G4_BMF-01      cccatcggggagca------------------------------------
A0A2K6B5G4_BMF-04      cccatcggggagca------------------------------------
A0A2K5Z4C3_BMF-01      cccatcggggagca------------------------------------
A0A2K5KGR6_BMF-02      cccatcggggagca------------------------------------
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      cccatcggggagca------------------------------------
A0A2K6L933_BMF-03      cccatcggggagca------------------------------------
A0A2K6L933_BMF-01      cccatcggggagca------------------------------------
A0A2K6L933_BMF-02      cccatcggggagca------------------------------------
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      ccccttggggagca------------------------------------
A0A2K6TW86_BMF-02      ccccttggggagca------------------------------------
A0A2K6TW86_BMF-01      ccccttggggagca------------------------------------
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          ccccttggggagca------------------------------------
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      cctactggggagca------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          cccattggggagca------------------------------------
Q96LC9_BMF-03          cccattggggagca------------------------------------
Q96LC9_BMF-04          cccattggggagca------------------------------------
Q96LC9_BMF-02          cccattggggagca------------------------------------
Q96LC9_BMF-06          cccattggggagca------------------------------------
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          cccattggggagca------------------------------------
A0A2R9BS98_BMF-01      cccattggggagca------------------------------------
A0A2J8QDD5_BMF-02      cccattggggagca------------------------------------
H9GL49_BMF-01          cacttccaggagga------------------------------------
K7FRX2_BMF-01          cacctccaagagga------------------------------------
U3JS06_BMF-01          cacctccaagagga------------------------------------
H0ZMX5_BMF-01          cacctccaggagga------------------------------------
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          aatctccaagaaga------------------------------------
A9XRG9_BMF-03          aatctccaagaaga------------------------------------
A9XRG9_BMF-02          aatctccaagaaga------------------------------------
A9XRH0_BMF-01          aatctccaagaaga------------------------------------
                                                                         

W5N4P7_BMF-01          -----------------------ctgaggagcagccggtg---cggagtg
A0A096LRV0_BMF-01      gaacaggatggagcagttacccct---gcaccagccggctgcactcagct
I3K2D6_BMF-01          aaacagcatggagcgcctgccccg---gcagcgacctgcggctcgcagcg
A0A2U9CJH3_BMF-01      aagcgggatggagcagctaccgcggcagcagcagcctgtggcgcacagcg
A3KND0_BMF-01          --------------------------------------------------
F6TGJ4_BMF-01          ------------------ggttgacaacaggaggcaagaa---cagagcg
Q0GKC7_BMF-01          ------------------gagccccgacctgca----------cagagcg
F6X3N6_BMF-01          ------------------gccccctgaagagcagtgggag---catcgag
G3WDQ2_BMF-01          ------------------gcctcccgaggagcagtgggag---catcgag
A0A1S3WU31_BMF-01      ------------------gcgccgtgaagggcagtggcag---cagcgag
A0A1U8CPE0_BMF-02      ------------------gccccctgaaggacagt---ggcaacatcgag
A0A1U8CPE0_BMF-01      ------------------gccccctgaaggacagt---ggcaacatcgag
Q8K589_BMF-01          ------------------gccccctgaaggacagttccttcagcaccgag
A2AV74_BMF-01          ------------------gccccctgaaggacagttccttcagcaccgag
A2AV74_BMF-02          ------------------gccccctgaaggacagttccttcagcaccgag
A0A1S3EQA2_BMF-01      ------------------gccccccgaaggc------------caccgcg
A0A1S3EQA2_BMF-02      ------------------gccccccgaaggc------------caccgcg
A0A286XXB0_BMF-02      ------------------gccccctgaaggtcagtggcaa---catcgag
A0A286XXB0_BMF-03      ------------------gccccctgaaggtcagtggcaa---catcgag
A0A286XXB0_BMF-01      ------------------gccccctgaaggtcagtggcaa---catcgag
G1SR62_BMF-01          ------------------gccccctgaagggcagtggcag---catcgag
G3T7Z4_BMF-01          ------------------gccccctgaagggcagtggcaa---catcgag
G1PAU1_BMF-01          ------------------gcccccggaaggacagtggcaacatcatcgag
Q05KI3_BMF-01          ------------------gccccctgaagggcagtggcaa---catcgag
W5QFV1_BMF-01          ------------------accccctgaagggcagtggcaa---catcgag
I3MDS9_BMF-01          ------------------gccccctgaaggtcagtggcaa---catcgag
I3MDS9_BMF-02          ------------------gccccctgaaggtcagtggcaa---catcgag
M3YAD5_BMF-01          ------------------gccccctgaagggcagtggcag---catcgag
J9PB65_BMF-01          ------------------gcccccggaagggcagtggcaa---catcgag
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          ------------------gccccctgaagggcattggcag---catcgag
H0WYH6_BMF-01          ------------------gccccctgaagggcaatggcaa---catcgag
A0A287AIU8_BMF-03      ------------------gccccccgaagggcagtggcaa---catcgag
A0A287AIU8_BMF-04      ------------------gccccccgaagggcagtggcaa---catcgag
A0A287AIU8_BMF-02      ------------------gccccccgaagggcagtggcaa---catcgag
A0A287AIU8_BMF-01      ------------------gccccccgaagggcagtggcaa---catcgag
A0A287AIU8_BMF-05      ------------------gccccccgaagggcagtggcaa---catcgag
F6TJI0_BMF-01          ------------------gccccctgaagggcagtggcaa---catcgag
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      ------------------gcccgctgaagggcagtggcaa---catcgag
A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      ------------------gccccccgaagggcagtggcaa---catcgag
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          ------------------gccccccgaagggcagtggcaa---catcgag
A0A096NTE9_BMF-01      ------------------gccccccgaagggcagtggcaa---catcgag
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      ------------------gccccccgaagggcagtggcaa---catcgag
F7CM09_BMF-02          ------------------gccccccgaagggcagtggcaa---catcgag
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      ------------------gccccccgaagggcagtggcaa---catcgag
A0A2K6B5G4_BMF-02      ------------------gccccccgaagggcagtggcaa---catcgag
A0A2K6B5G4_BMF-01      ------------------gccccccgaagggcagtggcaa---catcgag
A0A2K6B5G4_BMF-04      ------------------gccccccgaagggcagtggcaa---catcgag
A0A2K5Z4C3_BMF-01      ------------------gccccccgaagggcagtggcaa---catcgag
A0A2K5KGR6_BMF-02      ------------------gccccccgaagggcagtggcaa---catcgag
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      ------------------gccccccgaagggcagtggcaa---catcgag
A0A2K6L933_BMF-03      ------------------gccccccgaagggcagtggcaa---catcgag
A0A2K6L933_BMF-01      ------------------gccccccgaagggcagtggcaa---catcgag
A0A2K6L933_BMF-02      ------------------gccccccgaagggcagtggcaa---catcgag
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      ------------------gccccccgaagggcagtggcaa---catcgag
A0A2K6TW86_BMF-02      ------------------gccccctgaagggcagtggcaa---catcgag
A0A2K6TW86_BMF-01      ------------------gccccctgaagggcagtggcaa---catcgag
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          ------------------gccccccgaagggcagtggcaa---catcgag
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      ------------------gccccctgaagggcagtggcaa---catcgag
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          ------------------gccccccgaagggcagtggcaa---catcaag
Q96LC9_BMF-03          ------------------gccccccgaagggcagtggcaa---catcaag
Q96LC9_BMF-04          ------------------gccccccgaagggcagtggcaa---catcaag
Q96LC9_BMF-02          ------------------gccccccgaagggcagtggcaa---catcaag
Q96LC9_BMF-06          ------------------gccccccgaagggcagtggcaa---catcaag
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          ------------------gccccccgaagggcagtggcaa---catcgag
A0A2R9BS98_BMF-01      ------------------gccccccgaagggcagtggcaa---catcgag
A0A2J8QDD5_BMF-02      ------------------gccccccgaagggcagtggcaa---catcgag
H9GL49_BMF-01          ------------------gccccaggagagtccacaggaa---ctgcgta
K7FRX2_BMF-01          ------------------gcctcgggaaggtcaccaggaa---gcccggg
U3JS06_BMF-01          ------------------acctcaggaaggtcagcgggaa---gcacgtg
H0ZMX5_BMF-01          ------------------acctcaggaaggtcagcgggaa---gcacgtg
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          ------------------gcctcaggaaggtcagcgggag---gcgcgta
A9XRG9_BMF-03          ------------------gcctcaggaaggtcagcgggag---gcacgta
A9XRG9_BMF-02          ------------------gcctcaggaaggtcagcgggag---gcacgta
A9XRH0_BMF-01          ------------------gcctcaggaaggtcagcgggag---gcacgta
                                                                         

W5N4P7_BMF-01          ctgaggttcgaataggccaaaagctccagaggataggagatcagtttcac
A0A096LRV0_BMF-01      tggaggcctgcatcgggcagaagcttcagctgataggcgaccagtttcac
I3K2D6_BMF-01          tggaggcctgcatcggacagaaactccagctcataggagaccagtttcac
A0A2U9CJH3_BMF-01      tggaggcctgcattggccagaaactccagctgataggagaccagtttcac
A3KND0_BMF-01          -aatgcttc-aatcccacatgaa---------------------tctcat
F6TGJ4_BMF-01          cagagcatcggatcgcccgcaaactgcagtgtattggagaccagtttcac
