Dataset for CDS BIK of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

31 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

W5QCU2_BIK-01          atgtatcaagcaagacccctctctaggaacctctttttgtacaccttcct
Q925D2_BIK-01          atgtcagaggcgagactaatggccagagacatt---atcaagactcttct
O70337_BIK-01          atgtcggaggcgagacttatggccagagacgtc---atcaagactgttcc
O70337_BIK-02          atgtcggaggcgagacttatggccagagacgtc---atcaagactgttcc
O70337_BIK-04          atgtt---------------------------------------------
F1PUF4_BIK-01          atgtctcactcaggacccctctccaggaacctctttctgagcaccttcct
F6RS78_BIK-01          atgtctcaagtaggacccgtctccagggacctctttctggacgccttcct
A0A1S3FUQ7_BIK-01      atgtcggaggccgggtctgtcaccagggacctcttcatcaagaccctcct
G1TZR9_BIK-01          atgtctgaagtcagacctggctccagggacctcttccaggaagccctcct
H0W025_BIK-01          atgtcggaagcaaaacctgtcgccagggacccactgatggagaccccgct
I3LVX0_BIK-01          at------------------------------------------------
G1S1X2_BIK-01          atgtccgaagtaagacccatctccagagacatcttgatggagagcctcct
A0A2K6MCW0_BIK-01      atgtctggagtaagacccgtctccagagacatcttgatggagaccctcct
A0A2K6QK74_BIK-01      atgtctggagtaagacccgtctccagagacatcttgatggagaccctcct
A0A2K5J4Q7_BIK-01      atgtctggagtaagacccatctccagagacatcttgatggagaccctcct
A0A0D9QZY8_BIK-01      atgtctggagtaagacccatctccagacacatcttgatggagagcctcct
A0A2K5VW94_BIK-01      atgtctggagtaagacccatctccagagacaccttgatggagaccctcct
A0A2K6DBJ4_BIK-01      atgtctggagtaagacccatctccagagacaccttgatggagaccctcct
A0A2K5LDM6_BIK-01      atgtctggagtaagacccatctccagagacacctggatggagaccctcct
A0A2K5XSA1_BIK-01      atgtctggagtaagacccatctccagagacaccttgatggagaccctcct
A0A096NKG5_BIK-01      atgtctggagttagacccatctccagagacatcttgatggagaccctcct
H2P4N6_BIK-01          atgtctgaagtaagacctatctccagagacatcctgatggagaccctcct
G3QCT2_BIK-01          atgtctgaagtaagacccctctccagagacatcttgatggagaccctcct
Q13323_BIK-01          atgtctgaagtaagacccctctccagagacatcttgatggagaccctcct
A0A2R8ZXD2_BIK-01      atgtctgaagtaagacccctctccagagacatcttgatggagaccctcct
H2QLU7_BIK-01          atgtctgaagtaagacccctctccagagacatcttgatggagaccctcct
A0A2K6TBD7_BIK-01      atgtctgaagacagacccctctccagcgacatcttgatggagactctcct
A0A2K5CLG5_BIK-01      atgtctgaagttagacccctctccagtgacatcttgatggagaccctctt
F7FUT7_BIK-01          atgtctgaagtaagacccctctccagtgacatcttcatggagaccctcct
H0XAE7_BIK-01          atgtcagcaggaaggccagtctccatggaccactttatggagaccttccc
A0A2K6FM79_BIK-01      atgtctgaggtgagacccgtctccacggacctcctcatggagaccttccc

W5QCU2_BIK-01          acaaaaccacggcccaggcttcctggatgaccaaggctcagggcttcccg
Q925D2_BIK-01          acacgaccaggtcccccaacctgca------gtggtctctggggctccca
O70337_BIK-01          acacgaccaggtcccccaacctcca------gtggcctctgagactccca
O70337_BIK-02          acacgaccaggtcccccaacctcca------gtggcctctgagactccca
O70337_BIK-04          -cac----------------------------------------------
F1PUF4_BIK-01          gcaggagcatggcccagaagtt---------------ctggaggttccgg
F6RS78_BIK-01          gcacgagcgcagcccggaagcc---------------ctggaggttcctg
A0A1S3FUQ7_BIK-01      gtaccagcagatgcccggacctcgg------ccggcagccgggcttttcc
