Dataset for CDS BIK of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

33 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5QCU2_BIK-01          --------------------------------------------------
G1TZR9_BIK-01          --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
A0A2K5CLG5_BIK-01      --------------------------------------------------
F7FUT7_BIK-01          --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A3Q2LHE3_BIK-02      atgagaaagcggcggcgtcacgcagctgctaagcggcagacctgggattc
A0A452QUG1_BIK-01      --------------------------------------------------
F1PUF4_BIK-01          --------------------------------------------------
A0A452V3L2_BIK-01      --------------------------------------------------
                                                                         

W5QCU2_BIK-01          --------------------------------------------------
G1TZR9_BIK-01          --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
A0A2K5CLG5_BIK-01      --------------------------------------------------
F7FUT7_BIK-01          --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
A0A3Q2LHE3_BIK-01      --------------------------------------------------
A0A3Q2LHE3_BIK-02      gaactcaggccctctggtttcagagccgcgttcttcatcatcgtattctg
A0A452QUG1_BIK-01      ----------------------------------------------tttc
F1PUF4_BIK-01          --------------------------------------------------
A0A452V3L2_BIK-01      ----------------------------------------------atgg
                                                                         

W5QCU2_BIK-01          -----------------------------------atgtatcaagcaaga
G1TZR9_BIK-01          -----------------------------------atgtctgaagtcaga
H0W025_BIK-01          -----------------------------------atgtcggaagcaaaa
I3LVX0_BIK-01          -----------------------------------at-------------
G1S1X2_BIK-01          -----------------------------------atgtccgaagtaaga
A0A2K6MCW0_BIK-01      -----------------------------------atgtctggagtaaga
A0A2K6QK74_BIK-01      -----------------------------------atgtctggagtaaga
A0A2K5J4Q7_BIK-01      -----------------------------------atgtctggagtaaga
A0A0D9QZY8_BIK-01      -----------------------------------atgtctggagtaaga
A0A2K5VW94_BIK-01      -----------------------------------atgtctggagtaaga
A0A2K6DBJ4_BIK-01      -----------------------------------atgtctggagtaaga
A0A2K5LDM6_BIK-01      -----------------------------------atgtctggagtaaga
A0A2K5XSA1_BIK-01      -----------------------------------atgtctggagtaaga
A0A096NKG5_BIK-01      -----------------------------------atgtctggagttaga
H2P4N6_BIK-01          -----------------------------------atgtctgaagtaaga
G3QCT2_BIK-01          -----------------------------------atgtctgaagtaaga
Q13323_BIK-01          -----------------------------------atgtctgaagtaaga
A0A2R8ZXD2_BIK-01      -----------------------------------atgtctgaagtaaga
H2QLU7_BIK-01          -----------------------------------atgtctgaagtaaga
A0A2K6TBD7_BIK-01      -----------------------------------atgtctgaagacaga
A0A2K5CLG5_BIK-01      -----------------------------------atgtctgaagttaga
F7FUT7_BIK-01          -----------------------------------atgtctgaagtaaga
H0XAE7_BIK-01          -----------------------------------atgtcagcaggaagg
A0A2K6FM79_BIK-01      -----------------------------------atgtctgaggtgaga
Q925D2_BIK-01          -----------------------------------atgtcagaggcgaga
O70337_BIK-01          -----------------------------------atgtcggaggcgaga
O70337_BIK-02          -----------------------------------atgtcggaggcgaga
O70337_BIK-04          -----------------------------------atgtt----------
A0A3Q2LHE3_BIK-01      -----------------------------------atgtctcaagtagga
A0A3Q2LHE3_BIK-02      tacctaaggctgtttggtccagtgtgggagaagaaatgtctcaagtagga
A0A452QUG1_BIK-01      -----------------------------------acaccacccgcaggt
F1PUF4_BIK-01          -----------------------------------atgtctcactcagga
A0A452V3L2_BIK-01      cttggagctcagaagaagctaggtcaagagaagaaatgtcccacacagga
                                                          *              

W5QCU2_BIK-01          cccctctctaggaacctctttttgtaca-ccttcctacaaaaccacggcc
G1TZR9_BIK-01          cctggctccagggacctcttccaggaag-ccctcctggatgagcaggtcc
H0W025_BIK-01          cctgtcgccagggacccactgatggaga-ccccgctgtttgagccacccc
I3LVX0_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          cccatctccagagacatcttgatggaga-gcctcctgtatgagcagctcc
A0A2K6MCW0_BIK-01      cccgtctccagagacatcttgatggaga-ccctcctgtatgagcagctcc
A0A2K6QK74_BIK-01      cccgtctccagagacatcttgatggaga-ccctcctgtatgagcagctcc
A0A2K5J4Q7_BIK-01      cccatctccagagacatcttgatggaga-ccctcctgtatgagcagctcc
A0A0D9QZY8_BIK-01      cccatctccagacacatcttgatggaga-gcctcctgtatgagcagctcc
A0A2K5VW94_BIK-01      cccatctccagagacaccttgatggaga-ccctcctgtatgagcagctcc
A0A2K6DBJ4_BIK-01      cccatctccagagacaccttgatggaga-ccctcctgtatgagcagctcc
A0A2K5LDM6_BIK-01      cccatctccagagacacctggatggaga-ccctcctgtatgagcagctcc
A0A2K5XSA1_BIK-01      cccatctccagagacaccttgatggaga-ccctcctgtatgagcagctcc
A0A096NKG5_BIK-01      cccatctccagagacatcttgatggaga-ccctcctgtatgagcagctcc
H2P4N6_BIK-01          cctatctccagagacatcctgatggaga-ccctcctgtatgagcagctcc
G3QCT2_BIK-01          cccctctccagagacatcttgatggaga-ccctcctgtatgagcagctcc
Q13323_BIK-01          cccctctccagagacatcttgatggaga-ccctcctgtatgagcagctcc
A0A2R8ZXD2_BIK-01      cccctctccagagacatcttgatggaga-ccctcctgtatgagcagctcc
H2QLU7_BIK-01          cccctctccagagacatcttgatggaga-ccctcctgtatgagcagctcc
A0A2K6TBD7_BIK-01      cccctctccagcgacatcttgatggaga-ctctcctgtgtgagcagtttg
A0A2K5CLG5_BIK-01      cccctctccagtgacatcttgatggaga-ccctcttgtgtgagcagttcg
F7FUT7_BIK-01          cccctctccagtgacatcttcatggaga-ccctcctgtgtgagcagttcg
H0XAE7_BIK-01          ccagtctccatggaccactttatggaga-ccttcccatttgagcagctcc
A0A2K6FM79_BIK-01      cccgtctccacggacctcctcatggaga-ccttcccgttcgagcatctcc
Q925D2_BIK-01          ctaatggccagagacattatcaaga----ctcttctacacgaccaggtcc
O70337_BIK-01          cttatggccagagacgtcatcaaga----ctgttccacacgaccaggtcc
O70337_BIK-02          cttatggccagagacgtcatcaaga----ctgttccacacgaccaggtcc
O70337_BIK-04          -------------------------------------cac----------
A0A3Q2LHE3_BIK-01      cccgtctccagggacctctttctggacg-ccttcctgcacgagcgcagcc
A0A3Q2LHE3_BIK-02      cccgtctccagggacctctttctggacg-ccttcctgcacgagcgcagcc
A0A452QUG1_BIK-01      gcgctcagcggg--------tggtagcaccctccctccaccaccagcacc
F1PUF4_BIK-01          cccctctccaggaacctctttctgagca-ccttcctgcaggagcatggcc
A0A452V3L2_BIK-01      cccctctccaggaacctctttttgagca-ccttcctgcaggagcatggcc
                                                                         

