Dataset for CDS BIK of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

31 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


W5QCU2_BIK-01          --------------------------------------------------
G1TZR9_BIK-01          --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
A0A2K5CLG5_BIK-01      --------------------------------------------------
F7FUT7_BIK-01          --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
F1PUF4_BIK-01          --------------------------------------------------
F6RS78_BIK-01          --------------------------------------------------
F6RS78_BIK-02          atgagaaagcggcggcgtcacgcagctgctaagcggcagacctgggattc
                                                                         

W5QCU2_BIK-01          --------------------------------------------------
G1TZR9_BIK-01          --------------------------------------------------
H0W025_BIK-01          --------------------------------------------------
I3LVX0_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          --------------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      --------------------------------------------------
A0A0D9QZY8_BIK-01      --------------------------------------------------
A0A2K5VW94_BIK-01      --------------------------------------------------
A0A2K6DBJ4_BIK-01      --------------------------------------------------
A0A2K5LDM6_BIK-01      --------------------------------------------------
A0A2K5XSA1_BIK-01      --------------------------------------------------
A0A096NKG5_BIK-01      --------------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          --------------------------------------------------
Q13323_BIK-01          --------------------------------------------------
A0A2R8ZXD2_BIK-01      --------------------------------------------------
H2QLU7_BIK-01          --------------------------------------------------
A0A2K6TBD7_BIK-01      --------------------------------------------------
A0A2K5CLG5_BIK-01      --------------------------------------------------
F7FUT7_BIK-01          --------------------------------------------------
H0XAE7_BIK-01          --------------------------------------------------
A0A2K6FM79_BIK-01      --------------------------------------------------
Q925D2_BIK-01          --------------------------------------------------
O70337_BIK-04          --------------------------------------------------
O70337_BIK-02          --------------------------------------------------
O70337_BIK-01          --------------------------------------------------
F1PUF4_BIK-01          --------------------------------------------------
F6RS78_BIK-01          --------------------------------------------------
F6RS78_BIK-02          gaactcaggccctctggtttcagagccgcgttcttcatcatcgtattctg
                                                                         

W5QCU2_BIK-01          -----------------------------------atgtatcaagcaaga
G1TZR9_BIK-01          -----------------------------------atgtctgaagtcaga
H0W025_BIK-01          -----------------------------------atgtcggaagcaaaa
I3LVX0_BIK-01          -----------------------------------at-------------
G1S1X2_BIK-01          -----------------------------------atgtccgaagtaaga
A0A2K6MCW0_BIK-01      -----------------------------------atgtctggagtaaga
A0A2K6QK74_BIK-01      -----------------------------------atgtctggagtaaga
A0A2K5J4Q7_BIK-01      -----------------------------------atgtctggagtaaga
A0A0D9QZY8_BIK-01      -----------------------------------atgtctggagtaaga
A0A2K5VW94_BIK-01      -----------------------------------atgtctggagtaaga
A0A2K6DBJ4_BIK-01      -----------------------------------atgtctggagtaaga
A0A2K5LDM6_BIK-01      -----------------------------------atgtctggagtaaga
A0A2K5XSA1_BIK-01      -----------------------------------atgtctggagtaaga
A0A096NKG5_BIK-01      -----------------------------------atgtctggagttaga
H2P4N6_BIK-01          -----------------------------------atgtctgaagtaaga
G3QCT2_BIK-01          -----------------------------------atgtctgaagtaaga
Q13323_BIK-01          -----------------------------------atgtctgaagtaaga
A0A2R8ZXD2_BIK-01      -----------------------------------atgtctgaagtaaga
H2QLU7_BIK-01          -----------------------------------atgtctgaagtaaga
A0A2K6TBD7_BIK-01      -----------------------------------atgtctgaagacaga
A0A2K5CLG5_BIK-01      -----------------------------------atgtctgaagttaga
F7FUT7_BIK-01          -----------------------------------atgtctgaagtaaga
H0XAE7_BIK-01          -----------------------------------atgtcagcaggaagg
A0A2K6FM79_BIK-01      -----------------------------------atgtctgaggtgaga
Q925D2_BIK-01          -----------------------------------atgtcagaggcgaga
O70337_BIK-04          -----------------------------------atgtt----------
O70337_BIK-02          -----------------------------------atgtcggaggcgaga
O70337_BIK-01          -----------------------------------atgtcggaggcgaga
F1PUF4_BIK-01          -----------------------------------atgtctcactcagga
F6RS78_BIK-01          -----------------------------------atgtctcaagtagga
F6RS78_BIK-02          tacctaaggctgtttggtccagtgtgggagaagaaatgtctcaagtagga
                                                          **             