G1TZR9_BIK-01          ggatgagcaggtcccagaacctctg------ttgacggcggaagttcccg
H0W025_BIK-01          gtttgagccaccccctgggcctctg------ctggctgaaggggctttgg
I3LVX0_BIK-01          ------------------------------------------ggttc---
G1S1X2_BIK-01          gtatgagcagctcctggaaccc---------ccgaccatggaggttcttg
A0A2K6MCW0_BIK-01      gtatgagcagctcctggaaccc---------ctaaccatggaggttcttg
A0A2K6QK74_BIK-01      gtatgagcagctcctggaaccc---------ctaaccatggaggttcttg
A0A2K5J4Q7_BIK-01      gtatgagcagctcctggaaccc---------ctaaccatggaggttcttg
A0A0D9QZY8_BIK-01      gtatgagcagctcctggaaccc---------ctgaccatggaggttcttg
A0A2K5VW94_BIK-01      gtatgagcagctcctggaaccc---------ctaaccatggaggttcttg
A0A2K6DBJ4_BIK-01      gtatgagcagctcctggaaccc---------ctaaccatggaggttcttg
A0A2K5LDM6_BIK-01      gtatgagcagctcctggaaccc---------ctaaccatggaggttcttg
A0A2K5XSA1_BIK-01      gtatgagcagctcctggaaccc---------ctaaccatggaggttcttg
A0A096NKG5_BIK-01      gtatgagcagctcctggaaccc---------ctaaccatggaggttcttg
H2P4N6_BIK-01          gtatgagcagctcctggaaccc---------ccgaccatggaggttcttg
G3QCT2_BIK-01          gtatgagcagctcctggaaccc---------ccgaccatggaggttcttg
Q13323_BIK-01          gtatgagcagctcctggaaccc---------ccgaccatggaggttcttg
A0A2R8ZXD2_BIK-01      gtatgagcagctcctggaaccc---------ccgaccatggaggttcttg
H2QLU7_BIK-01          gtatgagcagctcctggaaccc---------ccgaccatggaggttcttg
A0A2K6TBD7_BIK-01      gtgtgagcagtttgtggatccc---------ctgaccatggaggttgtcg
A0A2K5CLG5_BIK-01      gtgtgagcagttcgtgcatccc---------ctgaccatggaggttgtcg
F7FUT7_BIK-01          gtgtgagcagttcgtggatccc---------ctgaccatggaggttgttg
H0XAE7_BIK-01          atttgagcagctcctggagcct---------ctgacaatggaggttcttg
A0A2K6FM79_BIK-01      gttcgagcatctcctggaccct---------ctgatcctggaggttctca

W5QCU2_BIK-01          gcgtgaccagtatctt---------ggagttccaccccatctc-------
Q925D2_BIK-01          gcatgaaggagcctgtgggggttgaggacgtcagtcctgtgagagacttg
O70337_BIK-01          gcatgaaggag------------------------cctgtgagagacgtg
O70337_BIK-02          gcatgaaggag------------------------cctgtgagagacgtg
O70337_BIK-04          --------------------------------------------------
F1PUF4_BIK-01          gcatgacagatctcgtggagtattatgaccctgggccctccc--------
F6RS78_BIK-01          gcatgaccgagctcacagatt-------cccagagcccctcc--------
A0A1S3FUQ7_BIK-01      cgatcaccgagcctatgggggaagaggtctgggac---------------
G1TZR9_BIK-01          gcctgacccgtcccgtggaggaaggggacttggat---------------
H0W025_BIK-01          gtgtgacgcagccactgtgggcagaggacctcagtccccctggggacact
I3LVX0_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          gcgtgactgaccc------tgaagaggacctggaccctatggaggacttc
A0A2K6MCW0_BIK-01      gtgtgactgaccc------tgaagaggacctggaccctatggaggacttc
A0A2K6QK74_BIK-01      gtgtgactgaccc------tgaagaggacctggaccctatggaggacttc
A0A2K5J4Q7_BIK-01      gtgtgactgaccc------tgaagaggacctggaccctatggaggacttc
A0A0D9QZY8_BIK-01      gtgtgactgaccc------tgaagaggacctggaccctatggaggacttc
A0A2K5VW94_BIK-01      gtgtcactgaccc------tgaagaggacctggaccctatggaggacttc
A0A2K6DBJ4_BIK-01      gtgtcactgaccc------tgaagaggacctggaccctatggaggacttc