W5QCU2_BIK-01          caggcttcctggatgaccaaggctcagggcttcccggcgtgaccagt---
G1TZR9_BIK-01          cagaacctctg------ttgacggcggaagttcccggcctgacccgtccc
H0W025_BIK-01          ctgggcctctg------ctggctgaaggggctttgggtgtgacgcagcca
I3LVX0_BIK-01          ----------------------------ggttc-----------------
G1S1X2_BIK-01          tggaaccc---------ccgaccatggaggttcttggcgtgactgaccc-
A0A2K6MCW0_BIK-01      tggaaccc---------ctaaccatggaggttcttggtgtgactgaccc-
A0A2K6QK74_BIK-01      tggaaccc---------ctaaccatggaggttcttggtgtgactgaccc-
A0A2K5J4Q7_BIK-01      tggaaccc---------ctaaccatggaggttcttggtgtgactgaccc-
A0A0D9QZY8_BIK-01      tggaaccc---------ctgaccatggaggttcttggtgtgactgaccc-
A0A2K5VW94_BIK-01      tggaaccc---------ctaaccatggaggttcttggtgtcactgaccc-
A0A2K6DBJ4_BIK-01      tggaaccc---------ctaaccatggaggttcttggtgtcactgaccc-
A0A2K5LDM6_BIK-01      tggaaccc---------ctaaccatggaggttcttggtgtgactgaccc-
A0A2K5XSA1_BIK-01      tggaaccc---------ctaaccatggaggttcttggtgtgactgaccc-
A0A096NKG5_BIK-01      tggaaccc---------ctaaccatggaggttcttggtgtgactgaccc-
H2P4N6_BIK-01          tggaaccc---------ccgaccatggaggttcttggcgtgactgactc-
G3QCT2_BIK-01          tggaaccc---------ccgaccatggaggttcttggcgtgactgactc-
Q13323_BIK-01          tggaaccc---------ccgaccatggaggttcttggcatgactgactc-
A0A2R8ZXD2_BIK-01      tggaaccc---------ccgaccatggaggttcttggcgtgactgagtc-
H2QLU7_BIK-01          tggaaccc---------ccgaccatggaggttcttggcgtgactgactc-
A0A2K6TBD7_BIK-01      tggatccc---------ctgaccatggaggttgtcggtgggagtgaccc-
A0A2K5CLG5_BIK-01      tgcatccc---------ctgaccatggaggttgtcggtgggagtgaccc-
F7FUT7_BIK-01          tggatccc---------ctgaccatggaggttgttggtgggagtgaccc-
H0XAE7_BIK-01          tggagcct---------ctgacaatggaggttcttggcatgactg-----
A0A2K6FM79_BIK-01      tggaccct---------ctgatcctggaggttctcagcatcatggacaa-
Q925D2_BIK-01          cccaacctgca------gtggtctctggggctcccagcatgaaggagcct
O70337_BIK-01          cccaacctcca------gtggcctctgagactcccagcatgaaggag---
O70337_BIK-02          cccaacctcca------gtggcctctgagactcccagcatgaaggag---
O70337_BIK-04          --------------------------------------------------
A0A3Q2LHE3_BIK-01      ---------cg------gaagccctggaggttcctggcatgaccgag---
A0A3Q2LHE3_BIK-02      ---------cg------gaagccctggaggttcctggcatgaccgag---
A0A452QUG1_BIK-01      ---------cc------gcag---gggaaggtgctgtcctgacaggt---
F1PUF4_BIK-01          ---------ca------gaagttctggaggttccgggcatgacagat---
A0A452V3L2_BIK-01      ---------cg------gaagttctggaggttccgggcatgactgat---
                                                                         