Q0GKC7_BMF-01          tggaaaccctcatcggacagaagctgcagctgattggagatcagttctat
F6X3N6_BMF-01          ccgaggtgcagattgcccaaaagcttcaatgcatagcggaccagttccat
G3WDQ2_BMF-01          ctgaggtgcagattgcccgaaagcttcagtgcatcgcggaccagttccac
A0A1S3WU31_BMF-01      tagaagtgcagatcgctcgcaagcttcagtgcattgcagaccagttccac
A0A1U8CPE0_BMF-02      cagaggtacagatcgccagaaagcttcagtgtattgctgaccagttccat
A0A1U8CPE0_BMF-01      cagaggtacagatcgccagaaagcttcagtgtattgctgaccagttccat
Q8K589_BMF-01          cagaggtacagatcgccagaaagcttcagtgcattgcagaccagttccat
A2AV74_BMF-01          cagaggtgcagatcgccagaaagcttcagtgtattgcagaccagttccat
A2AV74_BMF-02          cagaggtgcagatcgccagaaagcttcagtgtattgcagaccagttccat
A0A1S3EQA2_BMF-01      tggaggtgcagatcgcccggaagctgcagtgcatcgccgatcagttccat
A0A1S3EQA2_BMF-02      tggaggtgcagatcgcccggaagctgcagtgcatcgccgatcagttccat
A0A286XXB0_BMF-02      cagaggtacagatcgcccggaagcttcagtgcattgcagaccagttccac
A0A286XXB0_BMF-03      cagaggtacagatcgcccggaagcttcagtgcattgcagaccagttccac
A0A286XXB0_BMF-01      cagaggtacagatcgcccggaagcttcagtgcattgcagaccagttccac
G1SR62_BMF-01          cagaggtccagattgctcggaagcttcagtgcattgctgaccagttccac
G3T7Z4_BMF-01          cagaggtacagattgcccgaaagcttcagtgcattgcagaccacttccac
G1PAU1_BMF-01          cagagatccagatcgccagaaagcttcagagtattgccgaccaatttcat
Q05KI3_BMF-01          cagagatacagattgcccgaaaactccagtgcattgcagaccagttccat
W5QFV1_BMF-01          cagagatacagattgcccgaaaactccagtgcattgcagaccagttccat
I3MDS9_BMF-01          cagaggtacagatcgcccgaaaacttcagtgcattgcagaccagttccac
I3MDS9_BMF-02          cagaggtacagatcgcccgaaaacttcagtgcattgcagaccagttccac
M3YAD5_BMF-01          cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccat
J9PB65_BMF-01          cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccat
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccat
H0WYH6_BMF-01          cagaggtacagattgcccgaaagcttcagtgcattgcagaccagtttcac
A0A287AIU8_BMF-03      cagaggtacagattgcccgaaaacttcagtgcattgcagaccagttccat
A0A287AIU8_BMF-04      cagaggtacagattgcccgaaaacttcagtgcattgcagaccagttccat
A0A287AIU8_BMF-02      cagaggtacagattgcccgaaaacttcagtgcattgcagaccagttccat
A0A287AIU8_BMF-01      cagaggtacagattgcccgaaaacttcagtgcattgcagaccagttccat
A0A287AIU8_BMF-05      cagaggtacagattgcccgaaaacttcagtgcattgcagaccagttccat
F6TJI0_BMF-01          cagaggtacagattgcccgaaaacttcagtgcattgcagaccagttccat
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A096NTE9_BMF-01      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
F7CM09_BMF-02          cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K6B5G4_BMF-02      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K6B5G4_BMF-01      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K6B5G4_BMF-04      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K5Z4C3_BMF-01      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K5KGR6_BMF-02      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K6L933_BMF-03      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K6L933_BMF-01      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K6L933_BMF-02      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K6TW86_BMF-02      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K6TW86_BMF-01      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
Q96LC9_BMF-03          cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
Q96LC9_BMF-04          cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
Q96LC9_BMF-02          cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
Q96LC9_BMF-06          cagag---------------------------------------------
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2R9BS98_BMF-01      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
A0A2J8QDD5_BMF-02      cagaggtacagattgcccgaaagcttcagtgcattgcagaccagttccac
H9GL49_BMF-01          ctgaagttcagattgcacggaagttgcagtgcattgcagaccagttccac
K7FRX2_BMF-01          ctgaggttcagattgcacggaagttacagtgcatagcagaccagttccac
U3JS06_BMF-01          ctgaggtgcagattgcacggaagttgcagtgcattgccgaccagttccac
H0ZMX5_BMF-01          ctgaggtgcaaattgcacggaagttgcagtgcattgccgaccagttccac
A9XRG9_BMF-01          --------------gcaaggaaactat----cccttcag--cacttcccc
G1NHG8_BMF-01          ctgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccac
A9XRG9_BMF-03          ctgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccac
A9XRG9_BMF-02          ctgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccac
A9XRH0_BMF-01          ctgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccac
                                                                         

W5N4P7_BMF-01          cgagactatctccacatgtaccgcagaaaccaaaggaaccaccagcccat
A0A096LRV0_BMF-01      cgggaacacttacaacagtaccaacaaaaccaaaggaatcaggggccgct
I3K2D6_BMF-01          tgggaacgcctgcaactgtatcaccgaaaccaaaggaaccaggggccaat
A0A2U9CJH3_BMF-01      cgggaacacctacaactgtatcatcgaaaccaaaggaaccaggggccgct
A3KND0_BMF-01          agattccat------agacttt----------------------------
F6TGJ4_BMF-01          aggtttcatctgcagagacttcaacagaaccga---aatcagt------t
Q0GKC7_BMF-01          caggagcacatcatgcatcatcaaaggccgcag---gatccgc------t
F6X3N6_BMF-01          agactccacatgcagcggcaccagcagaaccga---aaccatg------t
G3WDQ2_BMF-01          aggctccacatgcagcggcaccagcagaaccaa---aaccatg------t
A0A1S3WU31_BMF-01      cacctgcacatgcagcaacaccagcagaaccga---aatccag------t
A0A1U8CPE0_BMF-02      cggctgcacatacaacaacaccagcagaaccga---gaccgtg------c
A0A1U8CPE0_BMF-01      cggctgcacatacaacaacaccagcagaaccga---gaccgtg------c
Q8K589_BMF-01          cggcttcatatgcaacaacaccagcagaaccga---gaccgag------c
A2AV74_BMF-01          cggcttcatacgcaacaacaccagcagaaccga---gaccgtg------c
A2AV74_BMF-02          cggcttcatacgcaacaacaccagcagaaccga---gaccgtg------c
A0A1S3EQA2_BMF-01      cggcttcatacgcagcggcaccagcagcaccgg---gaccgag------c
A0A1S3EQA2_BMF-02      cggcttcatacgcagcggcaccagcagcaccgg---gaccgag------c
A0A286XXB0_BMF-02      cgacttcacattcaacaacaccaacagaaccgg---aatcgcg------c
A0A286XXB0_BMF-03      cgacttcacattcaacaacaccaacagaaccgg---aatcgcg------c
A0A286XXB0_BMF-01      cgacttcacattcaacaacaccaacagaaccgg---aatcgcg------c
G1SR62_BMF-01          cggcttcatttacagcaacaccagcagaaccga---aatcgcg------t
G3T7Z4_BMF-01          cggcttcatatgcagcggcaccagcagaaccga---aatcctg------c
G1PAU1_BMF-01          cggcttcaaatgcagcaacaccagcagaaccga---aatcgca------t
Q05KI3_BMF-01          cggcttcatatgcagcaataccagcagaaccga---aatcgca------t
W5QFV1_BMF-01          cggcttcatatgcagcaacaccagcagaaccga---aatcgca------t
I3MDS9_BMF-01          cggcttcatatgcagcaacaccagcagaaccga---aatcgtg------t
I3MDS9_BMF-02          cggcttcatatgcagcaacaccagcagaaccga---aatcgtg------t
M3YAD5_BMF-01          cgacttcacatgcagcaacaccagcaaaaccaa---aatcggg------t
J9PB65_BMF-01          cggcttcacatgcagcaacaccagcaaaaccaa---aatcgag------t
M3WRS0_BMF-02          ------------------caccagcaaaaccgc---cgtcgag------t
M3WRS0_BMF-01          cggcttcatatgcagcaacaccagcaaaaccgc---cgtcgag------t
H0WYH6_BMF-01          cggcttcatgtgcagcaacaccagcagaaccaa---aatcgtg------t
A0A287AIU8_BMF-03      cggcttcatatgcagcagcaccagcagaaccaa---aatcgtg------t
A0A287AIU8_BMF-04      cggcttcatatgcagcagcaccagcagaaccaa---aatcgtg------t
A0A287AIU8_BMF-02      cggcttcatatgcagcagcaccagcagaaccaa---aatcgtg------t
A0A287AIU8_BMF-01      cggcttcatatgcagcagcaccagcagaaccaa---aatcgtg------t
A0A287AIU8_BMF-05      cggcttcatatgcagcagga------------------------------
F6TJI0_BMF-01          cggcttcatatgcagcaacaccagcagaaccga---aatcgcg------t
A0A2K6FFR1_BMF-02      ------------------caccagcagaaccaa---aatcgca------t
A0A2K6FFR1_BMF-01      cggcttcatgtgcagcaacaccagcagaaccaa---aatcgca------t
A0A2K5KGR6_BMF-01      ------------------caccagcagaaccga---aatcgcg------t
A0A0D9R4R5_BMF-01      cggctccatgtgcagcaacaccagcagaaccga---aatcgca------t
G7PAW6_BMF-01          ------------------caccagcagaaccga---aatcgcg------t
G7PAW6_BMF-02          cggctccatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A096NTE9_BMF-01      cggctccatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A096NTE9_BMF-03      ------------------caccagcagaaccga---aatcgcg------t
A0A096NTE9_BMF-02      cggctccatgtgcagcaacaccagcagaaccga---aatcgcg------t
F7CM09_BMF-02          cggctccatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A2K5MJY6_BMF-01      ------------------caccagcagaaccga---aatcgcg------t
A0A2K6B5G4_BMF-03      ------------------caccagcagaaccga---aatcgcg------t
A0A2K5Z4C3_BMF-02      ------------------caccagcagaaccga---aatcgcg------t
A0A2K5MJY6_BMF-02      cggctccatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A2K6B5G4_BMF-02      cggctccatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A2K6B5G4_BMF-01      cggctccatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A2K6B5G4_BMF-04      cggctccatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A2K5Z4C3_BMF-01      cggctccatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A2K5KGR6_BMF-02      cggcttcatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A2K6RAW8_BMF-02      ------------------caccagcagaaccga---aatcgcg------t