A0A2K5LDM6_BIK-01      gtgtgactgaccc------tgaagaggacctggaccctatggaggacttc
A0A2K5XSA1_BIK-01      gtgtgactgaccc------tgaagaggacctggaccctatggaggacttc
A0A096NKG5_BIK-01      gtgtgactgaccc------tgaagaggacctggaccctatggaggacttc
H2P4N6_BIK-01          gcgtgactgactc------tgaagaggacctggaccctatggaggacttc
G3QCT2_BIK-01          gcgtgactgactc------tgaagaggacctggaccctatggaggacttc
Q13323_BIK-01          gcatgactgactc------tgaagaggacctggaccctatggaggacttc
A0A2R8ZXD2_BIK-01      gcgtgactgagtc------tgaggaggacctggaccctatggaggacttc
H2QLU7_BIK-01          gcgtgactgactc------tgaagaggacctggaccctatggaggacttc
A0A2K6TBD7_BIK-01      gtgggagtgaccc------tgaagaggacccggactctgtggaggac---
A0A2K5CLG5_BIK-01      gtgggagtgaccc------tgaagaggacctggaccctgtggaggac---
F7FUT7_BIK-01          gtgggagtgaccc------tgaagaggacctggaccctgtggaggac---
H0XAE7_BIK-01          gcatgactg------------------agcccaac---------------
A0A2K6FM79_BIK-01      gcatcatggacaa------cgaggagaatcccgac---------------

W5QCU2_BIK-01          ---cccctacagtg--------acagtccacactacctggccatgcagct
Q925D2_BIK-01          gatttcatgaggtgcctggagagcagaa---accaggtggccctgaggct
O70337_BIK-01          gacctcatggagtgcgtggaaggcagaa---accaggtggccttgaggct
O70337_BIK-02          gacctcatggagtgcgtggaaggcagaa---accaggtggccttgaggct
O70337_BIK-04          -----------------------cagaa---accaggtggccttgaggct
F1PUF4_BIK-01          ---cta-------acagcaacaaccccg---acgatgtggccatgcggct
F6RS78_BIK-01          ---ccacaaggagagggtgacaaccgtg---actctgtggccatgcggct
A0A1S3FUQ7_BIK-01      ---cccatggactgtctggagggcagta---accaggtggccctgtggct
G1TZR9_BIK-01          ---ctcatggagtgcctcgagggcagta---accaggtggccctgaggct
H0W025_BIK-01          aacctcatggaatgcgtggaaggcagca---gcctggtggccctgcggct
I3LVX0_BIK-01          -------------------agggcagtc---accaggtggccctgcgact
G1S1X2_BIK-01          gatcctttgcagtgcatggagggcagtg---acgcgctggccccgcggct
A0A2K6MCW0_BIK-01      gatcctttggagtgtatggaggacagtg---acatgttggccctgcggct
A0A2K6QK74_BIK-01      gatcctttggagtgtatggaggacagtg---acatgttggccctgcggct
A0A2K5J4Q7_BIK-01      gatcctttggagtgtatggaggacagtg---acatgttggccctgcggct
A0A0D9QZY8_BIK-01      gatcctttggagtgtatggaggacagtg---acatgttggccctgcggct
A0A2K5VW94_BIK-01      aatcctttggagtgtatggaggacagtg---acatgttggccctgcggct
A0A2K6DBJ4_BIK-01      gatcctttggagtgtatagaggacagtg---acatgttggccctgcggct
A0A2K5LDM6_BIK-01      gatcctttggagtgtatggaggacagtg---acatgttggccctgcggct
A0A2K5XSA1_BIK-01      gatcctttggagtgtatggaggacagtg---acatgttggccctgcggct
A0A096NKG5_BIK-01      gatcctttggagtgtatggaggacagtg---acatgttggccctgcggct
H2P4N6_BIK-01          agtcctttggagtgcatggagggcagtg---acgcgttggccttgcggct
G3QCT2_BIK-01          gattctttggagtgcatggagggcagtg---acgcgttggccctgcggct
Q13323_BIK-01          gattctttggaatgcatggagggcagtg---acgcattggccctgcggct
A0A2R8ZXD2_BIK-01      gattctttggagtgcatggagggcagtg---acgcgttggccctgcggct
H2QLU7_BIK-01          gattctttggagtgcatggagggcagtg---acgcgttggccctgcggct
A0A2K6TBD7_BIK-01      ---cctttggaatgcatggagaacagtg---acgcactggccctgcagct
A0A2K5CLG5_BIK-01      ---cctttggaatgcatggagaacagtg---acgcactggtcctgcagct