W5QCU2_BIK-01          cccctctctaggaacctctttttgtacaccttcctacaaaaccacggccc
G1TZR9_BIK-01          cctggctccagggacctcttccaggaagccctcctggatgagcaggtccc
H0W025_BIK-01          cctgtcgccagggacccactgatggagaccccgctgtttgagccaccccc
I3LVX0_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          cccatctccagagacatcttgatggagagcctcctgtatgagcagctcct
A0A2K6MCW0_BIK-01      cccgtctccagagacatcttgatggagaccctcctgtatgagcagctcct
A0A2K6QK74_BIK-01      cccgtctccagagacatcttgatggagaccctcctgtatgagcagctcct
A0A2K5J4Q7_BIK-01      cccatctccagagacatcttgatggagaccctcctgtatgagcagctcct
A0A0D9QZY8_BIK-01      cccatctccagacacatcttgatggagagcctcctgtatgagcagctcct
A0A2K5VW94_BIK-01      cccatctccagagacaccttgatggagaccctcctgtatgagcagctcct
A0A2K6DBJ4_BIK-01      cccatctccagagacaccttgatggagaccctcctgtatgagcagctcct
A0A2K5LDM6_BIK-01      cccatctccagagacacctggatggagaccctcctgtatgagcagctcct
A0A2K5XSA1_BIK-01      cccatctccagagacaccttgatggagaccctcctgtatgagcagctcct
A0A096NKG5_BIK-01      cccatctccagagacatcttgatggagaccctcctgtatgagcagctcct
H2P4N6_BIK-01          cctatctccagagacatcctgatggagaccctcctgtatgagcagctcct
G3QCT2_BIK-01          cccctctccagagacatcttgatggagaccctcctgtatgagcagctcct
Q13323_BIK-01          cccctctccagagacatcttgatggagaccctcctgtatgagcagctcct
A0A2R8ZXD2_BIK-01      cccctctccagagacatcttgatggagaccctcctgtatgagcagctcct
H2QLU7_BIK-01          cccctctccagagacatcttgatggagaccctcctgtatgagcagctcct
A0A2K6TBD7_BIK-01      cccctctccagcgacatcttgatggagactctcctgtgtgagcagtttgt
A0A2K5CLG5_BIK-01      cccctctccagtgacatcttgatggagaccctcttgtgtgagcagttcgt
F7FUT7_BIK-01          cccctctccagtgacatcttcatggagaccctcctgtgtgagcagttcgt
H0XAE7_BIK-01          ccagtctccatggaccactttatggagaccttcccatttgagcagctcct
A0A2K6FM79_BIK-01      cccgtctccacggacctcctcatggagaccttcccgttcgagcatctcct
Q925D2_BIK-01          ctaatggccagagacattatc---aagactcttctacacgaccaggtccc
O70337_BIK-04          ------------------------------------cac-----------
O70337_BIK-02          cttatggccagagacgtcatc---aagactgttccacacgaccaggtccc
O70337_BIK-01          cttatggccagagacgtcatc---aagactgttccacacgaccaggtccc
F1PUF4_BIK-01          cccctctccaggaacctctttctgagcaccttcctgcaggagcatggcc-
F6RS78_BIK-01          cccgtctccagggacctctttctggacgccttcctgcacgagcgcagcc-
F6RS78_BIK-02          cccgtctccagggacctctttctggacgccttcctgcacgagcgcagcc-
                                                                         

W5QCU2_BIK-01          aggcttcctggatgaccaaggctcagggcttcccggcgtgaccagtatct
G1TZR9_BIK-01          agaacctctg------ttgacggcggaagttcccggcctgacccgtcccg
H0W025_BIK-01          tgggcctctg------ctggctgaaggggctttgggtgtgacgcagccac
I3LVX0_BIK-01          ---------------------------ggttc------------------
G1S1X2_BIK-01          ggaaccc---------ccgaccatggaggttcttggcgtgactgaccc--
A0A2K6MCW0_BIK-01      ggaaccc---------ctaaccatggaggttcttggtgtgactgaccc--
A0A2K6QK74_BIK-01      ggaaccc---------ctaaccatggaggttcttggtgtgactgaccc--
A0A2K5J4Q7_BIK-01      ggaaccc---------ctaaccatggaggttcttggtgtgactgaccc--
A0A0D9QZY8_BIK-01      ggaaccc---------ctgaccatggaggttcttggtgtgactgaccc--
A0A2K5VW94_BIK-01      ggaaccc---------ctaaccatggaggttcttggtgtcactgaccc--
A0A2K6DBJ4_BIK-01      ggaaccc---------ctaaccatggaggttcttggtgtcactgaccc--
A0A2K5LDM6_BIK-01      ggaaccc---------ctaaccatggaggttcttggtgtgactgaccc--
A0A2K5XSA1_BIK-01      ggaaccc---------ctaaccatggaggttcttggtgtgactgaccc--
A0A096NKG5_BIK-01      ggaaccc---------ctaaccatggaggttcttggtgtgactgaccc--
H2P4N6_BIK-01          ggaaccc---------ccgaccatggaggttcttggcgtgactgactc--
G3QCT2_BIK-01          ggaaccc---------ccgaccatggaggttcttggcgtgactgactc--
Q13323_BIK-01          ggaaccc---------ccgaccatggaggttcttggcatgactgactc--
A0A2R8ZXD2_BIK-01      ggaaccc---------ccgaccatggaggttcttggcgtgactgagtc--
H2QLU7_BIK-01          ggaaccc---------ccgaccatggaggttcttggcgtgactgactc--
A0A2K6TBD7_BIK-01      ggatccc---------ctgaccatggaggttgtcggtgggagtgaccc--
A0A2K5CLG5_BIK-01      gcatccc---------ctgaccatggaggttgtcggtgggagtgaccc--
F7FUT7_BIK-01          ggatccc---------ctgaccatggaggttgttggtgggagtgaccc--
H0XAE7_BIK-01          ggagcct---------ctgacaatggaggttcttggcatgactg------
A0A2K6FM79_BIK-01      ggaccct---------ctgatcctggaggttctcagcatcatggacaa--
Q925D2_BIK-01          ccaacctgca------gtggtctctggggctcccagcatgaaggagcctg
O70337_BIK-04          --------------------------------------------------
O70337_BIK-02          ccaacctcca------gtggcctctgagactcccagcatgaaggag----
O70337_BIK-01          ccaacctcca------gtggcctctgagactcccagcatgaaggag----
F1PUF4_BIK-01          --------ca------gaagttctggaggttccgggcatgacagat----
F6RS78_BIK-01          --------cg------gaagccctggaggttcctggcatgaccgag----
F6RS78_BIK-02          --------cg------gaagccctggaggttcctggcatgaccgag----
                                                                         