W5QCU2_BIK-01          ---------------------atcttggagttc-------caccccatct
G1TZR9_BIK-01          gtggaggaaggggacttggat-------------------ctcatggagt
H0W025_BIK-01          ctgtgggcagaggacctcagtccccctggggac-actaacctcatggaat
I3LVX0_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          -----tgaagaggacctggaccctatggaggac-ttcgatcctttgcagt
A0A2K6MCW0_BIK-01      -----tgaagaggacctggaccctatggaggac-ttcgatcctttggagt
A0A2K6QK74_BIK-01      -----tgaagaggacctggaccctatggaggac-ttcgatcctttggagt
A0A2K5J4Q7_BIK-01      -----tgaagaggacctggaccctatggaggac-ttcgatcctttggagt
A0A0D9QZY8_BIK-01      -----tgaagaggacctggaccctatggaggac-ttcgatcctttggagt
A0A2K5VW94_BIK-01      -----tgaagaggacctggaccctatggaggac-ttcaatcctttggagt
A0A2K6DBJ4_BIK-01      -----tgaagaggacctggaccctatggaggac-ttcgatcctttggagt
A0A2K5LDM6_BIK-01      -----tgaagaggacctggaccctatggaggac-ttcgatcctttggagt
A0A2K5XSA1_BIK-01      -----tgaagaggacctggaccctatggaggac-ttcgatcctttggagt
A0A096NKG5_BIK-01      -----tgaagaggacctggaccctatggaggac-ttcgatcctttggagt
H2P4N6_BIK-01          -----tgaagaggacctggaccctatggaggac-ttcagtcctttggagt
G3QCT2_BIK-01          -----tgaagaggacctggaccctatggaggac-ttcgattctttggagt
Q13323_BIK-01          -----tgaagaggacctggaccctatggaggac-ttcgattctttggaat
A0A2R8ZXD2_BIK-01      -----tgaggaggacctggaccctatggaggac-ttcgattctttggagt
H2QLU7_BIK-01          -----tgaagaggacctggaccctatggaggac-ttcgattctttggagt
A0A2K6TBD7_BIK-01      -----tgaagaggacccggactctgtggaggac-------cctttggaat
A0A2K5CLG5_BIK-01      -----tgaagaggacctggaccctgtggaggac-------cctttggaat
F7FUT7_BIK-01          -----tgaagaggacctggaccctgtggaggac-------cctttggaat
H0XAE7_BIK-01          -------------agcccaac-------------------cccatggagt
A0A2K6FM79_BIK-01      -----cgaggagaatcccgac-------------------ccctcggggt
Q925D2_BIK-01          gtgggggttgaggacgtcagtcctgtgagagac-ttggatttcatgaggt
O70337_BIK-01          ---------------------cctgtgagagac-gtggacctcatggagt
O70337_BIK-02          ---------------------cctgtgagagac-gtggacctcatggagt
O70337_BIK-04          --------------------------------------------------
A0A3Q2LHE3_BIK-01      ---------------------ctcacagagt----------------cct
A0A3Q2LHE3_BIK-02      ---------------------ctcacagagt----------------cct
A0A452QUG1_BIK-01      --------------------gcgggtggcatatgtcaggccacgggccct
F1PUF4_BIK-01          ---------------------ctcgtggagtat-tatgaccctgggccct
A0A452V3L2_BIK-01      ---------------------ctcgtggagtac-tatgatccggggccct
                                                                         

W5QCU2_BIK-01          ccccctacagtgacagtccacactacctggccatgcagctggcctccatt
G1TZR9_BIK-01          gcctcgagggcagtaacc------aggtggccctgaggctggcgtacatc
H0W025_BIK-01          gcgtggaaggcagcagcc------tggtggccctgcggctggcctgcatc
I3LVX0_BIK-01          ------agggcagtcacc------aggtggccctgcgactggcctgcatt
G1S1X2_BIK-01          gcatggagggcagtgacg------cgctggccccgcggctggcctgcatc
A0A2K6MCW0_BIK-01      gtatggaggacagtgaca------tgttggccctgcggctggcctgcatc
A0A2K6QK74_BIK-01      gtatggaggacagtgaca------tgttggccctgcggctggcctgcatc
A0A2K5J4Q7_BIK-01      gtatggaggacagtgaca------tgttggccctgcggctggcctgcatc
A0A0D9QZY8_BIK-01      gtatggaggacagtgaca------tgttggccctgcggctggcctgcatc
A0A2K5VW94_BIK-01      gtatggaggacagtgaca------tgttggccctgcggctggcctgcatc
A0A2K6DBJ4_BIK-01      gtatagaggacagtgaca------tgttggccctgcggctggcctgcatc
A0A2K5LDM6_BIK-01      gtatggaggacagtgaca------tgttggccctgcggctggcctgcatc
A0A2K5XSA1_BIK-01      gtatggaggacagtgaca------tgttggccctgcggctggcctgcatc
A0A096NKG5_BIK-01      gtatggaggacagtgaca------tgttggccctgcggctggcctgcatc
H2P4N6_BIK-01          gcatggagggcagtgacg------cgttggccttgcggctggcctgcatc
G3QCT2_BIK-01          gcatggagggcagtgacg------cgttggccctgcggctggcctgcatc
Q13323_BIK-01          gcatggagggcagtgacg------cattggccctgcggctggcctgcatc
A0A2R8ZXD2_BIK-01      gcatggagggcagtgacg------cgttggccctgcggctggcctgcatc
H2QLU7_BIK-01          gcatggagggcagtgacg------cgttggccctgcggctggcctgcatc
A0A2K6TBD7_BIK-01      gcatggagaacagtgacg------cactggccctgcagctggcctgcatc
A0A2K5CLG5_BIK-01      gcatggagaacagtgacg------cactggtcctgcagctggcctgcatc
F7FUT7_BIK-01          gcatggagaacagtgacg------cactggccctgcagctggcctgcatc
H0XAE7_BIK-01          gcctggaggacagtgacc------aggtggccctgcggctagcctgcatt
A0A2K6FM79_BIK-01      gcctcgaggacagtgacg------aggtggccctgcggctagcctgcatt
Q925D2_BIK-01          gcctggagagcagaaacc------aggtggccctgaggctagcctgcatc
O70337_BIK-01          gcgtggaaggcagaaacc------aggtggccttgaggctggcctgcatc
O70337_BIK-02          gcgtggaaggcagaaacc------aggtggccttgaggctggcctgcatc
O70337_BIK-04          ----------cagaaacc------aggtggccttgaggctggcctgcatc
A0A3Q2LHE3_BIK-01      cccccgacagtgacaaccgtgactctgtggccatgcggctggccttcatc
A0A3Q2LHE3_BIK-02      cccccgacagtgacaaccgtgactctgtggccatgcggctggccttcatc
A0A452QUG1_BIK-01      ttgt-----gcaacaaccccgacgatgtggccatgcggctggccttcatc
F1PUF4_BIK-01          cccctaacagcaacaaccccgacgatgtggccatgcggctggccttcatc
A0A452V3L2_BIK-01      cccctaacagcaacaaccccgacgatgtggccatgcggctggccttcatc
                                                  *** *  *   ** ** * *** 