F7FUT7_BIK-01          ---cctttggaatgcatggagaacagtg---acgcactggccctgcagct
H0XAE7_BIK-01          ---cccatggagtgcctggaggacagtg---accaggtggccctgcggct
A0A2K6FM79_BIK-01      ---ccctcggggtgcctcgaggacagtg---acgaggtggccctgcggct
                                              *        *    *** *  *   **

W5QCU2_BIK-01          ggcctccattgccgacgagatggagctgaggttgctgctgccccag-ttc
Q925D2_BIK-01          agcctgcatcggcgatgagatggaccggtgtcttcggagcccccgt-ctg
O70337_BIK-01          ggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgt-ctg
O70337_BIK-02          ggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgt-ctg
O70337_BIK-04          ggcctgcatcggcgatgagatggacctgtgtctgcggagcccccgt-ctg
F1PUF4_BIK-01          ggccttcatcggggacgagatggaagtgagatggatgcttccccgc-gtt
F6RS78_BIK-01          ggccttcatcggggacgagatggaagtgagatggatgctgccccac-atc
A0A1S3FUQ7_BIK-01      ggtgtgcatcggcgacgaaatggaccagcgcctccgaagtcctcgc-ctg
G1TZR9_BIK-01          ggcgtacatcggcgacgagatggacctgcacgtccggggcctccacactg
H0W025_BIK-01          ggcctgcatcggtgacgagatggacctgcgcctacggagcccccgc-ctg
I3LVX0_BIK-01          ggcctgcattggggatgagatggatctgtgttttcaggacctccaa-ctg
G1S1X2_BIK-01          ggcctgcatcggggacgagatggacgtgagcctcagggccccgcgc-ctg
A0A2K6MCW0_BIK-01      ggcctgcatcggggatgagatggacgtgagcctcagggccccgcgc-ctg
A0A2K6QK74_BIK-01      ggcctgcatcggggatgagatggacgtgagcctcagggccccgcgc-ctg
A0A2K5J4Q7_BIK-01      ggcctgcatcggggatgagatggacgtgagcctcagggccccgcgc-ctg
A0A0D9QZY8_BIK-01      ggcctgcatcggggacgagatggacgtgagcctcagggccccgcgc-ctg
A0A2K5VW94_BIK-01      ggcctgcatcggggacgagatggatgtgagcctcagggccccgcgc-ctg
A0A2K6DBJ4_BIK-01      ggcctgcatcggggacgagatggatgtgagcctcagggccccgcgc-ctg
A0A2K5LDM6_BIK-01      ggcctgcatcggggacgagatggatgtgagcctcagggccccgcgc-ctg
A0A2K5XSA1_BIK-01      ggcctgcatcggggacgagatggatgtgagcctcagggccccgcgc-ctg
A0A096NKG5_BIK-01      ggcctgcatcggggacgagatggatgtgagcctcagggccccgcgc-ctg
H2P4N6_BIK-01          ggcctgcatcggggacgagatggacgtgagcctcagggccccgcgc-cgg
G3QCT2_BIK-01          ggcctgcatcggggatgagatggacgtgagcctcagggccccgcgc-ctg
Q13323_BIK-01          ggcctgcatcggggacgagatggacgtgagcctcagggccccgcgc-ctg
A0A2R8ZXD2_BIK-01      ggcctgcatcggggacgagatggacgtgagcctcagggccccgcgc-ctg
H2QLU7_BIK-01          ggcctgcatcggggacgagatggacgtgagcctcagggccccacgc-ctg
A0A2K6TBD7_BIK-01      ggcctgcatcgcggaccagatggatgtgagcctcagggcccggagg-ctg
A0A2K5CLG5_BIK-01      ggcctgcatcgcggaccagatggatgtgagccttagggcccggagg-ctg
F7FUT7_BIK-01          ggcctgcatcgcggaccagatggatgtgagcctcagggcccggagg-ctg
H0XAE7_BIK-01          agcctgcattggggacgagatggacctgcatctcaggagcccccga-cta
A0A2K6FM79_BIK-01      agcctgcattggggatgagatggacctgtgtctcaggagcccccgc-ctg
                        *  * *** *  **  * *****   *            *         

W5QCU2_BIK-01          gttgagcccttctggatgcccatgtacagct------tgtgtttccccta
Q925D2_BIK-01          gtccagctgcctgggattgctatgcacagac------ttgctgccaccta
O70337_BIK-01          gtccagctgcctgggattgctatacacagac------tcgctgtcaccta
O70337_BIK-02          gtccagctgcctgggattgctatacacagac------tcgctgtcaccta
O70337_BIK-04          gtccagctgcctgggattgctatacacagac------tcgctgtcaccta