A0A2K6RAW8_BMF-01      cggcttcatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A2K6L933_BMF-03      cggcttcatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A2K6L933_BMF-01      cggcttcatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A2K6L933_BMF-02      cggcttcatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A2K5E1W9_BMF-02      ------------------catcagcagaaccga---aatcgcg------t
A0A2K5E1W9_BMF-01      cggcttcatgtgcagcaacatcagcagaaccga---aatcgcg------t
A0A2K6TW86_BMF-02      cggcttcatgtgcagcaacaccagcagaaccga---aatcgtg------t
A0A2K6TW86_BMF-01      cggcttcatgtgcagcaacaccagcagaaccga---aatcgtg------t
A0A2K6TW86_BMF-03      ------------------caccagcagaaccga---aatcgtg------t
F7HPK0_BMF-01          cggcttcatgtgcagcaacaccagcagaaccga---aatcgca------t
F7HPK0_BMF-02          ------------------caccagcagaaccga---aatcgca------t
A0A2J8T301_BMF-01      cggcttcatgtgcagcaacaccagcagaaccga---aatcgcg------t
A0A2I3HD83_BMF-01      ------------------caccagcagaaccga---aatcgcg------t
Q96LC9_BMF-05          ------------------caccagcagaaccaa---aatcgtg------t
Q96LC9_BMF-07          ------------------caccagcagaaccaa---aatcgtg------t
Q96LC9_BMF-01          cggcttcatgtgcagcaacaccagcagaaccaa---aatcgtg------t
Q96LC9_BMF-03          cggcttcatgtgcagcaacaccagcagaaccaa---aatcgtg------t
Q96LC9_BMF-04          cggcttcatgtgcagcaacaccagcagaaccaa---aatcgtg------t
Q96LC9_BMF-02          cggcttcatgtgcagcaacaccagcagaaccaa---aatcgtg------t
Q96LC9_BMF-06          ------------------caccagcagaaccaa---aatcgtg------t
G3QIN5_BMF-02          ------------------caccagcagaaccaa---aatcgtg------t
A0A2R9BS98_BMF-02      ------------------caccagcagaaccaa---aatcgtg------t
A0A2J8QDD5_BMF-01      ------------------caccagcagaaccaa---aatcgtg------t
G3QIN5_BMF-01          cggcttcatgtgcagcaacaccagcagaaccaa---aatcgtg------t
A0A2R9BS98_BMF-01      cggcttcatgtgcagcaacaccagcagaaccaa---aatcgtg------t
A0A2J8QDD5_BMF-02      cggcttcatgtgcagcaacaccagcagaaccaa---aatcgtg------t
H9GL49_BMF-01          aggcttcacctacagaggcaccagcagaacaga---aaccagg------t
K7FRX2_BMF-01          aggctccacatacagaggcatcagcagaacaga---aatcaag------t
U3JS06_BMF-01          cggctccacatacagaggcatcagcagaacaga---aatcaag------t
H0ZMX5_BMF-01          cggctccacattcagaggcatcagcagaacaga---aatcaag------t
A9XRG9_BMF-01          ------------------------------------agtca---------
G1NHG8_BMF-01          cggctccacatacagcggcatcagcagaacaga---aatcaag------t
A9XRG9_BMF-03          cggctccacatacagcggcatcagcagaacaga---aatcaag------t
A9XRG9_BMF-02          cggctccacatacagcggcatcagcagaacaga---aatcaag------t
A9XRH0_BMF-01          cggctccacatacagcggcatcagcagaacaga---aatcaag------t
                                                                         

W5N4P7_BMF-01          gtggtggaggctggctttggctttgttcacattcctgtttgagagacaa-
A0A096LRV0_BMF-01      gtggtggcgcatgactgcagctcttctcagcctcctgtttcatagggggt
I3K2D6_BMF-01          gtggtggcgcctggccgcggcccttctcagccttctgtttgacagggggt
A0A2U9CJH3_BMF-01      gtggtggcgcctggccgcagctctgctcagccttctgtttgacagggggt
A3KND0_BMF-01          --------------------------------------------------
F6TGJ4_BMF-01          ttggtctcagatcttaatcttcttccgcaacttggtaatgcatccagtg-
Q0GKC7_BMF-01          gtggaggcgtgtggcgacggccgtcctcacgctgctgttcggcgccaga-
F6X3N6_BMF-01          gtggtggcaaatcctcctcttccttcacaacttggccttgaacagagag-
G3WDQ2_BMF-01          gtggtggcagatcctcctcttccttcacaatttggccttgaacagagag-
A0A1S3WU31_BMF-01      gtggtggccgttcctgctcttcctacacaacctggctttgaatgagggt-
A0A1U8CPE0_BMF-02      atggtggcaggtcttcctcttcctgcaaaacctggccttgaacagagaa-
A0A1U8CPE0_BMF-01      atggtggcaggtcttcctcttcctgcaaaacctggccttgaacagagaa-
Q8K589_BMF-01          atggcggcaggtcttcctcttccttcaaaacctggccttgaacagacga-
A2AV74_BMF-01          gtggtggcaggtcttccttttccttcaaaacctcgccctgaacagacaa-
A2AV74_BMF-02          gtggtggcaggtcttccttttccttcaaaacctcgccctgaacagacaa-
A0A1S3EQA2_BMF-01      ttgggggcaggtcctcctcttcctgcacaacctggccttgaaccgagaa-
A0A1S3EQA2_BMF-02      ttgggggcaggtcctcctcttcctgcacaacctggccttgaaccgagaa-
A0A286XXB0_BMF-02      atggtggcaggtcttactcttcatgcacaacctgggtctgaacggagaa-
A0A286XXB0_BMF-03      atggtggcaggtcttactcttcatgcacaacctgggtctgaacggagaa-
A0A286XXB0_BMF-01      atggtggcaggtcttactcttcatgcacaacctgggtctgaacggagaa-
G1SR62_BMF-01          gtggtggcagatcctcctcttcctgcacaacctggctctgaatggtgac-
G3T7Z4_BMF-01          gtggaggcagattctccaattcctgcaccaccttgctgtgaacggggag-
G1PAU1_BMF-01          gtggtggcagttcctcctcttcctacataacctcgccttgaatggagat-
Q05KI3_BMF-01          gtggtggcagatcctcctcttcctacacaacgtggctttgaatggagat-
W5QFV1_BMF-01          gtggtggcagatcctcctcttcctacacaacgtggctttgaatggagat-
I3MDS9_BMF-01          gtggtggcagattctcctcttcctgcacaacctggcattaaatggagat-
I3MDS9_BMF-02          gtggtggcagattctcctcttcctgcacaacctggcattaaatggagat-
M3YAD5_BMF-01          gtggtggcagatccttctcttcctacacaaccttgctttgaacgcagac-
J9PB65_BMF-01          gtggtggcagattctcctcttcctgcacaacctggctttgaatgcagat-
M3WRS0_BMF-02          gtggtggcagattctcctcttcctacacaacctggctttgaatgcagaa-
M3WRS0_BMF-01          gtggtggcagattctcctcttcctacacaacctggctttgaatgcagaa-
H0WYH6_BMF-01          gtggtggcaggtcctctttttcctacacaacctggctttgaacggagaa-
A0A287AIU8_BMF-03      gtggtggcaaatcctcctgtttctacacaacctcgctttgcatggagat-
A0A287AIU8_BMF-04      gtggtggcaaatcctcctgtttctacacaacctcgctttgcatggagat-
A0A287AIU8_BMF-02      gtggtggcaaatcctcctgtttctacacaacctcgctttgcatggagat-
A0A287AIU8_BMF-01      gtggtggcaaatcctcctgtttctacacaacctcgctttgcatggagat-
A0A287AIU8_BMF-05      ------------gttcccgt--------------------cgtgg-----
F6TJI0_BMF-01          gtggtggcagaccctgctctttctccacaacctcgctttgaacggagac-
A0A2K6FFR1_BMF-02      gtggtggcagatcctcctcttcctacacaaccttgctttgaacggagaa-
A0A2K6FFR1_BMF-01      gtggtggcagatcctcctcttcctacacaaccttgctttgaacggagaa-
A0A2K5KGR6_BMF-01      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A0D9R4R5_BMF-01      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
G7PAW6_BMF-01          gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
G7PAW6_BMF-02          gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A096NTE9_BMF-01      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A096NTE9_BMF-03      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A096NTE9_BMF-02      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
F7CM09_BMF-02          gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K5MJY6_BMF-01      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K6B5G4_BMF-03      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K5Z4C3_BMF-02      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K5MJY6_BMF-02      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K6B5G4_BMF-02      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K6B5G4_BMF-01      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K6B5G4_BMF-04      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K5Z4C3_BMF-01      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K5KGR6_BMF-02      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K6RAW8_BMF-02      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K6RAW8_BMF-01      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K6L933_BMF-03      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K6L933_BMF-01      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K6L933_BMF-02      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2K5E1W9_BMF-02      gtggtggcaggtcctcctctttctgcacaacctggctttgaatggagaa-
A0A2K5E1W9_BMF-01      gtggtggcaggtcctcctctttctgcacaacctggctttgaatggagaa-
A0A2K6TW86_BMF-02      gtggtggcaggtcctcctcttcctgcacaacctggctttgaatggagaa-
A0A2K6TW86_BMF-01      gtggtggcaggtcctcctcttcctgcacaacctggctttgaatggagaa-
A0A2K6TW86_BMF-03      gtggtggcaggtcctcctcttcctgcacaacctggctttgaatggagaa-
F7HPK0_BMF-01          gtggtggcaggtcctcctcttcctgcacaacctggctttgaatggagaa-
F7HPK0_BMF-02          gtggtggcaggtcctcctcttcctgcacaacctggctttgaatggagaa-
A0A2J8T301_BMF-01      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2I3HD83_BMF-01      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
Q96LC9_BMF-05          gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
Q96LC9_BMF-07          gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
Q96LC9_BMF-01          gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
Q96LC9_BMF-03          gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
Q96LC9_BMF-04          gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
Q96LC9_BMF-02          gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
Q96LC9_BMF-06          gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
G3QIN5_BMF-02          gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2R9BS98_BMF-02      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2J8QDD5_BMF-01      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
G3QIN5_BMF-01          gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2R9BS98_BMF-01      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
A0A2J8QDD5_BMF-02      gtggtggcagatcctcctcttcctgcacaaccttgctttgaatggagaa-
H9GL49_BMF-01          ctggtggcagatcttcttcttcctccataacgtggccttgaacatggag-