W5QCU2_BIK-01          gccgacgagatggagctgaggttgctgctgccccag-ttcgttgagccct
G1TZR9_BIK-01          ggcgacgagatggacctgcacgtccggggcctccacactggcccagctg-
H0W025_BIK-01          ggtgacgagatggacctgcgcctacggagcccccgc-ctggcccagctgc
I3LVX0_BIK-01          ggggatgagatggatctgtgttttcaggacctccaa-ctggcccagctgc
G1S1X2_BIK-01          ggggacgagatggacgtgagcctcagggccccgcgc-ctggcccagctct
A0A2K6MCW0_BIK-01      ggggatgagatggacgtgagcctcagggccccgcgc-ctggcccagctct
A0A2K6QK74_BIK-01      ggggatgagatggacgtgagcctcagggccccgcgc-ctggcccagctct
A0A2K5J4Q7_BIK-01      ggggatgagatggacgtgagcctcagggccccgcgc-ctggcccagctct
A0A0D9QZY8_BIK-01      ggggacgagatggacgtgagcctcagggccccgcgc-ctggcccagctct
A0A2K5VW94_BIK-01      ggggacgagatggatgtgagcctcagggccccgcgc-ctggcccagctct
A0A2K6DBJ4_BIK-01      ggggacgagatggatgtgagcctcagggccccgcgc-ctggcccagctct
A0A2K5LDM6_BIK-01      ggggacgagatggatgtgagcctcagggccccgcgc-ctggcccagctct
A0A2K5XSA1_BIK-01      ggggacgagatggatgtgagcctcagggccccgcgc-ctggcccagctct
A0A096NKG5_BIK-01      ggggacgagatggatgtgagcctcagggccccgcgc-ctggcccagctct
H2P4N6_BIK-01          ggggacgagatggacgtgagcctcagggccccgcgc-cgggcccagctcc
G3QCT2_BIK-01          ggggatgagatggacgtgagcctcagggccccgcgc-ctggcccagctct
Q13323_BIK-01          ggggacgagatggacgtgagcctcagggccccgcgc-ctggcccagctct
A0A2R8ZXD2_BIK-01      ggggacgagatggacgtgagcctcagggccccgcgc-ctggcccagctct
H2QLU7_BIK-01          ggggacgagatggacgtgagcctcagggccccacgc-ctggcccagctct
A0A2K6TBD7_BIK-01      gcggaccagatggatgtgagcctcagggcccggagg-ctggcccagctct
A0A2K5CLG5_BIK-01      gcggaccagatggatgtgagccttagggcccggagg-ctggcccagctct
F7FUT7_BIK-01          gcggaccagatggatgtgagcctcagggcccggagg-ctggcccagctct
H0XAE7_BIK-01          ggggacgagatggacctgcatctcaggagcccccga-ctagcccagctgt
A0A2K6FM79_BIK-01      ggggatgagatggacctgtgtctcaggagcccccgc-ctggcctggctgc
Q925D2_BIK-01          ggcgatgagatggaccggtgtcttcggagcccccgt-ctggtccagctgc
O70337_BIK-01          ggcgatgagatggacctgtgtctgcggagcccccgt-ctggtccagctgc
O70337_BIK-02          ggcgatgagatggacctgtgtctgcggagcccccgt-ctggtccagctgc
O70337_BIK-04          ggcgatgagatggacctgtgtctgcggagcccccgt-ctggtccagctgc
A0A3Q2LHE3_BIK-01      ggggacgagatggaagtgagatggatgctgccccac-atcgctgagctgc
A0A3Q2LHE3_BIK-02      ggggacgagatggaagtgagatggatgctgccccac-atcgctgagctgc
A0A452QUG1_BIK-01      ggggacgagatggaagtgagatggatgcttccccgc-gttggcgagctcc
F1PUF4_BIK-01          ggggacgagatggaagtgagatggatgcttccccgc-gttggcgagctgc
A0A452V3L2_BIK-01      ggggacgagatggaagtgagatggatgcttccccgc-gttggcgagctgc
                       *  **  *******   *        *   *         *    **   