W5QCU2_BIK-01          t---------ggagttccaccccat---------------------ctcc
G1TZR9_BIK-01          tggaggaaggggacttggat------------------ctcatggagtgc
H0W025_BIK-01          tgtgggcagaggacctcagtccccctggggacactaacctcatggaatgc
I3LVX0_BIK-01          --------------------------------------------------
G1S1X2_BIK-01          ----tgaagaggacctggaccctatggaggacttcgatcctttgcagtgc
A0A2K6MCW0_BIK-01      ----tgaagaggacctggaccctatggaggacttcgatcctttggagtgt
A0A2K6QK74_BIK-01      ----tgaagaggacctggaccctatggaggacttcgatcctttggagtgt
A0A2K5J4Q7_BIK-01      ----tgaagaggacctggaccctatggaggacttcgatcctttggagtgt
A0A0D9QZY8_BIK-01      ----tgaagaggacctggaccctatggaggacttcgatcctttggagtgt
A0A2K5VW94_BIK-01      ----tgaagaggacctggaccctatggaggacttcaatcctttggagtgt
A0A2K6DBJ4_BIK-01      ----tgaagaggacctggaccctatggaggacttcgatcctttggagtgt
A0A2K5LDM6_BIK-01      ----tgaagaggacctggaccctatggaggacttcgatcctttggagtgt
A0A2K5XSA1_BIK-01      ----tgaagaggacctggaccctatggaggacttcgatcctttggagtgt
A0A096NKG5_BIK-01      ----tgaagaggacctggaccctatggaggacttcgatcctttggagtgt
H2P4N6_BIK-01          ----tgaagaggacctggaccctatggaggacttcagtcctttggagtgc
G3QCT2_BIK-01          ----tgaagaggacctggaccctatggaggacttcgattctttggagtgc
Q13323_BIK-01          ----tgaagaggacctggaccctatggaggacttcgattctttggaatgc
A0A2R8ZXD2_BIK-01      ----tgaggaggacctggaccctatggaggacttcgattctttggagtgc
H2QLU7_BIK-01          ----tgaagaggacctggaccctatggaggacttcgattctttggagtgc
A0A2K6TBD7_BIK-01      ----tgaagaggacccggactctgtggaggac------cctttggaatgc
A0A2K5CLG5_BIK-01      ----tgaagaggacctggaccctgtggaggac------cctttggaatgc
F7FUT7_BIK-01          ----tgaagaggacctggaccctgtggaggac------cctttggaatgc
H0XAE7_BIK-01          ------------agcccaac------------------cccatggagtgc
A0A2K6FM79_BIK-01      ----cgaggagaatcccgac------------------ccctcggggtgc
Q925D2_BIK-01          tgggggttgaggacgtcagtcctgtgagagacttggatttcatgaggtgc
O70337_BIK-04          --------------------------------------------------
O70337_BIK-02          --------------------cctgtgagagacgtggacctcatggagtgc
O70337_BIK-01          --------------------cctgtgagagacgtggacctcatggagtgc
F1PUF4_BIK-01          --------------------ctcgtggagtattatgaccctgggccctcc
F6RS78_BIK-01          --------------------ctcacagagt---------------cctcc
F6RS78_BIK-02          --------------------ctcacagagt---------------cctcc
                                                                         

W5QCU2_BIK-01          ccctacagtgacagtccacactacctggccatgcagctggcctccattgc
G1TZR9_BIK-01          ctcgagggcagtaacc------aggtggccctgaggctggcgtacatcgg
H0W025_BIK-01          gtggaaggcagcagcc------tggtggccctgcggctggcctgcatcgg
I3LVX0_BIK-01          ----agggcagtcacc------aggtggccctgcgactggcctgcattgg
G1S1X2_BIK-01          atggagggcagtgacg------cgctggccccgcggctggcctgcatcgg
A0A2K6MCW0_BIK-01      atggaggacagtgaca------tgttggccctgcggctggcctgcatcgg
A0A2K6QK74_BIK-01      atggaggacagtgaca------tgttggccctgcggctggcctgcatcgg
A0A2K5J4Q7_BIK-01      atggaggacagtgaca------tgttggccctgcggctggcctgcatcgg
A0A0D9QZY8_BIK-01      atggaggacagtgaca------tgttggccctgcggctggcctgcatcgg
A0A2K5VW94_BIK-01      atggaggacagtgaca------tgttggccctgcggctggcctgcatcgg
A0A2K6DBJ4_BIK-01      atagaggacagtgaca------tgttggccctgcggctggcctgcatcgg
A0A2K5LDM6_BIK-01      atggaggacagtgaca------tgttggccctgcggctggcctgcatcgg
A0A2K5XSA1_BIK-01      atggaggacagtgaca------tgttggccctgcggctggcctgcatcgg
A0A096NKG5_BIK-01      atggaggacagtgaca------tgttggccctgcggctggcctgcatcgg
H2P4N6_BIK-01          atggagggcagtgacg------cgttggccttgcggctggcctgcatcgg
G3QCT2_BIK-01          atggagggcagtgacg------cgttggccctgcggctggcctgcatcgg
Q13323_BIK-01          atggagggcagtgacg------cattggccctgcggctggcctgcatcgg
A0A2R8ZXD2_BIK-01      atggagggcagtgacg------cgttggccctgcggctggcctgcatcgg
H2QLU7_BIK-01          atggagggcagtgacg------cgttggccctgcggctggcctgcatcgg
A0A2K6TBD7_BIK-01      atggagaacagtgacg------cactggccctgcagctggcctgcatcgc
A0A2K5CLG5_BIK-01      atggagaacagtgacg------cactggtcctgcagctggcctgcatcgc
F7FUT7_BIK-01          atggagaacagtgacg------cactggccctgcagctggcctgcatcgc
H0XAE7_BIK-01          ctggaggacagtgacc------aggtggccctgcggctagcctgcattgg
A0A2K6FM79_BIK-01      ctcgaggacagtgacg------aggtggccctgcggctagcctgcattgg
Q925D2_BIK-01          ctggagagcagaaacc------aggtggccctgaggctagcctgcatcgg
O70337_BIK-04          --------cagaaacc------aggtggccttgaggctggcctgcatcgg
O70337_BIK-02          gtggaaggcagaaacc------aggtggccttgaggctggcctgcatcgg
O70337_BIK-01          gtggaaggcagaaacc------aggtggccttgaggctggcctgcatcgg
F1PUF4_BIK-01          cctaacagcaacaaccccgacgatgtggccatgcggctggccttcatcgg
F6RS78_BIK-01          cccgacagtgacaaccgtgactctgtggccatgcggctggccttcatcgg
F6RS78_BIK-02          cccgacagtgacaaccgtgactctgtggccatgcggctggccttcatcgg
                                                *** *  *   ** ** * *** * 