K7FRX2_BMF-01          gtggtggcagatccttcttttcctacataacttggccttaaatgtggag-
U3JS06_BMF-01          gtggtggcagctttttctcttcctacacaacttggccttaaacacggag-
H0ZMX5_BMF-01          gtggtggcagctttttctcttcctacacaacttggccttaaacacggag-
A9XRG9_BMF-01          -----ggcag---tttctttcattaaa-------gctttaa---------
G1NHG8_BMF-01          gtggtggcagctttttctctttctacacaacttggccttaaatgtggag-
A9XRG9_BMF-03          gtggtggcagctttttctctttctacacaacttggccttaaacgtggag-
A9XRG9_BMF-02          gtggtggcagctttttctctttctacacaacttggccttaaacgtggag-
A9XRH0_BMF-01          gtggtggcagctttttctctttctacacaacttggccttaaacgtggag-
                                                                         

W5N4P7_BMF-01          -----gggaacaggaaccaacttcgtggtgacc-----------------
A0A096LRV0_BMF-01      ttattgctggaggaggt------ggagcaggac-----------------
I3K2D6_BMF-01          tcatagccggaggaggg------ggtggaggac-----------------
A0A2U9CJH3_BMF-01      tccttgctggaggaggt------ggagcgggac-----------------
A3KND0_BMF-01          ------------------------------ttc-----------------
F6TGJ4_BMF-01          -----gggaatagagcc------gggctggctc-----------------
Q0GKC7_BMF-01          -----gagaaccg-------------------------------------
F6X3N6_BMF-01          -----gagaacaggaat------ggggcaggcc-----------------
G3WDQ2_BMF-01          -----gagaacaggaat------ggggcaggcc-----------------
A0A1S3WU31_BMF-01      -----gagaatagaaac------agggaagcgc-----------------
A0A1U8CPE0_BMF-02      -----gaaaacagggaa------ggggtgggtc-----------------
A0A1U8CPE0_BMF-01      -----gaaaacagggaa------ggggtgggtc-----------------
Q8K589_BMF-01          -----gaaaacagggaa------ggggtgggtc-----------------
A2AV74_BMF-01          -----gaaaacagggaa------ggggtggggc-----------------
A2AV74_BMF-02          -----gaaaacagggaa------ggggtggggc-----------------
A0A1S3EQA2_BMF-01      --------aacagggac------cgggcgggcc-----------------
A0A1S3EQA2_BMF-02      --------aacagggac------cgggcgggcc-----------------
A0A286XXB0_BMF-02      -----gagaacagggaa------ggggcaggtc-----------------
A0A286XXB0_BMF-03      -----gagaacagggaa------ggggcaggtc-----------------
A0A286XXB0_BMF-01      -----gagaacagggaa------ggggcaggtc-----------------
G1SR62_BMF-01          -----gagaacagggat------ggggcaggtc-----------------
G3T7Z4_BMF-01          -----gagaacaggaat------ggggcaggtc-----------------
G1PAU1_BMF-01          -----gagaacaggaac------ggggccggtc-----------------
Q05KI3_BMF-01          -----gagaacaggaac------ggggcaggcc-----------------
W5QFV1_BMF-01          -----gagaacaggaat------ggggcaggcc-----------------
I3MDS9_BMF-01          -----gagaacagggac------cgggcaggtc-----------------
I3MDS9_BMF-02          -----gagaacagggac------cgggcaggtc-----------------
M3YAD5_BMF-01          -----gagaacaggaat------ggggcgggtc-----------------
J9PB65_BMF-01          -----gagaacaggaat------ggggcaggtc-----------------
M3WRS0_BMF-02          -----gagaacaggaat------ggggcaggtc-----------------
M3WRS0_BMF-01          -----gagaacaggaat------ggggcaggtc-----------------
H0WYH6_BMF-01          -----gagaacaggaat------ggggcaggtc-----------------
A0A287AIU8_BMF-03      -----gagaacaggaat------ggggcaggtc-----------------
A0A287AIU8_BMF-04      -----gagaacaggaat------ggggcaggtc-----------------
A0A287AIU8_BMF-02      -----gagaacaggaat------ggggcaggtc-----------------
A0A287AIU8_BMF-01      -----gagaacaggaat------ggggcaggtc-----------------
A0A287AIU8_BMF-05      --------------------------------c-----------------
F6TJI0_BMF-01          -----gagaacaggaac------ggggcaggtc-----------------
A0A2K6FFR1_BMF-02      -----gagaacaggaac------ggggcaggtc-----------------
A0A2K6FFR1_BMF-01      -----gagaacaggaac------ggggcaggtc-----------------
A0A2K5KGR6_BMF-01      -----gagaacaggaac------ggggcgggcc-----------------
A0A0D9R4R5_BMF-01      -----gagaacaggaac------ggggcgggcc-----------------
G7PAW6_BMF-01          -----gagaacaggaac------ggggcgggcc-----------------
G7PAW6_BMF-02          -----gagaacaggaac------ggggcgggcc-----------------
A0A096NTE9_BMF-01      -----gagaacaggaac------ggggtggacc-----------------
A0A096NTE9_BMF-03      -----gagaacaggaac------ggggtggacc-----------------
A0A096NTE9_BMF-02      -----gagaacaggaac------ggggtggacc-----------------
F7CM09_BMF-02          -----cagaacaggaac------ggggcgggcc-----------------
A0A2K5MJY6_BMF-01      -----gagaacaggaac------ggggcgggcc-----------------
A0A2K6B5G4_BMF-03      -----gagaacaggaac------ggggcgggcc-----------------
A0A2K5Z4C3_BMF-02      -----gagaacaggaac------ggggcgggcc-----------------
A0A2K5MJY6_BMF-02      -----gagaacaggaac------ggggcgggcc-----------------
A0A2K6B5G4_BMF-02      -----gagaacaggaac------ggggcgggcc-----------------
A0A2K6B5G4_BMF-01      -----gagaacaggaac------ggggcgggcc-----------------
A0A2K6B5G4_BMF-04      -----gagaacaggaac------ggggcgggcc-----------------
A0A2K5Z4C3_BMF-01      -----gagaacaggaac------ggggcgggcc-----------------
A0A2K5KGR6_BMF-02      -----gagaacaggaac------ggggcgggcc-----------------
A0A2K6RAW8_BMF-02      -----gagaatag-------------------------------------
A0A2K6RAW8_BMF-01      -----gagaataggaac------ggggcgggcc-----------------
A0A2K6L933_BMF-03      -----gagaataggaac------ggggcgggcc-----------------
A0A2K6L933_BMF-01      -----gagaataggaac------ggggcgggcc-----------------
A0A2K6L933_BMF-02      -----gagaataggaac------ggggcgggcc-----------------
A0A2K5E1W9_BMF-02      -----gagaacaggaat------ggggcaggcc-----------------
A0A2K5E1W9_BMF-01      -----gagaacaggaat------ggggcaggcc-----------------
A0A2K6TW86_BMF-02      -----gaaaacaggaat------ggggcaggtc-----------------
A0A2K6TW86_BMF-01      -----gaaaacaggaat------ggggcaggtc-----------------
A0A2K6TW86_BMF-03      -----gaaaacaggaat------ggggcaggtc-----------------
F7HPK0_BMF-01          -----gagaacaggaat------ggggcaggcc-----------------
F7HPK0_BMF-02          -----gagaacaggaat------ggggcaggcc-----------------
A0A2J8T301_BMF-01      -----gagaacaggaac------ggggcaggcc-----------------
A0A2I3HD83_BMF-01      -----gagaacaggaat------ggggcaggcc-----------------
Q96LC9_BMF-05          -----gagaacaggaac------ggggcaggcc-----------------
Q96LC9_BMF-07          -----gagaacaggaac------ggggcaggcc-----------------
Q96LC9_BMF-01          -----gagaacaggaac------ggggcaggcc-----------------
Q96LC9_BMF-03          -----gagaacaggaac------ggggcaggcc-----------------
Q96LC9_BMF-04          -----gagaacaggaac------ggggcaggcc-----------------
Q96LC9_BMF-02          -----gagaacaggaac------ggggcaggcc-----------------
Q96LC9_BMF-06          -----gagaacaggaac------ggggcaggcc-----------------
G3QIN5_BMF-02          -----gagaacaggaac------ggggcaggcc-----------------
A0A2R9BS98_BMF-02      -----gagaacaggaac------ggggcaggcc-----------------
A0A2J8QDD5_BMF-01      -----gagaacaggaac------ggggcaggcc-----------------
G3QIN5_BMF-01          -----gagaacaggaac------ggggcaggcc-----------------
A0A2R9BS98_BMF-01      -----gagaacaggaac------ggggcaggcc-----------------
A0A2J8QDD5_BMF-02      -----gagaacaggaac------ggggcaggcc-----------------
H9GL49_BMF-01          -----gcaaacagacat------cgtgctggccgtagttgtaccacaacc
K7FRX2_BMF-01          -----gcgaacaggaac------cacataggtc-----------------
U3JS06_BMF-01          -----gtgaacaggaac------cacactgggc-----------------
H0ZMX5_BMF-01          -----gtgaacaggaac------cacactgggc-----------------
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          -----gcgaacaggaac------cgcactgggc-----------------
A9XRG9_BMF-03          -----gcgaacaggaac------cgcactgggc-----------------
A9XRG9_BMF-02          -----gcgaacaggaac------cgcactgggc-----------------
A9XRH0_BMF-01          -----gcgaacaggaac------cgcactgggc-----------------
                                                                         

W5N4P7_BMF-01          --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A2U9CJH3_BMF-01      --------------------------------------------------
A3KND0_BMF-01          --------------------------------------------------
F6TGJ4_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A1S3WU31_BMF-01      --------------------------------------------------
A0A1U8CPE0_BMF-02      --------------------------------------------------
A0A1U8CPE0_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
A2AV74_BMF-01          --------------------------------------------------
A2AV74_BMF-02          --------------------------------------------------
A0A1S3EQA2_BMF-01      --------------------------------------------------
A0A1S3EQA2_BMF-02      --------------------------------------------------
A0A286XXB0_BMF-02      --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
G3T7Z4_BMF-01          --------------------------------------------------
G1PAU1_BMF-01          --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
I3MDS9_BMF-01          --------------------------------------------------
I3MDS9_BMF-02          --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A287AIU8_BMF-03      --------------------------------------------------
A0A287AIU8_BMF-04      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-05      --------------------------------------------------