F1PUF4_BIK-01          ggcgagctgcccgggatggccatgtacagct------tggcttttaccta
F6RS78_BIK-01          gctgagctgcctggggtggccgtgtac-----------------------
A0A1S3FUQ7_BIK-01      gcccagctgccggggatggccatacacagcc------tggctctgaccta
G1TZR9_BIK-01          gcccagctg-ccggggtggccatgcacagct------tggccttcaccta
H0W025_BIK-01          gcccagctgccagggagggcagtgcacagcc------tggccatcactta
I3LVX0_BIK-01          gcccagctgcctgggatggccatgcacagcc------ttgctctcagcta
G1S1X2_BIK-01          gcccagctctccgaggtggccatgcacagcctgggtctggctttcatcta
A0A2K6MCW0_BIK-01      gcccagctctctgaggtggccatgcacagcctaggtctggctttcatcta
A0A2K6QK74_BIK-01      gcccagctctctgaggtggccatgcacagcctaggtctggctttcatcta
A0A2K5J4Q7_BIK-01      gcccagctctctgaggtggccatgcacagcctgggtctggctttcatcta
A0A0D9QZY8_BIK-01      gcccagctctctgaggtggccatgcacagcctgggtctggctttcatcta
A0A2K5VW94_BIK-01      gcccagctctctgaggtggccatgcacagcctgggtctggctttcatcta
A0A2K6DBJ4_BIK-01      gcccagctctctgaggtggccatgcacagcctgggtctggctttcatcta
A0A2K5LDM6_BIK-01      gcccagctctctgaggtggccatgcacagcctgggtctggctttcatctg
A0A2K5XSA1_BIK-01      gcccagctctctgaggtggccatgcacagcctgggtctggctttcatcta
A0A096NKG5_BIK-01      gcccagctctctgaggtggccatgcacagcctgggtctggctttcatcta
H2P4N6_BIK-01          gcccagctccccgaggtggccatgcacagcctgggtctggctttcatcta
G3QCT2_BIK-01          gcccagctctccgaggtggccatgcacagcctgggtctggctttcatcta
Q13323_BIK-01          gcccagctctccgaggtggccatgcacagcctgggtctggctttcatcta
A0A2R8ZXD2_BIK-01      gcccagctctccgacgtggccatgcacagcctgggtctggctttcatcta
H2QLU7_BIK-01          gcccagctctccgacgtggccatgcacagcctgggtctggctttcatcta
A0A2K6TBD7_BIK-01      gcccagctctacgaggtggccacgtacagcccgggtctcgctttcatcct
A0A2K5CLG5_BIK-01      gcccagctctatgaggtggccatgtacagcccgggtctcgctttcatcct
F7FUT7_BIK-01          gcccagctctacgaggtggccatgtacagcccgggtctcgctttcgtcct
H0XAE7_BIK-01          gcccagctgtccaggatgaccatgcacagcctggg------tctatccta
A0A2K6FM79_BIK-01      gcctggctgcccgggatgaccatgcacagcctggggctggcgctgtcctg
                       *    **            *     **                       

W5QCU2_BIK-01          cagccacgt---agggctcagggatgttctgagaagctttatggttgctt
Q925D2_BIK-01          cagccagac---gggtgtcagaggtattttcagaagcttgattggaagcc
O70337_BIK-01          cagccggac---aggtgtcagaggtattttcaggagcttgattcgaagcc
O70337_BIK-02          cagccggac---aggtgtcagaggtattttcaggagcttgattcgaagcc
O70337_BIK-04          cagccggac---aggtgtcagaggtattttcaggagcttgattcgaagcc
F1PUF4_BIK-01          caaccagac---aggcctgagaggtgttcttagaagtttcctggatggtc
F6RS78_BIK-01          --------------------------------------------------
A0A1S3FUQ7_BIK-01      cagccagat---gggtgtctggggagtgctccgacgcctcatccgtgggg
G1TZR9_BIK-01          cagccagac---gggcttcacgggtgttctcggaagcgtggggctccacc
H0W025_BIK-01          cagccagat---ggggctctggggtgtgctcggaaggctgaccctcagtc
I3LVX0_BIK-01          cagccaggc---gagagtcacgggtgtgctcagaagcttggcccagggtc
G1S1X2_BIK-01          tgaccagactgaggacatcagggatgttcttagaagtttcatggacggtt
A0A2K6MCW0_BIK-01      cgaccagaccgacgacatcagggatgttcttacaagtttcatggacggct
A0A2K6QK74_BIK-01      cgaccagaccgacgacatcagggatgttcttacaagtttcatggacggct