W5QCU2_BIK-01          cgacgagatggagctgaggttgctgctgccccag-ttcgttgagcccttc
G1TZR9_BIK-01          cgacgagatggacctgcacgtccggggcctccacactggcccagctg-cc
H0W025_BIK-01          tgacgagatggacctgcgcctacggagcccccgc-ctggcccagctgcca
I3LVX0_BIK-01          ggatgagatggatctgtgttttcaggacctccaa-ctggcccagctgcct
G1S1X2_BIK-01          ggacgagatggacgtgagcctcagggccccgcgc-ctggcccagctctcc
A0A2K6MCW0_BIK-01      ggatgagatggacgtgagcctcagggccccgcgc-ctggcccagctctct
A0A2K6QK74_BIK-01      ggatgagatggacgtgagcctcagggccccgcgc-ctggcccagctctct
A0A2K5J4Q7_BIK-01      ggatgagatggacgtgagcctcagggccccgcgc-ctggcccagctctct
A0A0D9QZY8_BIK-01      ggacgagatggacgtgagcctcagggccccgcgc-ctggcccagctctct
A0A2K5VW94_BIK-01      ggacgagatggatgtgagcctcagggccccgcgc-ctggcccagctctct
A0A2K6DBJ4_BIK-01      ggacgagatggatgtgagcctcagggccccgcgc-ctggcccagctctct
A0A2K5LDM6_BIK-01      ggacgagatggatgtgagcctcagggccccgcgc-ctggcccagctctct
A0A2K5XSA1_BIK-01      ggacgagatggatgtgagcctcagggccccgcgc-ctggcccagctctct
A0A096NKG5_BIK-01      ggacgagatggatgtgagcctcagggccccgcgc-ctggcccagctctct
H2P4N6_BIK-01          ggacgagatggacgtgagcctcagggccccgcgc-cgggcccagctcccc
G3QCT2_BIK-01          ggatgagatggacgtgagcctcagggccccgcgc-ctggcccagctctcc
Q13323_BIK-01          ggacgagatggacgtgagcctcagggccccgcgc-ctggcccagctctcc
A0A2R8ZXD2_BIK-01      ggacgagatggacgtgagcctcagggccccgcgc-ctggcccagctctcc
H2QLU7_BIK-01          ggacgagatggacgtgagcctcagggccccacgc-ctggcccagctctcc
A0A2K6TBD7_BIK-01      ggaccagatggatgtgagcctcagggcccggagg-ctggcccagctctac
A0A2K5CLG5_BIK-01      ggaccagatggatgtgagccttagggcccggagg-ctggcccagctctat
F7FUT7_BIK-01          ggaccagatggatgtgagcctcagggcccggagg-ctggcccagctctac
H0XAE7_BIK-01          ggacgagatggacctgcatctcaggagcccccga-ctagcccagctgtcc
A0A2K6FM79_BIK-01      ggatgagatggacctgtgtctcaggagcccccgc-ctggcctggctgccc
Q925D2_BIK-01          cgatgagatggaccggtgtcttcggagcccccgt-ctggtccagctgcct
O70337_BIK-04          cgatgagatggacctgtgtctgcggagcccccgt-ctggtccagctgcct
O70337_BIK-02          cgatgagatggacctgtgtctgcggagcccccgt-ctggtccagctgcct
O70337_BIK-01          cgatgagatggacctgtgtctgcggagcccccgt-ctggtccagctgcct
F1PUF4_BIK-01          ggacgagatggaagtgagatggatgcttccccgc-gttggcgagctgccc
F6RS78_BIK-01          ggacgagatggaagtgagatggatgctgccccac-atcgctgagctgcct
F6RS78_BIK-02          ggacgagatggaagtgagatggatgctgccccac-atcgctgagctgcct
                        **  *******   *        *   *         *    **     