F6TJI0_BMF-01          --------------------------------------------------
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
F7CM09_BMF-02          --------------------------------------------------
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-04      --------------------------------------------------
A0A2K5Z4C3_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-03      --------------------------------------------------
A0A2K6L933_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-02      --------------------------------------------------
A0A2K6TW86_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          --------------------------------------------------
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
H9GL49_BMF-01          tattttccttttactgagcctccggtgtgttttccattctctgaaatgct
K7FRX2_BMF-01          --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
H0ZMX5_BMF-01          --------------------------------------------------
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A9XRG9_BMF-03          --------------------------------------------------
A9XRG9_BMF-02          --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
                                                                         

W5N4P7_BMF-01          ---------------agag-------------------------------
A0A096LRV0_BMF-01      ---------------ggag-------------------------------
I3K2D6_BMF-01          ---------------ggag-------------------------------
A0A2U9CJH3_BMF-01      ---------------ggag-------------------------------
A3KND0_BMF-01          ---------------aagt-------------------------------
F6TGJ4_BMF-01          ---------------agag-------------------------------
Q0GKC7_BMF-01          ---------------cagg-------------------------------
F6X3N6_BMF-01          ---------------ctag-------------------------------
G3WDQ2_BMF-01          ---------------ctag-------------------------------
A0A1S3WU31_BMF-01      ---------------ccag-------------------------------
A0A1U8CPE0_BMF-02      ---------------cctg-------------------------------
A0A1U8CPE0_BMF-01      ---------------cctg-------------------------------
Q8K589_BMF-01          ---------------cctg-------------------------------
A2AV74_BMF-01          ---------------cctg-------------------------------
A2AV74_BMF-02          ---------------cctg-------------------------------
A0A1S3EQA2_BMF-01      ---------------ccag-------------------------------
A0A1S3EQA2_BMF-02      ---------------ccag-------------------------------
A0A286XXB0_BMF-02      ---------------ccag-------------------------------
A0A286XXB0_BMF-03      ---------------ccag-------------------------------
A0A286XXB0_BMF-01      ---------------ccag-------------------------------
G1SR62_BMF-01          ---------------ctag-------------------------------
G3T7Z4_BMF-01          ---------------ctag-------------------------------
G1PAU1_BMF-01          ---------------ccag-------------------------------
Q05KI3_BMF-01          ---------------ccag-------------------------------
W5QFV1_BMF-01          ---------------ccag-------------------------------
I3MDS9_BMF-01          ---------------ctag-------------------------------
I3MDS9_BMF-02          ---------------ctag-------------------------------
M3YAD5_BMF-01          ---------------ccag-------------------------------
J9PB65_BMF-01          ---------------ccag---------cttccagctagtcccgggaata
M3WRS0_BMF-02          ---------------ccag-------------------------------
M3WRS0_BMF-01          ---------------ccag-------------------------------
H0WYH6_BMF-01          ---------------ccag-------------------------------
A0A287AIU8_BMF-03      ---------------ccag-------------------------------
A0A287AIU8_BMF-04      ---------------ccag-------------------------------
A0A287AIU8_BMF-02      ---------------ccag-------------------------------
A0A287AIU8_BMF-01      ---------------ccag-------------------------------
A0A287AIU8_BMF-05      ---------------ttgg-------------------------------
F6TJI0_BMF-01          ---------------ccag-------------------------------
A0A2K6FFR1_BMF-02      ---------------ccag-------------------------------
A0A2K6FFR1_BMF-01      ---------------ccag-------------------------------
A0A2K5KGR6_BMF-01      ---------------ccaggtgaggctgggctgccctcttcacatggggc
A0A0D9R4R5_BMF-01      ---------------ctag-------------------------------
G7PAW6_BMF-01          ---------------ctag-------------------------------
G7PAW6_BMF-02          ---------------ctag-------------------------------
A0A096NTE9_BMF-01      ---------------ctaggtataaaaatgcaagaagatcagttaggaaa
A0A096NTE9_BMF-03      ---------------ctag-------------------------------
A0A096NTE9_BMF-02      ---------------ctaggcccctgacctggaatggggccgttgtcaaa
F7CM09_BMF-02          ---------------ctag-------------------------------
A0A2K5MJY6_BMF-01      ---------------ctag-------------------------------
A0A2K6B5G4_BMF-03      ---------------ctag-------------------------------
A0A2K5Z4C3_BMF-02      ---------------ctag-------------------------------
A0A2K5MJY6_BMF-02      ---------------ctag-------------------------------
A0A2K6B5G4_BMF-02      ---------------ctag-------------------------------
A0A2K6B5G4_BMF-01      ---------------ctag-------------------------------
A0A2K6B5G4_BMF-04      ---------------ctag-------------------------------
A0A2K5Z4C3_BMF-01      ---------------ctag-------------------------------
A0A2K5KGR6_BMF-02      ---------------ccag-------------------------------
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      ---------------ctag-------------------------------
A0A2K6L933_BMF-03      ---------------ctag-------------------------------
A0A2K6L933_BMF-01      ---------------ctag-------------------------------
A0A2K6L933_BMF-02      ---------------ctag------gcccttgacctggaatgggggccgt
A0A2K5E1W9_BMF-02      ---------------cgag-------------------------------
A0A2K5E1W9_BMF-01      ---------------cgag-------------------------------
A0A2K6TW86_BMF-02      ---------------cgag-------------------------------
A0A2K6TW86_BMF-01      ---------------cgag-------------------------------
A0A2K6TW86_BMF-03      ---------------cgag-------------------------------
F7HPK0_BMF-01          ---------------cgag-------------------------------
F7HPK0_BMF-02          ---------------cgag-------------------------------
A0A2J8T301_BMF-01      ---------------ctag-------------------------------
A0A2I3HD83_BMF-01      ---------------ctag-------------------------------
Q96LC9_BMF-05          ---------------ctag-------------------------------
Q96LC9_BMF-07          ---------------ctag-------------------------------
Q96LC9_BMF-01          ---------------ctag-------------------------------
Q96LC9_BMF-03          ---------------ctag-------------------------------
Q96LC9_BMF-04          ---------------ctag-------------------------------
Q96LC9_BMF-02          ---------------ctag-------------------------------
Q96LC9_BMF-06          ---------------ctag-------------------------------
G3QIN5_BMF-02          ---------------ctag-------------------------------
A0A2R9BS98_BMF-02      ---------------ctag-------------------------------
A0A2J8QDD5_BMF-01      ---------------ctag-------------------------------
G3QIN5_BMF-01          ---------------ctag-------------------------------
A0A2R9BS98_BMF-01      ---------------ctag-------------------------------
A0A2J8QDD5_BMF-02      ---------------ctag-------------------------------
H9GL49_BMF-01          gccaagattctgtctagag-------------------------------
K7FRX2_BMF-01          ---------------agag-------------------------------
U3JS06_BMF-01          ---------------agag-------------------------------
H0ZMX5_BMF-01          ---------------agag-------------------------------
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          ---------------agag-------------------------------
A9XRG9_BMF-03          ---------------agag-------------------------------
A9XRG9_BMF-02          ---------------agag-------------------------------
A9XRH0_BMF-01          ---------------agag-------------------------------
                                                                         

W5N4P7_BMF-01          -----------------------------------g--------------
A0A096LRV0_BMF-01      -----------------------------------g--------------
I3K2D6_BMF-01          -----------------------------------g--------------
A0A2U9CJH3_BMF-01      -----------------------------------gcaggcgcacacaaa
A3KND0_BMF-01          -----------------------------------a--------------
F6TGJ4_BMF-01          -----------------------------------g--------------
Q0GKC7_BMF-01          --------------------------------------------------
F6X3N6_BMF-01          -----------------------------------g--------------
G3WDQ2_BMF-01          -----------------------------------g--------------
A0A1S3WU31_BMF-01      -----------------------------------g--------------
A0A1U8CPE0_BMF-02      -----------------------------------g--------------