A0A2K5J4Q7_BIK-01      cgaccagaccgacgacatcagggatgttcttagaagtttcatggacggct
A0A0D9QZY8_BIK-01      cgaccagacggacgacatcagggatgttcttagaagtttcatagatggtt
A0A2K5VW94_BIK-01      cgaccagatggacgacatcagggatgttcttagaagtttcatggatggtt
A0A2K6DBJ4_BIK-01      cgaccagatggacgacatcagggatgttcttagaagtttcatggatggtt
A0A2K5LDM6_BIK-01      cgaccagacggacgacatcagggatgttcttagaagtttcatggatggtt
A0A2K5XSA1_BIK-01      cgaccagacggacgacatcagggatgttcttagaagtttcctggatggtt
A0A096NKG5_BIK-01      cgaccagacggacgacatcagggatgttcttagaagtttcatggatggtt
H2P4N6_BIK-01          cgaccagactgaggacatcagggatgttcttagaagtttcacggacggtt
G3QCT2_BIK-01          cgaccagaccgaggacatcagggatgttcttagaagtttcatggacggtt
Q13323_BIK-01          cgaccagactgaggacatcagggatgttcttagaagtttcatggacggtt
A0A2R8ZXD2_BIK-01      cgaccagactgaggacatcagggatgttcttagaagtttcatggacggtt
H2QLU7_BIK-01          cgaccagactgaggacatcagggatgttcttagaagtttcatggacggtt
A0A2K6TBD7_BIK-01      tgaccggac---cgacatcagggatgttcttagcggtgtcgtggatgttt
A0A2K5CLG5_BIK-01      cgaccggac---cgacatcggggatgttcttagcggtatcgtggaagttt
F7FUT7_BIK-01          cgaccggac---cgacatcggggatgttcttagcggtgtcgtggatgttt
H0XAE7_BIK-01          caaccagac---tgatggccagggtgtcctcagaagtgttatcagcggtt
A0A2K6FM79_BIK-01      tgaccagcc---ggtccgctggggcgtgctcgggagccttagcgacggtt

W5QCU2_BIK-01          tcaccaacctcagggagaaccg---aaggctctggagcttcctgactctc
Q925D2_BIK-01          tcaccaacctcagggaaaatat---ctggtcctggagagtcttcactcct
O70337_BIK-01          tcaccaacctcagggaaaacat---ctggtcctggagagtcttgactcct
O70337_BIK-02          tcaccaacctcagggaaaacat---ctggtcctggagagtcttgactcct
O70337_BIK-04          tcaccaacctcagggaaaacat---ctggtcctggagagtcttgactcct
F1PUF4_BIK-01          ttgctaacctcagggagaacat---ccgcatctggagcttcctgaccttc
F6RS78_BIK-01          --------------------------------------------------
A0A1S3FUQ7_BIK-01      tcgcccacctgagggcgcacat---cagggcctggagaccccccatcccc
G1TZR9_BIK-01          ttgccagcctcgtagagctc----tggagcccctgggggcggggggctgc
H0W025_BIK-01          tcgccagcctcagggacaatgt---gtgggcctgtggacgcccagcctcc
I3LVX0_BIK-01          tcgccagcctcagggagaacat---gtggttctggagacctgcagccccc
G1S1X2_BIK-01          tcaccacctttaaggagaacataataaggctctggagatccccgaacccc
A0A2K6MCW0_BIK-01      tcaccacccttaaggagaacataatgaggttctggagatccctgaatccc
A0A2K6QK74_BIK-01      tcaccacccttaaggagaacataatgaggttctggagatccctgaatccc
A0A2K5J4Q7_BIK-01      tcaccacccttaaggagaacataatgaggttctggagatccccgaatccc
A0A0D9QZY8_BIK-01      tcaccacccttagggagaacataatgaggttctggagatccctgaatccc
A0A2K5VW94_BIK-01      tcaccacccttagggagaacataatgaggttctggagatccccgaatccc
A0A2K6DBJ4_BIK-01      tcaccacccttagggagaacataatgaggttctggagatccccgaatccc
A0A2K5LDM6_BIK-01      tcaccacccttagggagaacataatgaggttctggagatccccgaatccc
A0A2K5XSA1_BIK-01      tcaccacccttagggagaacataatgaggttctggagatccccgaatccc
A0A096NKG5_BIK-01      tcaccacccttagggagaacataatgaggttctggagatccccgaatccc
H2P4N6_BIK-01          tcaccacccttaaggaaaacataatgaggttctggagctccct-------
G3QCT2_BIK-01          tcaccacccttaaggagaacataatgaggttctggagatccccgaacccc
Q13323_BIK-01          tcaccacacttaaggagaacataatgaggttctggagatccccgaacccc