W5QCU2_BIK-01          tggatgcccatgtacagct------tgtgtttcccctacagccacgt---
G1TZR9_BIK-01          ggggtggccatgcacagct------tggccttcacctacagccagac---
H0W025_BIK-01          gggagggcagtgcacagcc------tggccatcacttacagccagat---
I3LVX0_BIK-01          gggatggccatgcacagcc------ttgctctcagctacagccaggc---
G1S1X2_BIK-01          gaggtggccatgcacagcctgggtctggctttcatctatgaccagactga
A0A2K6MCW0_BIK-01      gaggtggccatgcacagcctaggtctggctttcatctacgaccagaccga
A0A2K6QK74_BIK-01      gaggtggccatgcacagcctaggtctggctttcatctacgaccagaccga
A0A2K5J4Q7_BIK-01      gaggtggccatgcacagcctgggtctggctttcatctacgaccagaccga
A0A0D9QZY8_BIK-01      gaggtggccatgcacagcctgggtctggctttcatctacgaccagacgga
A0A2K5VW94_BIK-01      gaggtggccatgcacagcctgggtctggctttcatctacgaccagatgga
A0A2K6DBJ4_BIK-01      gaggtggccatgcacagcctgggtctggctttcatctacgaccagatgga
A0A2K5LDM6_BIK-01      gaggtggccatgcacagcctgggtctggctttcatctgcgaccagacgga
A0A2K5XSA1_BIK-01      gaggtggccatgcacagcctgggtctggctttcatctacgaccagacgga
A0A096NKG5_BIK-01      gaggtggccatgcacagcctgggtctggctttcatctacgaccagacgga
H2P4N6_BIK-01          gaggtggccatgcacagcctgggtctggctttcatctacgaccagactga
G3QCT2_BIK-01          gaggtggccatgcacagcctgggtctggctttcatctacgaccagaccga
Q13323_BIK-01          gaggtggccatgcacagcctgggtctggctttcatctacgaccagactga
A0A2R8ZXD2_BIK-01      gacgtggccatgcacagcctgggtctggctttcatctacgaccagactga
H2QLU7_BIK-01          gacgtggccatgcacagcctgggtctggctttcatctacgaccagactga
A0A2K6TBD7_BIK-01      gaggtggccacgtacagcccgggtctcgctttcatccttgaccggac---
A0A2K5CLG5_BIK-01      gaggtggccatgtacagcccgggtctcgctttcatcctcgaccggac---
F7FUT7_BIK-01          gaggtggccatgtacagcccgggtctcgctttcgtcctcgaccggac---
H0XAE7_BIK-01          aggatgaccatgcacagcctggg------tctatcctacaaccagac---
A0A2K6FM79_BIK-01      gggatgaccatgcacagcctggggctggcgctgtcctgtgaccagcc---
Q925D2_BIK-01          gggattgctatgcacagac------ttgctgccacctacagccagac---
O70337_BIK-04          gggattgctatacacagac------tcgctgtcacctacagccggac---
O70337_BIK-02          gggattgctatacacagac------tcgctgtcacctacagccggac---
O70337_BIK-01          gggattgctatacacagac------tcgctgtcacctacagccggac---
F1PUF4_BIK-01          gggatggccatgtacagct------tggcttttacctacaaccagac---
F6RS78_BIK-01          ggggtggccgtgtacagct------tggccttcacctacaaccagac---
F6RS78_BIK-02          ggggtggccgtgtacagct------tggccttcacctacaaccagac---
                              *     ****                        **       

W5QCU2_BIK-01          agggctcagggatgttctgagaagctttatggttgctttcaccaacctca
G1TZR9_BIK-01          gggcttcacgggtgttctcggaagcgtggggctccaccttgccagcctcg
H0W025_BIK-01          ggggctctggggtgtgctcggaaggctgaccctcagtctcgccagcctca
I3LVX0_BIK-01          gagagtcacgggtgtgctcagaagcttggcccagggtctcgccagcctca
G1S1X2_BIK-01          ggacatcagggatgttcttagaagtttcatggacggtttcaccaccttta
A0A2K6MCW0_BIK-01      cgacatcagggatgttcttacaagtttcatggacggcttcaccaccctta
A0A2K6QK74_BIK-01      cgacatcagggatgttcttacaagtttcatggacggcttcaccaccctta
A0A2K5J4Q7_BIK-01      cgacatcagggatgttcttagaagtttcatggacggcttcaccaccctta
A0A0D9QZY8_BIK-01      cgacatcagggatgttcttagaagtttcatagatggtttcaccaccctta
A0A2K5VW94_BIK-01      cgacatcagggatgttcttagaagtttcatggatggtttcaccaccctta
A0A2K6DBJ4_BIK-01      cgacatcagggatgttcttagaagtttcatggatggtttcaccaccctta
A0A2K5LDM6_BIK-01      cgacatcagggatgttcttagaagtttcatggatggtttcaccaccctta
A0A2K5XSA1_BIK-01      cgacatcagggatgttcttagaagtttcctggatggtttcaccaccctta
A0A096NKG5_BIK-01      cgacatcagggatgttcttagaagtttcatggatggtttcaccaccctta
H2P4N6_BIK-01          ggacatcagggatgttcttagaagtttcacggacggtttcaccaccctta
G3QCT2_BIK-01          ggacatcagggatgttcttagaagtttcatggacggtttcaccaccctta
Q13323_BIK-01          ggacatcagggatgttcttagaagtttcatggacggtttcaccacactta
A0A2R8ZXD2_BIK-01      ggacatcagggatgttcttagaagtttcatggacggtttcaccacactta
H2QLU7_BIK-01          ggacatcagggatgttcttagaagtttcatggacggtttcaccacactta
A0A2K6TBD7_BIK-01      cgacatcagggatgttcttagcggtgtcgtggatgttttcgctgacttcc
A0A2K5CLG5_BIK-01      cgacatcggggatgttcttagcggtatcgtggaagttttcgctaacttcc
F7FUT7_BIK-01          cgacatcggggatgttcttagcggtgtcgtggatgttttcgctaacttcc
H0XAE7_BIK-01          tgatggccagggtgtcctcagaagtgttatcagcggtttcaccaacctca
A0A2K6FM79_BIK-01      ggtccgctggggcgtgctcgggagccttagcgacggtttcgccaacctca
Q925D2_BIK-01          gggtgtcagaggtattttcagaagcttgattggaagcctcaccaacctca
O70337_BIK-04          aggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctca
O70337_BIK-02          aggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctca
O70337_BIK-01          aggtgtcagaggtattttcaggagcttgattcgaagcctcaccaacctca
F1PUF4_BIK-01          aggcctgagaggtgttcttagaagtttcctggatggtcttgctaacctca
F6RS78_BIK-01          aggcctgaggggtgtttttagaagtttcatggatggtctcactaacctca
F6RS78_BIK-02          aggcctgaggggtgtttttagaagtttcatggatggtctcactaacctca
                                 *   *  *     *  *           *  *     *  