A0A1U8CPE0_BMF-01      -----------------------------------g--------------
Q8K589_BMF-01          -----------------------------------g--------------
A2AV74_BMF-01          -----------------------------------g--------------
A2AV74_BMF-02          -----------------------------------g--------------
A0A1S3EQA2_BMF-01      -----------------------------------g--------------
A0A1S3EQA2_BMF-02      -----------------------------------g--------------
A0A286XXB0_BMF-02      -----------------------------------g--------------
A0A286XXB0_BMF-03      -----------------------------------g--------------
A0A286XXB0_BMF-01      -----------------------------------g--------------
G1SR62_BMF-01          -----------------------------------g--------------
G3T7Z4_BMF-01          -----------------------------------g--------------
G1PAU1_BMF-01          -----------------------------------g--------------
Q05KI3_BMF-01          -----------------------------------g--------------
W5QFV1_BMF-01          -----------------------------------g--------------
I3MDS9_BMF-01          -----------------------------------g--------------
I3MDS9_BMF-02          -----------------------------------g--------------
M3YAD5_BMF-01          -----------------------------------g--------------
J9PB65_BMF-01          tcgtgctctggagctcagcaggattgcagctgcctc--------------
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          -----------------------------------g--------------
H0WYH6_BMF-01          -----------------------------------g--------------
A0A287AIU8_BMF-03      -----------------------------------g--------------
A0A287AIU8_BMF-04      -----------------------------------g--------------
A0A287AIU8_BMF-02      -----------------------------------g--------------
A0A287AIU8_BMF-01      -----------------------------------g--------------
A0A287AIU8_BMF-05      -----------------------------------t--------------
F6TJI0_BMF-01          -----------------------------------g--------------
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      -----------------------------------g--------------
A0A2K5KGR6_BMF-01      accaggaacaccgtcaggaaggacatcgggcaggac--------------
A0A0D9R4R5_BMF-01      -----------------------------------g--------------
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          -----------------------------------g--------------
A0A096NTE9_BMF-01      ttaaaggcttctagctttctcagctgccagcctgag--------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      ------------------------------ccctgt--------------
F7CM09_BMF-02          -----------------------------------g--------------
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      -----------------------------------g--------------
A0A2K6B5G4_BMF-02      -----------------------------------g--------------
A0A2K6B5G4_BMF-01      -----------------------------------g--------------
A0A2K6B5G4_BMF-04      -----------------------------------g--------------
A0A2K5Z4C3_BMF-01      -----------------------------------g--------------
A0A2K5KGR6_BMF-02      -----------------------------------g--------------
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      -----------------------------------g--------------
A0A2K6L933_BMF-03      -----------------------------------g--------------
A0A2K6L933_BMF-01      -----------------------------------g--------------
A0A2K6L933_BMF-02      tgtcaaacactgttgaaggggaggctgatgtgtctg--------------
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      -----------------------------------g--------------
A0A2K6TW86_BMF-02      -----------------------------------g--------------
A0A2K6TW86_BMF-01      -----------------------------------g--------------
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          -----------------------------------g--------------
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      -----------------------------------g--------------
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          -----------------------------------g--------------
Q96LC9_BMF-03          -----------------------------------g--------------
Q96LC9_BMF-04          -----------------------------------g--------------
Q96LC9_BMF-02          -----------------------------------g--------------
Q96LC9_BMF-06          -----------------------------------g--------------
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          -----------------------------------g--------------
A0A2R9BS98_BMF-01      -----------------------------------g--------------
A0A2J8QDD5_BMF-02      -----------------------------------g--------------
H9GL49_BMF-01          -----------------------------------g--------------
K7FRX2_BMF-01          -----------------------------------g--------------
U3JS06_BMF-01          -----------------------------------g--------------
H0ZMX5_BMF-01          -----------------------------------g--------------
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          -----------------------------------g--------------
A9XRG9_BMF-03          -----------------------------------g--------------
A9XRG9_BMF-02          -----------------------------------g--------------
A9XRH0_BMF-01          -----------------------------------g--------------
                                                                         

W5N4P7_BMF-01          --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A2U9CJH3_BMF-01      acgcagggcgaaagcctccgggccgcagaaccgggccagttcagtggaga
A3KND0_BMF-01          --------------------------------------------------
F6TGJ4_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A1S3WU31_BMF-01      --------------------------------------------------
A0A1U8CPE0_BMF-02      --------------------------------------------------
A0A1U8CPE0_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
A2AV74_BMF-01          --------------------------------------------------
A2AV74_BMF-02          --------------------------------------------------
A0A1S3EQA2_BMF-01      --------------------------------------------------
A0A1S3EQA2_BMF-02      --------------------------------------------------
A0A286XXB0_BMF-02      --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
G3T7Z4_BMF-01          --------------------------------------------------
G1PAU1_BMF-01          --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
I3MDS9_BMF-01          --------------------------------------------------
I3MDS9_BMF-02          --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A287AIU8_BMF-03      --------------------------------------------------
A0A287AIU8_BMF-04      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-05      --------------------------------------------------
F6TJI0_BMF-01          --------------------------------------------------
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
F7CM09_BMF-02          --------------------------------------------------
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-04      --------------------------------------------------
A0A2K5Z4C3_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-03      --------------------------------------------------
A0A2K6L933_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-02      --------------------------------------------------
A0A2K6TW86_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          --------------------------------------------------
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
H0ZMX5_BMF-01          --------------------------------------------------
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A9XRG9_BMF-03          --------------------------------------------------
A9XRG9_BMF-02          --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
                                                                         

W5N4P7_BMF-01          --------------------------------------------------
A0A096LRV0_BMF-01      --------------------------------------------------
I3K2D6_BMF-01          --------------------------------------------------
A0A2U9CJH3_BMF-01      ggacggtccaggcgatgaccaaccagttcacctcactgccgcctcagcag
A3KND0_BMF-01          --------------------------------------------------
F6TGJ4_BMF-01          --------------------------------------------------
Q0GKC7_BMF-01          --------------------------------------------------
F6X3N6_BMF-01          --------------------------------------------------
G3WDQ2_BMF-01          --------------------------------------------------
A0A1S3WU31_BMF-01      --------------------------------------------------
A0A1U8CPE0_BMF-02      --------------------------------------------------
A0A1U8CPE0_BMF-01      --------------------------------------------------
Q8K589_BMF-01          --------------------------------------------------
A2AV74_BMF-01          --------------------------------------------------
A2AV74_BMF-02          --------------------------------------------------
A0A1S3EQA2_BMF-01      --------------------------------------------------