W5QCU2_BIK-01          tctggatgcccatgtacagct------tgtgtttcccctacagccacgt-
G1TZR9_BIK-01          ccggggtggccatgcacagct------tggccttcacctacagccagac-
H0W025_BIK-01          cagggagggcagtgcacagcc------tggccatcacttacagccagat-
I3LVX0_BIK-01          ctgggatggccatgcacagcc------ttgctctcagctacagccaggc-
G1S1X2_BIK-01          ccgaggtggccatgcacagcctgggtctggctttcatctatgaccagact
A0A2K6MCW0_BIK-01      ctgaggtggccatgcacagcctaggtctggctttcatctacgaccagacc
A0A2K6QK74_BIK-01      ctgaggtggccatgcacagcctaggtctggctttcatctacgaccagacc
A0A2K5J4Q7_BIK-01      ctgaggtggccatgcacagcctgggtctggctttcatctacgaccagacc
A0A0D9QZY8_BIK-01      ctgaggtggccatgcacagcctgggtctggctttcatctacgaccagacg
A0A2K5VW94_BIK-01      ctgaggtggccatgcacagcctgggtctggctttcatctacgaccagatg
A0A2K6DBJ4_BIK-01      ctgaggtggccatgcacagcctgggtctggctttcatctacgaccagatg
A0A2K5LDM6_BIK-01      ctgaggtggccatgcacagcctgggtctggctttcatctgcgaccagacg
A0A2K5XSA1_BIK-01      ctgaggtggccatgcacagcctgggtctggctttcatctacgaccagacg
A0A096NKG5_BIK-01      ctgaggtggccatgcacagcctgggtctggctttcatctacgaccagacg
H2P4N6_BIK-01          ccgaggtggccatgcacagcctgggtctggctttcatctacgaccagact
G3QCT2_BIK-01          ccgaggtggccatgcacagcctgggtctggctttcatctacgaccagacc
Q13323_BIK-01          ccgaggtggccatgcacagcctgggtctggctttcatctacgaccagact
A0A2R8ZXD2_BIK-01      ccgacgtggccatgcacagcctgggtctggctttcatctacgaccagact
H2QLU7_BIK-01          ccgacgtggccatgcacagcctgggtctggctttcatctacgaccagact
A0A2K6TBD7_BIK-01      acgaggtggccacgtacagcccgggtctcgctttcatccttgaccggac-
A0A2K5CLG5_BIK-01      atgaggtggccatgtacagcccgggtctcgctttcatcctcgaccggac-
F7FUT7_BIK-01          acgaggtggccatgtacagcccgggtctcgctttcgtcctcgaccggac-
H0XAE7_BIK-01          ccaggatgaccatgcacagcctggg------tctatcctacaaccagac-
A0A2K6FM79_BIK-01      ccgggatgaccatgcacagcctggggctggcgctgtcctgtgaccagcc-
Q925D2_BIK-01          ctgggattgctatgcacagac------ttgctgccacctacagccagac-
O70337_BIK-01          ctgggattgctatacacagac------tcgctgtcacctacagccggac-
O70337_BIK-02          ctgggattgctatacacagac------tcgctgtcacctacagccggac-
O70337_BIK-04          ctgggattgctatacacagac------tcgctgtcacctacagccggac-
A0A3Q2LHE3_BIK-01      ctggggtggccgtgtacagct------tggccttcacctacaaccagac-
A0A3Q2LHE3_BIK-02      ctggggtggccgtgtacagct------tggccttcacctacaaccagac-
A0A452QUG1_BIK-01      ccgggatggccatgtacagct------tggcttttacctacaaccagac-
F1PUF4_BIK-01          ccgggatggccatgtacagct------tggcttttacctacaaccagac-
A0A452V3L2_BIK-01      ccgggatggccatgtacagct------tggcttttacctacaaccagac-
                                *     ****                        **     

W5QCU2_BIK-01          --agggctcagggatgttctgagaagctttatggttgctttcaccaacct
G1TZR9_BIK-01          --gggcttcacgggtgttctcggaagcgtggggctccaccttgccagcct
H0W025_BIK-01          --ggggctctggggtgtgctcggaaggctgaccctcagtctcgccagcct
I3LVX0_BIK-01          --gagagtcacgggtgtgctcagaagcttggcccagggtctcgccagcct
G1S1X2_BIK-01          gaggacatcagggatgttcttagaagtttcatggacggtttcaccacctt
A0A2K6MCW0_BIK-01      gacgacatcagggatgttcttacaagtttcatggacggcttcaccaccct
A0A2K6QK74_BIK-01      gacgacatcagggatgttcttacaagtttcatggacggcttcaccaccct
A0A2K5J4Q7_BIK-01      gacgacatcagggatgttcttagaagtttcatggacggcttcaccaccct
A0A0D9QZY8_BIK-01      gacgacatcagggatgttcttagaagtttcatagatggtttcaccaccct
A0A2K5VW94_BIK-01      gacgacatcagggatgttcttagaagtttcatggatggtttcaccaccct
A0A2K6DBJ4_BIK-01      gacgacatcagggatgttcttagaagtttcatggatggtttcaccaccct
A0A2K5LDM6_BIK-01      gacgacatcagggatgttcttagaagtttcatggatggtttcaccaccct
A0A2K5XSA1_BIK-01      gacgacatcagggatgttcttagaagtttcctggatggtttcaccaccct
A0A096NKG5_BIK-01      gacgacatcagggatgttcttagaagtttcatggatggtttcaccaccct
H2P4N6_BIK-01          gaggacatcagggatgttcttagaagtttcacggacggtttcaccaccct
G3QCT2_BIK-01          gaggacatcagggatgttcttagaagtttcatggacggtttcaccaccct
Q13323_BIK-01          gaggacatcagggatgttcttagaagtttcatggacggtttcaccacact
A0A2R8ZXD2_BIK-01      gaggacatcagggatgttcttagaagtttcatggacggtttcaccacact
H2QLU7_BIK-01          gaggacatcagggatgttcttagaagtttcatggacggtttcaccacact
A0A2K6TBD7_BIK-01      --cgacatcagggatgttcttagcggtgtcgtggatgttttcgctgactt
A0A2K5CLG5_BIK-01      --cgacatcggggatgttcttagcggtatcgtggaagttttcgctaactt
F7FUT7_BIK-01          --cgacatcggggatgttcttagcggtgtcgtggatgttttcgctaactt
H0XAE7_BIK-01          --tgatggccagggtgtcctcagaagtgttatcagcggtttcaccaacct
A0A2K6FM79_BIK-01      --ggtccgctggggcgtgctcgggagccttagcgacggtttcgccaacct
Q925D2_BIK-01          --gggtgtcagaggtattttcagaagcttgattggaagcctcaccaacct
O70337_BIK-01          --aggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacct
O70337_BIK-02          --aggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacct
O70337_BIK-04          --aggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacct
A0A3Q2LHE3_BIK-01      --aggcctgaggggtgtttttagaagtttcatggatggtctcactaacct
A0A3Q2LHE3_BIK-02      --aggcctgaggggtgtttttagaagtttcatggatggtctcactaacct
A0A452QUG1_BIK-01      --aggcctgagaggtgttcttcgaagtctcatggacggactcactaacct
F1PUF4_BIK-01          --aggcctgagaggtgttcttagaagtttcctggatggtcttgctaacct
A0A452V3L2_BIK-01      --aggcctgagaggtgttcttcgaagtctcatggacggactcactaacct
                                   *   *  *     *  *           *  *     *