W5QCU2_BIK-01          gggagaaccg---aaggctctggagcttcctgactctcagggaccg----
G1TZR9_BIK-01          tagagctc----tggagcccctgggggcggggggctgctgctcctgctgc
H0W025_BIK-01          gggacaatgt---gtgggcctgtggacgcccagcctcccgtgcctg----
I3LVX0_BIK-01          gggagaacat---gtggttctggagacctgcagcccccagcacccg----
G1S1X2_BIK-01          aggagaacataataaggctctggagatccccgaaccccgggtcccg----
A0A2K6MCW0_BIK-01      aggagaacataatgaggttctggagatccctgaatcccgggtccca----
A0A2K6QK74_BIK-01      aggagaacataatgaggttctggagatccctgaatcccgggtccca----
A0A2K5J4Q7_BIK-01      aggagaacataatgaggttctggagatccccgaatcccgggtcccg----
A0A0D9QZY8_BIK-01      gggagaacataatgaggttctggagatccctgaatcccgggtcctg----
A0A2K5VW94_BIK-01      gggagaacataatgaggttctggagatccccgaatcccaggtcctg----
A0A2K6DBJ4_BIK-01      gggagaacataatgaggttctggagatccccgaatcccaggtcctg----
A0A2K5LDM6_BIK-01      gggagaacataatgaggttctggagatccccgaatcccaggtcctg----
A0A2K5XSA1_BIK-01      gggagaacataatgaggttctggagatccccgaatcccaggtcctg----
A0A096NKG5_BIK-01      gggagaacataatgaggttctggagatccccgaatcccaggtcctg----
H2P4N6_BIK-01          aggaaaacataatgaggttctggagctccct-------------------
G3QCT2_BIK-01          aggagaacataatgaggttctggagatccccgaaccccgggtcctg----
Q13323_BIK-01          aggagaacataatgaggttctggagatccccgaaccccgggtcctg----
A0A2R8ZXD2_BIK-01      aggagaacataatgaggttctggagatccccgaaccccaggtcctg----
H2QLU7_BIK-01          aggagaacataatgaggttctggagatccccgaaccccgggtcctg----
A0A2K6TBD7_BIK-01      aggaggacatagtgaggctctggagatccctgagctctgggtcctg----
A0A2K5CLG5_BIK-01      aggaggacatagtgaggctctggagatccctgagctccgggtcctg----
F7FUT7_BIK-01          aggaggacatagtgaggctctggagatccctgagctccgggtcctg----
H0XAE7_BIK-01          gggagaatatagcagggttctggagatccctgagccgcgggccctg----
A0A2K6FM79_BIK-01      gggagtacgtggccaggctctggaggtcgctcagcccccggccctg----
Q925D2_BIK-01          gggaaaatat---ctggtcctggagagtcttcactcctggcgcctg----
O70337_BIK-04          gggaaaacat---ctggtcctggagagtcttgactcctggcgcctg----
O70337_BIK-02          gggaaaacat---ctggtcctggagagtcttgactcctggcgcctg----
O70337_BIK-01          gggaaaacat---ctggtcctggagagtcttgactcctggcgcctg----
F1PUF4_BIK-01          gggagaacat---ccgcatctggagcttcctgaccttccggaacag----
F6RS78_BIK-01          gggagaacat---aaggttctggagcttcctgacccgcagggacag----
F6RS78_BIK-02          gggagaacat---aaggttctggagcttcctgacccgcagggacag----
                         **               *    *                         