A0A2R8ZXD2_BIK-01      tcaccacacttaaggagaacataatgaggttctggagatccccgaacccc
H2QLU7_BIK-01          tcaccacacttaaggagaacataatgaggttctggagatccccgaacccc
A0A2K6TBD7_BIK-01      tcgctgacttccaggaggacatagtgaggctctggagatccctgagctct
A0A2K5CLG5_BIK-01      tcgctaacttccaggaggacatagtgaggctctggagatccctgagctcc
F7FUT7_BIK-01          tcgctaacttccaggaggacatagtgaggctctggagatccctgagctcc
H0XAE7_BIK-01          tcaccaacctcagggagaatatagcagggttctggagatccctgagccgc
A0A2K6FM79_BIK-01      tcgccaacctcagggagtacgtggccaggctctggaggtcgctcagcccc

W5QCU2_BIK-01          agggaccg----ggtgtcgcccagcctgtggcccgagctggcactgtccc
Q925D2_BIK-01          ggcgcctg----ggtgtcacctgaccaggaccctgggcagctgtttccca
O70337_BIK-01          ggcgcctg----ggtgtcacctgaccaggaccctgggcagctgtttccga
O70337_BIK-02          ggcgcctg----ggtgtcacctgaccaggaccctgggcagctgtttccga
O70337_BIK-04          ggcgcctg----ggtgtcacctgaccaggaccctgggcagctgtttccga
F1PUF4_BIK-01          cggaacag----ggtgtcccccaacccggggcgcgggctggtgctgtcgc
F6RS78_BIK-01          --------------------------------------------------
A0A1S3FUQ7_BIK-01      cgcctcca----ggtgtcccctggccaggtccgcaggcagatgctgcccg
G1TZR9_BIK-01          tgctcctgctgcagtgaggcccctcccagggcagggctggcccccgtcct
H0W025_BIK-01          cgtgcctg----ggtgtccccccgctggacctgcaggtggctgctgcctg
I3LVX0_BIK-01          agcacccg----ggtgcctcctgcccgggcctgccgggagctgctgcccg
G1S1X2_BIK-01          gggtcccg----ggtgtcccgcgaacagatgctgctggtgctgctggtgc
A0A2K6MCW0_BIK-01      gggtccca----ggtgtcccgcgaacaggtgctgctggcgctgctgctgc
A0A2K6QK74_BIK-01      gggtccca----ggtgtcccgcgaacaggtgctgctggcgctgctgctgc
A0A2K5J4Q7_BIK-01      gggtcccg----ggtgtcccgcgaacaggtgctgctggcgctgctgctgc
A0A0D9QZY8_BIK-01      gggtcctg----ggtgtcccgcgaacaggtgctgctgg---cgctgctgc
A0A2K5VW94_BIK-01      aggtcctg----ggtgtcccgtgaacaggtgctgctggtgctgctgctgc
A0A2K6DBJ4_BIK-01      aggtcctg----ggtgtcccgtgaacaggtgctgctggtgctgctgctgc
A0A2K5LDM6_BIK-01      aggtcctg----ggtgtcccatgaacagg------------tgctgctgc
A0A2K5XSA1_BIK-01      aggtcctg----ggtgtcccgtgaacagg------------tgctgctgc
A0A096NKG5_BIK-01      aggtcctg----ggtgtcccgtgaacaggtgctgctggcgctgctgctgc
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          gggtcctg----ggtgtcccgcgaacaggtgctgctggcgctgctgctgc
Q13323_BIK-01          gggtcctg----ggtgtcctgcgaacaggtgctgctggcgctgctgctgc
A0A2R8ZXD2_BIK-01      aggtcctg----ggtgtcccgcgaacaggtgctgctggcgctgctgctgc
H2QLU7_BIK-01          gggtcctg----ggtgtcccgcgaacaggtgctgctggcgctgctgctgc
A0A2K6TBD7_BIK-01      gggtcctg----ggtgtccggcaaacagg------ccgtgctgctggcgc
A0A2K5CLG5_BIK-01      gggtcctg----ggtgtcccgcaaacagg------cagtgctgctggcac
F7FUT7_BIK-01          gggtcctg----ggtgtcccgcaaacagg------cagtgctgctagcac
H0XAE7_BIK-01          gggccctg----ggtgtgccctgccccggcgtgggaacaggtgctgttgc
A0A2K6FM79_BIK-01      cggccctg----ggtgtgccccgccccggcgtgggagcaggtgctgctgc

W5QCU2_BIK-01          tgctggtg------gtggcgatgctcagctgggg-------gtgccgctt
Q925D2_BIK-01          tggtgctgctggtcttcttgctgctgggtggggcctggcatttgcagctt
O70337_BIK-01          tggtgctgctggtcttcttgctgctgggtggggcctggtatttgcagctt