W5QCU2_BIK-01          cagggagaaccg---aaggctctggagcttcctgactctcagggaccg--
G1TZR9_BIK-01          cgtagagctc----tggagcccctgggggcggggggctgctgctcctgct
H0W025_BIK-01          cagggacaatgt---gtgggcctgtggacgcccagcctcccgtgcctg--
I3LVX0_BIK-01          cagggagaacat---gtggttctggagacctgcagcccccagcacccg--
G1S1X2_BIK-01          taaggagaacataataaggctctggagatccccgaaccccgggtcccg--
A0A2K6MCW0_BIK-01      taaggagaacataatgaggttctggagatccctgaatcccgggtccca--
A0A2K6QK74_BIK-01      taaggagaacataatgaggttctggagatccctgaatcccgggtccca--
A0A2K5J4Q7_BIK-01      taaggagaacataatgaggttctggagatccccgaatcccgggtcccg--
A0A0D9QZY8_BIK-01      tagggagaacataatgaggttctggagatccctgaatcccgggtcctg--
A0A2K5VW94_BIK-01      tagggagaacataatgaggttctggagatccccgaatcccaggtcctg--
A0A2K6DBJ4_BIK-01      tagggagaacataatgaggttctggagatccccgaatcccaggtcctg--
A0A2K5LDM6_BIK-01      tagggagaacataatgaggttctggagatccccgaatcccaggtcctg--
A0A2K5XSA1_BIK-01      tagggagaacataatgaggttctggagatccccgaatcccaggtcctg--
A0A096NKG5_BIK-01      tagggagaacataatgaggttctggagatccccgaatcccaggtcctg--
H2P4N6_BIK-01          taaggaaaacataatgaggttctggagctccct-----------------
G3QCT2_BIK-01          taaggagaacataatgaggttctggagatccccgaaccccgggtcctg--
Q13323_BIK-01          taaggagaacataatgaggttctggagatccccgaaccccgggtcctg--
A0A2R8ZXD2_BIK-01      taaggagaacataatgaggttctggagatccccgaaccccaggtcctg--
H2QLU7_BIK-01          taaggagaacataatgaggttctggagatccccgaaccccgggtcctg--
A0A2K6TBD7_BIK-01      ccaggaggacatagtgaggctctggagatccctgagctctgggtcctg--
A0A2K5CLG5_BIK-01      ccaggaggacatagtgaggctctggagatccctgagctccgggtcctg--
F7FUT7_BIK-01          ccaggaggacatagtgaggctctggagatccctgagctccgggtcctg--
H0XAE7_BIK-01          cagggagaatatagcagggttctggagatccctgagccgcgggccctg--
A0A2K6FM79_BIK-01      cagggagtacgtggccaggctctggaggtcgctcagcccccggccctg--
Q925D2_BIK-01          cagggaaaatat---ctggtcctggagagtcttcactcctggcgcctg--
O70337_BIK-01          cagggaaaacat---ctggtcctggagagtcttgactcctggcgcctg--
O70337_BIK-02          cagggaaaacat---ctggtcctggagagtcttgactcctggcgcctg--
O70337_BIK-04          cagggaaaacat---ctggtcctggagagtcttgactcctggcgcctg--
A0A3Q2LHE3_BIK-01      cagggagaacat---aaggttctggagcttcctgacccgcagggacag--
A0A3Q2LHE3_BIK-02      cagggagaacat---aaggttctggagcttcctgacccgcagggacag--
A0A452QUG1_BIK-01      cagggagaacat---aaggatttggagcttcctgaccttcaggaacag--
F1PUF4_BIK-01          cagggagaacat---ccgcatctggagcttcctgaccttccggaacag--
A0A452V3L2_BIK-01      cagggagaacat---aaggatctggagcttcctgaccttcaggaacag--
                           **                    *                       

W5QCU2_BIK-01          --gg-------------------------tgtcgcccagcctgtggcccg
G1TZR9_BIK-01          gcag-------------------------tgaggcccctcccagggcagg
H0W025_BIK-01          --gg-------------------------tgtccccccgctggacctgca
I3LVX0_BIK-01          --gg-------------------------tgcctcctgcccgggcctgcc
G1S1X2_BIK-01          --gg-------------------------tgtcccgcgaacagatgctgc
A0A2K6MCW0_BIK-01      --gg-------------------------tgtcccgcgaacaggtgctgc
A0A2K6QK74_BIK-01      --gg-------------------------tgtcccgcgaacaggtgctgc
A0A2K5J4Q7_BIK-01      --gg-------------------------tgtcccgcgaacaggtgctgc
A0A0D9QZY8_BIK-01      --gg-------------------------tgtcccgcgaacaggtgctgc
A0A2K5VW94_BIK-01      --gg-------------------------tgtcccgtgaacaggtgctgc
A0A2K6DBJ4_BIK-01      --gg-------------------------tgtcccgtgaacaggtgctgc
A0A2K5LDM6_BIK-01      --gg-------------------------tgtcccatgaacagg------
A0A2K5XSA1_BIK-01      --gg-------------------------tgtcccgtgaacagg------
A0A096NKG5_BIK-01      --gg-------------------------tgtcccgtgaacaggtgctgc
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --gg-------------------------tgtcccgcgaacaggtgctgc
Q13323_BIK-01          --gg-------------------------tgtcctgcgaacaggtgctgc
A0A2R8ZXD2_BIK-01      --gg-------------------------tgtcccgcgaacaggtgctgc
H2QLU7_BIK-01          --gg-------------------------tgtcccgcgaacaggtgctgc
A0A2K6TBD7_BIK-01      --gg-------------------------tgtccggcaaacagg------
A0A2K5CLG5_BIK-01      --gg-------------------------tgtcccgcaaacagg------
F7FUT7_BIK-01          --gg-------------------------tgtcccgcaaacagg------
H0XAE7_BIK-01          --gg-------------------------tgtgccctgccccggcgtggg
A0A2K6FM79_BIK-01      --gg-------------------------tgtgccccgccccggcgtggg
Q925D2_BIK-01          --gg-------------------------tgtcacctgaccaggaccctg
O70337_BIK-01          --gg-------------------------tgtcacctgaccaggaccctg
O70337_BIK-02          --gg-------------------------tgtcacctgaccaggaccctg
O70337_BIK-04          --gg-------------------------tgtcacctgaccaggaccctg
A0A3Q2LHE3_BIK-01      --gg---taagcctgagatttcatgaccttgactcaccttcctgcatgtg
A0A3Q2LHE3_BIK-02      --gg---taagcctgagatttcatgaccttgactcaccttcctgcatgtg
A0A452QUG1_BIK-01      --gg-------------------------tgtccccccacccggggcgca
F1PUF4_BIK-01          --gg-------------------------tgtcccccaacccggggcgcg
A0A452V3L2_BIK-01      --gggcctggatttggagcctt----ccctgcccgcc-acccagccccag
                                                                         