W5QCU2_BIK-01          ggt---------------------------gtcgcccagcctgtggcccg
G1TZR9_BIK-01          agt---------------------------gaggcccctcccagggcagg
H0W025_BIK-01          ggt---------------------------gtccccccgctggacctgca
I3LVX0_BIK-01          ggt---------------------------gcctcctgcccgggcctgcc
G1S1X2_BIK-01          ggt---------------------------gtcccgcgaacagatgctgc
A0A2K6MCW0_BIK-01      ggt---------------------------gtcccgcgaacaggtgctgc
A0A2K6QK74_BIK-01      ggt---------------------------gtcccgcgaacaggtgctgc
A0A2K5J4Q7_BIK-01      ggt---------------------------gtcccgcgaacaggtgctgc
A0A0D9QZY8_BIK-01      ggt---------------------------gtcccgcgaacaggtgctgc
A0A2K5VW94_BIK-01      ggt---------------------------gtcccgtgaacaggtgctgc
A0A2K6DBJ4_BIK-01      ggt---------------------------gtcccgtgaacaggtgctgc
A0A2K5LDM6_BIK-01      ggt---------------------------gtcccatgaacagg------
A0A2K5XSA1_BIK-01      ggt---------------------------gtcccgtgaacagg------
A0A096NKG5_BIK-01      ggt---------------------------gtcccgtgaacaggtgctgc
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          ggt---------------------------gtcccgcgaacaggtgctgc
Q13323_BIK-01          ggt---------------------------gtcctgcgaacaggtgctgc
A0A2R8ZXD2_BIK-01      ggt---------------------------gtcccgcgaacaggtgctgc
H2QLU7_BIK-01          ggt---------------------------gtcccgcgaacaggtgctgc
A0A2K6TBD7_BIK-01      ggt---------------------------gtccggcaaacagg------
A0A2K5CLG5_BIK-01      ggt---------------------------gtcccgcaaacagg------
F7FUT7_BIK-01          ggt---------------------------gtcccgcaaacagg------
H0XAE7_BIK-01          ggt---------------------------gtgccctgccccggcgtggg
A0A2K6FM79_BIK-01      ggt---------------------------gtgccccgccccggcgtggg
Q925D2_BIK-01          ggt---------------------------gtcacctgaccagga-----
O70337_BIK-04          ggt---------------------------gtcacctgaccagga-----
O70337_BIK-02          ggt---------------------------gtcacctgaccagga-----
O70337_BIK-01          ggt---------------------------gtcacctgaccagga-----
F1PUF4_BIK-01          ggt---------------------------gtcccccaacccggggcgcg
F6RS78_BIK-01          ggtaagcctgagatttcatgaccttgactcaccttcctgcatgtgtagcc
F6RS78_BIK-02          ggtaagcctgagatttcatgaccttgactcaccttcctgcatgtgtagcc
                                                                         

W5QCU2_BIK-01          agct-----------ggcactgtccc--------------tgctggtgg-
G1TZR9_BIK-01          gctg-----------gcccccgtcct--------------ggcgtgtggt
H0W025_BIK-01          ggtg-----------gctgctgcctg--------------tgctgctgtt
I3LVX0_BIK-01          ggga-----------gctgctgcccg--------------tgctgctgct
G1S1X2_BIK-01          tggt-----------gctgctggtgc--------------tgctgctgct
A0A2K6MCW0_BIK-01      tggc-----------gctgctgctgc--------------tgctggc---
A0A2K6QK74_BIK-01      tggc-----------gctgctgctgc--------------tgctggc---
A0A2K5J4Q7_BIK-01      tggc-----------gctgctgctgc--------------tgctggcact
A0A0D9QZY8_BIK-01      tgg--------------cgctgctgc--------------tgctggcact
A0A2K5VW94_BIK-01      tggt-----------gctgctgctgc--------------tgctggcact
A0A2K6DBJ4_BIK-01      tggt-----------gctgctgctgc--------------tgctggcact
A0A2K5LDM6_BIK-01      -----------------tgctgctgc--------------tgctggcact
A0A2K5XSA1_BIK-01      -----------------tgctgctgc--------------tgctggcact
A0A096NKG5_BIK-01      tggc-----------gctgctgctgc--------------tgctggcact
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          tggc-----------gctgctgctgc--------------tgctggcgct
Q13323_BIK-01          tggc-----------gctgctgctgc--------------tgctggcgct
A0A2R8ZXD2_BIK-01      tggc-----------gctgctgctgc--------------tgctggcgct
H2QLU7_BIK-01          tggc-----------gctgctgctgc--------------tgctggcgct
A0A2K6TBD7_BIK-01      ccgt-----------gctgctggcgc--------------tcctggcgct
A0A2K5CLG5_BIK-01      cagt-----------gctgctggcac--------------tcctggcgct
F7FUT7_BIK-01          cagt-----------gctgctagcac--------------tcctggcgct
H0XAE7_BIK-01          aaca-----------ggtgctgttgc--------------tgctgttgtt
A0A2K6FM79_BIK-01      agca-----------ggtgctgctgc--------------tgctgctggt
Q925D2_BIK-01          ccctgg---------gcagctgtttc--------------ccatggtgct
O70337_BIK-04          ccctgg---------gcagctgtttc--------------cgatggtgct
O70337_BIK-02          ccctgg---------gcagctgtttc--------------cgatggtgct
O70337_BIK-01          ccctgg---------gcagctgtttc--------------cgatggtgct
F1PUF4_BIK-01          ggctggtgctgt--cgctgctgctgc--------------tgctggtgct
F6RS78_BIK-01          ctctggagccgtggagcagctgccccgtagggcacagcctcgctggt--t
F6RS78_BIK-02          ctctggagccgtggagcagctgccccgtagggcacagcctcgctggt--t
                                                                         

W5QCU2_BIK-01          --------------------------------------------------
G1TZR9_BIK-01          cctcc---------------------------------------------
H0W025_BIK-01          gctgc---------------------------------------------
I3LVX0_BIK-01          gctgg---------------------------------------------
G1S1X2_BIK-01          gctgc---------------------------------------------
A0A2K6MCW0_BIK-01      --------------------------------------------------
A0A2K6QK74_BIK-01      --------------------------------------------------
A0A2K5J4Q7_BIK-01      gctgc---------------------------------------------
A0A0D9QZY8_BIK-01      gctgc---------------------------------------------
A0A2K5VW94_BIK-01      gctgc---------------------------------------------
A0A2K6DBJ4_BIK-01      gctgc---------------------------------------------
A0A2K5LDM6_BIK-01      gctgc---------------------------------------------
A0A2K5XSA1_BIK-01      gctgc---------------------------------------------
A0A096NKG5_BIK-01      gctgc---------------------------------------------
H2P4N6_BIK-01          --------------------------------------------------
G3QCT2_BIK-01          gctgc---------------------------------------------
Q13323_BIK-01          gctgc---------------------------------------------
A0A2R8ZXD2_BIK-01      gctgc---------------------------------------------
H2QLU7_BIK-01          gctgc---------------------------------------------
A0A2K6TBD7_BIK-01      gctgc---------------------------------------------
A0A2K5CLG5_BIK-01      gctgc---------------------------------------------
F7FUT7_BIK-01          gctgc---------------------------------------------
H0XAE7_BIK-01          gctgg---------------------------------------------
A0A2K6FM79_BIK-01      gc------------------------------------------------
Q925D2_BIK-01          gc-------------------------------tggtct-----------
O70337_BIK-04          gc-------------------------------tggtct-----------
O70337_BIK-02          gc-------------------------------tggtct-----------
O70337_BIK-01          gc-------------------------------tggtct-----------
F1PUF4_BIK-01          gctac----------------------------taggctggggcctccg-
F6RS78_BIK-01          gccacagtccccaccaatccctattgtcttcttttgcctgcttcacccat
F6RS78_BIK-02          gccacagtccccaccaatccctattgtcttcttttgcctgcttcacccat
                                                                         