A0A1S3EQA2_BMF-02      --------------------------------------------------
A0A286XXB0_BMF-02      --------------------------------------------------
A0A286XXB0_BMF-03      --------------------------------------------------
A0A286XXB0_BMF-01      --------------------------------------------------
G1SR62_BMF-01          --------------------------------------------------
G3T7Z4_BMF-01          --------------------------------------------------
G1PAU1_BMF-01          --------------------------------------------------
Q05KI3_BMF-01          --------------------------------------------------
W5QFV1_BMF-01          --------------------------------------------------
I3MDS9_BMF-01          --------------------------------------------------
I3MDS9_BMF-02          --------------------------------------------------
M3YAD5_BMF-01          --------------------------------------------------
J9PB65_BMF-01          --------------------------------------------------
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          --------------------------------------------------
H0WYH6_BMF-01          --------------------------------------------------
A0A287AIU8_BMF-03      --------------------------------------------------
A0A287AIU8_BMF-04      --------------------------------------------------
A0A287AIU8_BMF-02      --------------------------------------------------
A0A287AIU8_BMF-01      --------------------------------------------------
A0A287AIU8_BMF-05      --------------------------------------------------
F6TJI0_BMF-01          --------------------------------------------------
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-01      --------------------------------------------------
A0A0D9R4R5_BMF-01      --------------------------------------------------
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          --------------------------------------------------
A0A096NTE9_BMF-01      --------------------------------------------------
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      --------------------------------------------------
F7CM09_BMF-02          --------------------------------------------------
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-02      --------------------------------------------------
A0A2K6B5G4_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-04      --------------------------------------------------
A0A2K5Z4C3_BMF-01      --------------------------------------------------
A0A2K5KGR6_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-03      --------------------------------------------------
A0A2K6L933_BMF-01      --------------------------------------------------
A0A2K6L933_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-02      --------------------------------------------------
A0A2K6TW86_BMF-01      --------------------------------------------------
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          --------------------------------------------------
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      --------------------------------------------------
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          --------------------------------------------------
Q96LC9_BMF-03          --------------------------------------------------
Q96LC9_BMF-04          --------------------------------------------------
Q96LC9_BMF-02          --------------------------------------------------
Q96LC9_BMF-06          --------------------------------------------------
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          --------------------------------------------------
A0A2R9BS98_BMF-01      --------------------------------------------------
A0A2J8QDD5_BMF-02      --------------------------------------------------
H9GL49_BMF-01          --------------------------------------------------
K7FRX2_BMF-01          --------------------------------------------------
U3JS06_BMF-01          --------------------------------------------------
H0ZMX5_BMF-01          --------------------------------------------------
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          --------------------------------------------------
A9XRG9_BMF-03          --------------------------------------------------
A9XRG9_BMF-02          --------------------------------------------------
A9XRH0_BMF-01          --------------------------------------------------
                                                                         

W5N4P7_BMF-01          ---------------------------------------------tga--
A0A096LRV0_BMF-01      ---------------------------------------------tga--
I3K2D6_BMF-01          ---------------------------------------------tga--
A0A2U9CJH3_BMF-01      ctgccacctccagccaacggtcggcttccctgcgcgctgattggctaa--
A3KND0_BMF-01          ---------------------------------------------tga--
F6TGJ4_BMF-01          ---------------------------------------------tga--
Q0GKC7_BMF-01          ---------------------------------------------tga--
F6X3N6_BMF-01          ---------------------------------------------tga--
G3WDQ2_BMF-01          ---------------------------------------------tga--
A0A1S3WU31_BMF-01      ---------------------------------------------tga--
A0A1U8CPE0_BMF-02      ---------------------------------------------tga--
A0A1U8CPE0_BMF-01      ---------------------------------------------tga--
Q8K589_BMF-01          ---------------------------------------------tga--
A2AV74_BMF-01          ---------------------------------------------tga--
A2AV74_BMF-02          ---------------------------------------------tga--
A0A1S3EQA2_BMF-01      ---------------------------------------------tga--
A0A1S3EQA2_BMF-02      ---------------------------------------------tga--
A0A286XXB0_BMF-02      ---------------------------------------------tga--
A0A286XXB0_BMF-03      ---------------------------------------------tga--
A0A286XXB0_BMF-01      ---------------------------------------------tga--
G1SR62_BMF-01          ---------------------------------------------tga--
G3T7Z4_BMF-01          ---------------------------------------------tga--
G1PAU1_BMF-01          ---------------------------------------------tga--
Q05KI3_BMF-01          ---------------------------------------------tga--
W5QFV1_BMF-01          ---------------------------------------------tga--
I3MDS9_BMF-01          ---------------------------------------------tga--
I3MDS9_BMF-02          ---------------------------------------------tga--
M3YAD5_BMF-01          ---------------------------------------------tga--
J9PB65_BMF-01          ---------------------------------------------tga--
M3WRS0_BMF-02          --------------------------------------------------
M3WRS0_BMF-01          ---------------------------------------------tga--
H0WYH6_BMF-01          ---------------------------------------------tga--
A0A287AIU8_BMF-03      ---------------------------------------------tga--
A0A287AIU8_BMF-04      ---------------------------------------------tga--
A0A287AIU8_BMF-02      ---------------------------------------------tga--
A0A287AIU8_BMF-01      ---------------------------------------------tga--
A0A287AIU8_BMF-05      ---------------------------------------------taa--
F6TJI0_BMF-01          ---------------------------------------------tga--
A0A2K6FFR1_BMF-02      --------------------------------------------------
A0A2K6FFR1_BMF-01      ---------------------------------------------tga--
A0A2K5KGR6_BMF-01      ---------------------------------------------tgaca
A0A0D9R4R5_BMF-01      ---------------------------------------------tga--
G7PAW6_BMF-01          --------------------------------------------------
G7PAW6_BMF-02          ---------------------------------------------tga--
A0A096NTE9_BMF-01      ---------------------------------------------tga--
A0A096NTE9_BMF-03      --------------------------------------------------
A0A096NTE9_BMF-02      ---------------------------------------------tga--
F7CM09_BMF-02          ---------------------------------------------tga--
A0A2K5MJY6_BMF-01      --------------------------------------------------
A0A2K6B5G4_BMF-03      --------------------------------------------------
A0A2K5Z4C3_BMF-02      --------------------------------------------------
A0A2K5MJY6_BMF-02      ---------------------------------------------tga--
A0A2K6B5G4_BMF-02      ---------------------------------------------tga--
A0A2K6B5G4_BMF-01      ---------------------------------------------tga--
A0A2K6B5G4_BMF-04      ---------------------------------------------tga--
A0A2K5Z4C3_BMF-01      ---------------------------------------------tga--
A0A2K5KGR6_BMF-02      ---------------------------------------------tga--
A0A2K6RAW8_BMF-02      --------------------------------------------------
A0A2K6RAW8_BMF-01      ---------------------------------------------tga--
A0A2K6L933_BMF-03      ---------------------------------------------tga--
A0A2K6L933_BMF-01      ---------------------------------------------tga--