W5QCU2_BIK-01          ag-----ctggcactgtccctgctggtggt------ggcgatgctcagct
G1TZR9_BIK-01          gc-----tggcccccgtcctggcgtgtggtcctccttggggcgggcagct
H0W025_BIK-01          gg-----tggctgctgcctgtgctgctgttgctgctgctgctgctg---g
I3LVX0_BIK-01          gg-----gagctgctgcccgtgctgctgctgctgggcctgttgctgagca
G1S1X2_BIK-01          tg-----gtgctgctggtgctgctgctgctgctgctgccgctgctcagcg
A0A2K6MCW0_BIK-01      tg-----gcgctgctgctgctgctggc---------ggcgctgctcagcg
A0A2K6QK74_BIK-01      tg-----gcgctgctgctgctgctggc---------ggcgctgctcagcg
A0A2K5J4Q7_BIK-01      tg-----gcgctgctgctgctgctggcactgctgctggcgctgctcagcg
A0A0D9QZY8_BIK-01      tg-----g---cgctgctgctgctggcactgctgctggcgctgctcagcg
A0A2K5VW94_BIK-01      tg-----gtgctgctgctgctgctggcactgctgctggcgctgctcagcg
A0A2K6DBJ4_BIK-01      tg-----gtgctgctgctgctgctggcactgctgctggcgctgctcagcg
A0A2K5LDM6_BIK-01      -----------tgctgctgctgctggcactgctgctggcgctgctcagcg
A0A2K5XSA1_BIK-01      -----------tgctgctgctgctggcactgctgctggcgctgctcagcg
A0A096NKG5_BIK-01      tg-----gcgctgctgctgctgctggcactgctgctggcgctgctcagcg
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          tg-----gcgctgctgctgctgctggcgctgctgctgccgctgctcagtg
Q13323_BIK-01          tg-----gcgctgctgctgctgctggcgctgctgctgccgctgctcagcg
A0A2R8ZXD2_BIK-01      tg-----gcgctgctgctgctgctggcgctgctgctgccgctgctcagcg
H2QLU7_BIK-01          tg-----gcgctgctgctgctgctggcgctgctgctgccgctgctcagcg
A0A2K6TBD7_BIK-01      cc-----gtgctgctggcgctcctggcgctgctgctggcgatgttcagcg
A0A2K5CLG5_BIK-01      ca-----gtgctgctggcactcctggcgctgctgctggcgatgttcagcg
F7FUT7_BIK-01          ca-----gtgctgctagcactcctggcgctgctgctggcgatgttcagtg
H0XAE7_BIK-01          aa-----caggtgctgttgctgctgttgttgctggtgctgctgctggcag
A0A2K6FM79_BIK-01      ag-----caggtgctgctgctgctgctggtgc---tgctgctgctgggcg
Q925D2_BIK-01          gg-----cagctgtttcccatggtgctgctggtcttcttgctgctgggtg
O70337_BIK-01          gg-----cagctgtttccgatggtgctgctggtcttcttgctgctgggtg
O70337_BIK-02          gg-----cagctgtttccgatggtgctgctggtcttcttgctgctgggtg
O70337_BIK-04          gg-----cagctgtttccgatggtgctgctggtcttcttgctgctgggtg
A0A3Q2LHE3_BIK-01      tagccctctggagccgtgga-gcagctgccccgtagggcacagcctcgct
A0A3Q2LHE3_BIK-02      tagccctctggagccgtgga-gcagctgccccgtagggcacagcctcgct
A0A452QUG1_BIK-01      gg-----ctggtgctgtccctgctgctgct-----------------gct
F1PUF4_BIK-01          gg-----ctggtgctgtcgctgctgctgct-----------------gct
A0A452V3L2_BIK-01      ag-----ccgatccagcagatgcagtgactcaccacctc-cggccgggct
                                                                         