O70337_BIK-02          tggtgctgctggtcttcttgctgctgggtggggcctggtatttgcagctt
O70337_BIK-04          tggtgctgctggtcttcttgctgctgggtggggcctggtatttgcagctt
F1PUF4_BIK-01          tgctgctgctgctggtgctgctactaggctggggcctccgcctcc---tc
F6RS78_BIK-01          --------------------------------------------------
A0A1S3FUQ7_BIK-01      ------------cagtgctgctgctctgcggagccctgcagctgctgctc
G1TZR9_BIK-01          ggcgtgtggtcctccttggggcgggcagctggggcctgcggatgcca---
H0W025_BIK-01          tgctgctgttgctgctgctgctgctg---gggaccctgcgcctgctgctg
I3LVX0_BIK-01          tgctgctgctgctgggcctgttgctgagcagggccctgtacctgcggctc
G1S1X2_BIK-01          tgctgctgctgctgctgccgctgctcagcgggggcctgtacctgctg---
A0A2K6MCW0_BIK-01      tgctggc---------ggcgctgctcagcgggggcctgcacctgctgctc
A0A2K6QK74_BIK-01      tgctggc---------ggcgctgctcagcgggggcctgcacctgctgctc
A0A2K5J4Q7_BIK-01      tgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctc
A0A0D9QZY8_BIK-01      tgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctc
A0A2K5VW94_BIK-01      tgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctc
A0A2K6DBJ4_BIK-01      tgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctc
A0A2K5LDM6_BIK-01      tgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctc
A0A2K5XSA1_BIK-01      tgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctc
A0A096NKG5_BIK-01      tgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctc
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          tgctggcgctgctgctgccgctgctcagtgggggcctgcacctgctgctc
Q13323_BIK-01          tgctggcgctgctgctgccgctgctcagcgggggcctgcacctgctgctc
A0A2R8ZXD2_BIK-01      tgctggcgctgctgctgccgctgctcagcgggggcctgcacctgctgctc
H2QLU7_BIK-01          tgctggcgctgctgctgccgctgctcagcgggggcctgcacctgctgctc
A0A2K6TBD7_BIK-01      tcctggcgctgctgctggcgatgttcagcgggggtctgcgcctgctgctc
A0A2K5CLG5_BIK-01      tcctggcgctgctgctggcgatgttcagcgggggtctgcacctgctgctc
F7FUT7_BIK-01          tcctggcgctgctgctggcgatgttcagtgggggtctgcacctgctgctc
H0XAE7_BIK-01          tgctgttgttgctggtgctgctgctggcagggggcctgcacctgctgctc
A0A2K6FM79_BIK-01      tgctgctggtgc---tgctgctgctgggcgggggcctgcacctgctgctc

W5QCU2_BIK-01          c-----
Q925D2_BIK-01          cagtga
O70337_BIK-01          cagtga
O70337_BIK-02          cagtga
O70337_BIK-04          cagtga
F1PUF4_BIK-01          cagtga
F6RS78_BIK-01          ------
A0A1S3FUQ7_BIK-01      cagtga
G1TZR9_BIK-01          ------
H0W025_BIK-01          cagtga
I3LVX0_BIK-01          cagtga
G1S1X2_BIK-01          aattga
A0A2K6MCW0_BIK-01      aagtga
A0A2K6QK74_BIK-01      aagtga
A0A2K5J4Q7_BIK-01      aagtga
A0A0D9QZY8_BIK-01      aagtga
A0A2K5VW94_BIK-01      aagtga
A0A2K6DBJ4_BIK-01      aagtga
A0A2K5LDM6_BIK-01      aagtga
A0A2K5XSA1_BIK-01      aagtga
A0A096NKG5_BIK-01      aagtga
H2P4N6_BIK-01          --gtaa
G3QCT2_BIK-01          aagtga
Q13323_BIK-01          aagtga
A0A2R8ZXD2_BIK-01      aagtga
H2QLU7_BIK-01          aagtga
A0A2K6TBD7_BIK-01      aagtga
A0A2K5CLG5_BIK-01      aagtga
F7FUT7_BIK-01          aagtga
H0XAE7_BIK-01          aagtga
A0A2K6FM79_BIK-01      aagtga

© 1998-2019