W5QCU2_BIK-01          tggcgatgctcagctgggg-------gtgccgcttc--------------
G1TZR9_BIK-01          ttggggcgggcagctggggcctgcggatgcca------------------
H0W025_BIK-01          tgctgctgctg---gggaccctgcgcctgctgctgcag------------
I3LVX0_BIK-01          gcctgttgctgagcagggccctgtacctgcggctccag------------
G1S1X2_BIK-01          tgccgctgctcagcgggggcctgtacctgctg---aat------------
A0A2K6MCW0_BIK-01      -ggcgctgctcagcgggggcctgcacctgctgctcaag------------
A0A2K6QK74_BIK-01      -ggcgctgctcagcgggggcctgcacctgctgctcaag------------
A0A2K5J4Q7_BIK-01      tggcgctgctcagcgggggcctgcacctgctgctcaag------------
A0A0D9QZY8_BIK-01      tggcgctgctcagcgggggcctgcacctgctgctcaag------------
A0A2K5VW94_BIK-01      tggcgctgctcagcgggggcctgcacctgctgctcaag------------
A0A2K6DBJ4_BIK-01      tggcgctgctcagcgggggcctgcacctgctgctcaag------------
A0A2K5LDM6_BIK-01      tggcgctgctcagcgggggcctgcacctgctgctcaag------------
A0A2K5XSA1_BIK-01      tggcgctgctcagcgggggcctgcacctgctgctcaag------------
A0A096NKG5_BIK-01      tggcgctgctcagcgggggcctgcacctgctgctcaag------------
H2P4N6_BIK-01          -------------------------------------g------------
G3QCT2_BIK-01          tgccgctgctcagtgggggcctgcacctgctgctcaag------------
Q13323_BIK-01          tgccgctgctcagcgggggcctgcacctgctgctcaag------------
A0A2R8ZXD2_BIK-01      tgccgctgctcagcgggggcctgcacctgctgctcaag------------
H2QLU7_BIK-01          tgccgctgctcagcgggggcctgcacctgctgctcaag------------
A0A2K6TBD7_BIK-01      tggcgatgttcagcgggggtctgcgcctgctgctcaag------------
A0A2K5CLG5_BIK-01      tggcgatgttcagcgggggtctgcacctgctgctcaag------------
F7FUT7_BIK-01          tggcgatgttcagtgggggtctgcacctgctgctcaag------------
H0XAE7_BIK-01          tgctgctgctggcagggggcctgcacctgctgctcaag------------
A0A2K6FM79_BIK-01      tgctgctgctgggcgggggcctgcacctgctgctcaag------------
Q925D2_BIK-01          tcttgctgctgggtggggcctggcatttgcagcttcag------------
O70337_BIK-04          tcttgctgctgggtggggcctggtatttgcagcttcag------------
O70337_BIK-02          tcttgctgctgggtggggcctggtatttgcagcttcag------------
O70337_BIK-01          tcttgctgctgggtggggcctggtatttgcagcttcag------------
F1PUF4_BIK-01          -cctcctccag---------------------------------------
F6RS78_BIK-01          tcctcctcctgcctgttccctgggcctttgggtttgagatggctggctta
F6RS78_BIK-02          tcctcctcctgcctgttccctgggcctttgggtttgagatggctggctta
                                                                         

W5QCU2_BIK-01          ----
G1TZR9_BIK-01          ----
H0W025_BIK-01          -tga
I3LVX0_BIK-01          -tga
G1S1X2_BIK-01          -tga
A0A2K6MCW0_BIK-01      -tga
A0A2K6QK74_BIK-01      -tga
A0A2K5J4Q7_BIK-01      -tga
A0A0D9QZY8_BIK-01      -tga
A0A2K5VW94_BIK-01      -tga
A0A2K6DBJ4_BIK-01      -tga
A0A2K5LDM6_BIK-01      -tga
A0A2K5XSA1_BIK-01      -tga
A0A096NKG5_BIK-01      -tga
H2P4N6_BIK-01          -taa
G3QCT2_BIK-01          -tga
Q13323_BIK-01          -tga
A0A2R8ZXD2_BIK-01      -tga
H2QLU7_BIK-01          -tga
A0A2K6TBD7_BIK-01      -tga
A0A2K5CLG5_BIK-01      -tga
F7FUT7_BIK-01          -tga
H0XAE7_BIK-01          -tga
A0A2K6FM79_BIK-01      -tga
Q925D2_BIK-01          -tga
O70337_BIK-04          -tga
O70337_BIK-02          -tga
O70337_BIK-01          -tga
F1PUF4_BIK-01          -tga
F6RS78_BIK-01          ctga
F6RS78_BIK-02          ctga
                           

© 1998-2019