W5QCU2_BIK-01          gg---------ggg------------------------------------
G1TZR9_BIK-01          gg---------ggc------------------------------------
H0W025_BIK-01          gg---------acc------------------------------------
I3LVX0_BIK-01          gg---------gcc------------------------------------
G1S1X2_BIK-01          gg---------ggc------------------------------------
A0A2K6MCW0_BIK-01      gg---------ggc------------------------------------
A0A2K6QK74_BIK-01      gg---------ggc------------------------------------
A0A2K5J4Q7_BIK-01      gg---------ggc------------------------------------
A0A0D9QZY8_BIK-01      gg---------ggc------------------------------------
A0A2K5VW94_BIK-01      gg---------ggc------------------------------------
A0A2K6DBJ4_BIK-01      gg---------ggc------------------------------------
A0A2K5LDM6_BIK-01      gg---------ggc------------------------------------
A0A2K5XSA1_BIK-01      gg---------ggc------------------------------------
A0A096NKG5_BIK-01      gg---------ggc------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          gg---------ggc------------------------------------
Q13323_BIK-01          gg---------ggc------------------------------------
A0A2R8ZXD2_BIK-01      gg---------ggc------------------------------------
H2QLU7_BIK-01          gg---------ggc------------------------------------
A0A2K6TBD7_BIK-01      gg---------ggt------------------------------------
A0A2K5CLG5_BIK-01      gg---------ggt------------------------------------
F7FUT7_BIK-01          gg---------ggt------------------------------------
H0XAE7_BIK-01          gg---------ggc------------------------------------
A0A2K6FM79_BIK-01      gg---------ggc------------------------------------
Q925D2_BIK-01          gg---------gcc------------------------------------
O70337_BIK-01          gg---------gcc------------------------------------
O70337_BIK-02          gg---------gcc------------------------------------
O70337_BIK-04          gg---------gcc------------------------------------
A0A3Q2LHE3_BIK-01      gg-ttgccacagtccccaccaatccctattgtcttcttttgcctgcttca
A0A3Q2LHE3_BIK-02      gg-ttgccacagtccccaccaatccctattgtcttcttttgcctgcttca
A0A452QUG1_BIK-01      gg--------ggctgctgctaggc--------------------------
F1PUF4_BIK-01          gg--------tgctgctactaggc--------------------------
A0A452V3L2_BIK-01      ggtcaggtcctgcccactcccagc--------------------------
                                                                         

W5QCU2_BIK-01          -----------tgccgcttc------------------------------
G1TZR9_BIK-01          ----ctgcggatgcca----------------------------------
H0W025_BIK-01          ----ctgcgcctgctgctgc------------------------------
I3LVX0_BIK-01          ----ctgtacctgcggctcc------------------------------
G1S1X2_BIK-01          ----ctgtacctgctg---a------------------------------
A0A2K6MCW0_BIK-01      ----ctgcacctgctgctca------------------------------
A0A2K6QK74_BIK-01      ----ctgcacctgctgctca------------------------------
A0A2K5J4Q7_BIK-01      ----ctgcacctgctgctca------------------------------
A0A0D9QZY8_BIK-01      ----ctgcacctgctgctca------------------------------
A0A2K5VW94_BIK-01      ----ctgcacctgctgctca------------------------------
A0A2K6DBJ4_BIK-01      ----ctgcacctgctgctca------------------------------
A0A2K5LDM6_BIK-01      ----ctgcacctgctgctca------------------------------
A0A2K5XSA1_BIK-01      ----ctgcacctgctgctca------------------------------
A0A096NKG5_BIK-01      ----ctgcacctgctgctca------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          ----ctgcacctgctgctca------------------------------
Q13323_BIK-01          ----ctgcacctgctgctca------------------------------
A0A2R8ZXD2_BIK-01      ----ctgcacctgctgctca------------------------------
H2QLU7_BIK-01          ----ctgcacctgctgctca------------------------------
A0A2K6TBD7_BIK-01      ----ctgcgcctgctgctca------------------------------
A0A2K5CLG5_BIK-01      ----ctgcacctgctgctca------------------------------
F7FUT7_BIK-01          ----ctgcacctgctgctca------------------------------
H0XAE7_BIK-01          ----ctgcacctgctgctca------------------------------
A0A2K6FM79_BIK-01      ----ctgcacctgctgctca------------------------------
Q925D2_BIK-01          ----tggcatttgcagcttc------------------------------
O70337_BIK-01          ----tggtatttgcagcttc------------------------------
O70337_BIK-02          ----tggtatttgcagcttc------------------------------
O70337_BIK-04          ----tggtatttgcagcttc------------------------------
A0A3Q2LHE3_BIK-01      cccattcctcctcctgcctgttccctgggcctttgggtttgagatggctg
A0A3Q2LHE3_BIK-02      cccattcctcctcctgcctgttccctgggcctttgggtttgagatggctg
A0A452QUG1_BIK-01      ----tgggggttcc-gcctcctcc--------------------------
F1PUF4_BIK-01          ----tggggcctcc-gcctcctcc--------------------------
A0A452V3L2_BIK-01      ----tgccccgtccggccctcacg--------------------------
                                                                         

W5QCU2_BIK-01          ---------
G1TZR9_BIK-01          ---------
H0W025_BIK-01          ----agtga
I3LVX0_BIK-01          ----agtga
G1S1X2_BIK-01          ----attga
A0A2K6MCW0_BIK-01      ----agtga
A0A2K6QK74_BIK-01      ----agtga
A0A2K5J4Q7_BIK-01      ----agtga
A0A0D9QZY8_BIK-01      ----agtga
A0A2K5VW94_BIK-01      ----agtga
A0A2K6DBJ4_BIK-01      ----agtga
A0A2K5LDM6_BIK-01      ----agtga
A0A2K5XSA1_BIK-01      ----agtga
A0A096NKG5_BIK-01      ----agtga
H2P4N6_BIK-01          -----gtaa
G3QCT2_BIK-01          ----agtga
Q13323_BIK-01          ----agtga
A0A2R8ZXD2_BIK-01      ----agtga
H2QLU7_BIK-01          ----agtga
A0A2K6TBD7_BIK-01      ----agtga
A0A2K5CLG5_BIK-01      ----agtga
F7FUT7_BIK-01          ----agtga
H0XAE7_BIK-01          ----agtga
A0A2K6FM79_BIK-01      ----agtga
Q925D2_BIK-01          ----agtga
O70337_BIK-01          ----agtga
O70337_BIK-02          ----agtga
O70337_BIK-04          ----agtga
A0A3Q2LHE3_BIK-01      gcttactga
A0A3Q2LHE3_BIK-02      gcttactga
A0A452QUG1_BIK-01      ----agtga
F1PUF4_BIK-01          ----agtga
A0A452V3L2_BIK-01      ----actga
                                

© 1998-2019