A0A2K6L933_BMF-02      ---------------------------------------------tga--
A0A2K5E1W9_BMF-02      --------------------------------------------------
A0A2K5E1W9_BMF-01      ---------------------------------------------tga--
A0A2K6TW86_BMF-02      ---------------------------------------------tga--
A0A2K6TW86_BMF-01      ---------------------------------------------tga--
A0A2K6TW86_BMF-03      --------------------------------------------------
F7HPK0_BMF-01          ---------------------------------------------tga--
F7HPK0_BMF-02          --------------------------------------------------
A0A2J8T301_BMF-01      ---------------------------------------------tga--
A0A2I3HD83_BMF-01      --------------------------------------------------
Q96LC9_BMF-05          --------------------------------------------------
Q96LC9_BMF-07          --------------------------------------------------
Q96LC9_BMF-01          ---------------------------------------------tga--
Q96LC9_BMF-03          ---------------------------------------------tga--
Q96LC9_BMF-04          ---------------------------------------------tga--
Q96LC9_BMF-02          ---------------------------------------------tga--
Q96LC9_BMF-06          ---------------------------------------------tga--
G3QIN5_BMF-02          --------------------------------------------------
A0A2R9BS98_BMF-02      --------------------------------------------------
A0A2J8QDD5_BMF-01      --------------------------------------------------
G3QIN5_BMF-01          ---------------------------------------------tga--
A0A2R9BS98_BMF-01      ---------------------------------------------tga--
A0A2J8QDD5_BMF-02      ---------------------------------------------tga--
H9GL49_BMF-01          ----------------------------------------ctatctga--
K7FRX2_BMF-01          ---------------------------------------------tga--
U3JS06_BMF-01          ---------------------------------------------tga--
H0ZMX5_BMF-01          ---------------------------------------------tga--
A9XRG9_BMF-01          --------------------------------------------------
G1NHG8_BMF-01          ---------------------------------------------tga--
A9XRG9_BMF-03          ---------------------------------------------tga--
A9XRG9_BMF-02          ---------------------------------------------tga--
A9XRH0_BMF-01          ---------------------------------------------tga--
                                                                         

W5N4P7_BMF-01          ---------------------------------------------
A0A096LRV0_BMF-01      ---------------------------------------------
I3K2D6_BMF-01          ---------------------------------------------
A0A2U9CJH3_BMF-01      ---------------------------------------------
A3KND0_BMF-01          ---------------------------------------------
F6TGJ4_BMF-01          ---------------------------------------------
Q0GKC7_BMF-01          ---------------------------------------------
F6X3N6_BMF-01          ---------------------------------------------
G3WDQ2_BMF-01          ---------------------------------------------
A0A1S3WU31_BMF-01      ---------------------------------------------
A0A1U8CPE0_BMF-02      ---------------------------------------------
A0A1U8CPE0_BMF-01      ---------------------------------------------
Q8K589_BMF-01          ---------------------------------------------
A2AV74_BMF-01          ---------------------------------------------
A2AV74_BMF-02          ---------------------------------------------
A0A1S3EQA2_BMF-01      ---------------------------------------------
A0A1S3EQA2_BMF-02      ---------------------------------------------
A0A286XXB0_BMF-02      ---------------------------------------------
A0A286XXB0_BMF-03      ---------------------------------------------
A0A286XXB0_BMF-01      ---------------------------------------------
G1SR62_BMF-01          ---------------------------------------------
G3T7Z4_BMF-01          ---------------------------------------------
G1PAU1_BMF-01          ---------------------------------------------
Q05KI3_BMF-01          ---------------------------------------------
W5QFV1_BMF-01          ---------------------------------------------
I3MDS9_BMF-01          ---------------------------------------------
I3MDS9_BMF-02          ---------------------------------------------
M3YAD5_BMF-01          ---------------------------------------------
J9PB65_BMF-01          ---------------------------------------------
M3WRS0_BMF-02          ---------------------------------------------
M3WRS0_BMF-01          ---------------------------------------------
H0WYH6_BMF-01          ---------------------------------------------
A0A287AIU8_BMF-03      ---------------------------------------------
A0A287AIU8_BMF-04      ---------------------------------------------
A0A287AIU8_BMF-02      ---------------------------------------------
A0A287AIU8_BMF-01      ---------------------------------------------
A0A287AIU8_BMF-05      ---------------------------------------------
F6TJI0_BMF-01          ---------------------------------------------
A0A2K6FFR1_BMF-02      ---------------------------------------------
A0A2K6FFR1_BMF-01      ---------------------------------------------
A0A2K5KGR6_BMF-01      ctgtgtcttgtgaagttgtttttttgttgttattttgcgttttaa
A0A0D9R4R5_BMF-01      ---------------------------------------------
G7PAW6_BMF-01          ---------------------------------------------
G7PAW6_BMF-02          ---------------------------------------------
A0A096NTE9_BMF-01      ---------------------------------------------
A0A096NTE9_BMF-03      ---------------------------------------------
A0A096NTE9_BMF-02      ---------------------------------------------
F7CM09_BMF-02          ---------------------------------------------
A0A2K5MJY6_BMF-01      ---------------------------------------------
A0A2K6B5G4_BMF-03      ---------------------------------------------
A0A2K5Z4C3_BMF-02      ---------------------------------------------
A0A2K5MJY6_BMF-02      ---------------------------------------------
A0A2K6B5G4_BMF-02      ---------------------------------------------
A0A2K6B5G4_BMF-01      ---------------------------------------------
A0A2K6B5G4_BMF-04      ---------------------------------------------
A0A2K5Z4C3_BMF-01      ---------------------------------------------
A0A2K5KGR6_BMF-02      ---------------------------------------------
A0A2K6RAW8_BMF-02      ---------------------------------------------
A0A2K6RAW8_BMF-01      ---------------------------------------------
A0A2K6L933_BMF-03      ---------------------------------------------
A0A2K6L933_BMF-01      ---------------------------------------------
A0A2K6L933_BMF-02      ---------------------------------------------
A0A2K5E1W9_BMF-02      ---------------------------------------------
A0A2K5E1W9_BMF-01      ---------------------------------------------
A0A2K6TW86_BMF-02      ---------------------------------------------
A0A2K6TW86_BMF-01      ---------------------------------------------
A0A2K6TW86_BMF-03      ---------------------------------------------
F7HPK0_BMF-01          ---------------------------------------------
F7HPK0_BMF-02          ---------------------------------------------
A0A2J8T301_BMF-01      ---------------------------------------------
A0A2I3HD83_BMF-01      ---------------------------------------------
Q96LC9_BMF-05          ---------------------------------------------
Q96LC9_BMF-07          ---------------------------------------------
Q96LC9_BMF-01          ---------------------------------------------
Q96LC9_BMF-03          ---------------------------------------------
Q96LC9_BMF-04          ---------------------------------------------
Q96LC9_BMF-02          ---------------------------------------------
Q96LC9_BMF-06          ---------------------------------------------
G3QIN5_BMF-02          ---------------------------------------------
A0A2R9BS98_BMF-02      ---------------------------------------------
A0A2J8QDD5_BMF-01      ---------------------------------------------
G3QIN5_BMF-01          ---------------------------------------------
A0A2R9BS98_BMF-01      ---------------------------------------------
A0A2J8QDD5_BMF-02      ---------------------------------------------
H9GL49_BMF-01          ---------------------------------------------
K7FRX2_BMF-01          ---------------------------------------------
U3JS06_BMF-01          ---------------------------------------------
H0ZMX5_BMF-01          ---------------------------------------------
A9XRG9_BMF-01          ---------------------------------------------
G1NHG8_BMF-01          ---------------------------------------------
A9XRG9_BMF-03          ---------------------------------------------
A9XRG9_BMF-02          ---------------------------------------------
A9XRH0_BMF-01          ---------------------------------------------
                                                                    

© 1998-2019