Dataset for CDS BCL2L11 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

235 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       ------------------------------------atggggcgggcagg
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcg
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------

B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       gcgcgggccgggagctgcacaatcagtgcaggcgccgcgccgcgtcccag
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       cggagccctcggctgccggacggctcgcggcggcgggcgggctgccagtg
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------

B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       ccttttgtcccgtggcgggggggtccgagcgcgcggctgcccgattccca
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       gccggctctgcgctgccccgggggctctgaaggcgagtcccaggctttgt
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------

B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       gctccggccggggcggactcggagcgccggggtctggctgaggaattgct
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       ctcccgcgcttctttcgtgctgagggtcagggagctccgggtcggcgaag
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------

B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       -------------------------------------------------t
K7GA86_BCL2L11-01       cttggagcctgactcgcttttgttcagacaaagcctttctgcgagttact
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       gacgcgagcgggacgccgcggggctcgggcccggacgcgacggtcggaag
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------

B2KKY9_BCL2L11-01       --------------------------atgtctgacacgtccagagagcaa
B8JK68_BCL2L11-01       --------------------------atgtctgacacgtccagagagcaa
Q4KMV9_BCL2L11-01       --------------------------atggc--------caaa----caa
M3XHJ5_BCL2L11-01       --------------------------atgccaacagaggaaagtttacaa
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------atgctggtcgttggaag----cag
F7FTC8_BCL2L11-01       --------------------------atggc--------caag----caa
G1MV54_BCL2L11-01       ttttg---------------------------------------------
K7GA86_BCL2L11-01       ctttggacgcaggaaaaggcgaccaaatggc--------aaag----caa
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------atggc--------aaaa----caa
G3W979_BCL2L11-01       --------------------------atggc--------aaag----caa
O43521_BCL2L11-11       --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-08       --------------------------atggc--------aaag----caa
Q2YDF0_BCL2L11-01       --------------------------atggc--------aaag----caa
W5PY58_BCL2L11-01       --------------------------atggc--------aaag----caa
A0A1U8BW10_BCL2L11      --------------------------atggc--------caag----caa
A0A1U8BW10_BCL2L11      --------------------------atggc--------caag----caa
A0A1U8BW10_BCL2L11      --------------------------atggc--------caag----caa
O54918_BCL2L11-03       --------------------------atggc--------caag----caa
O88498_BCL2L11-01       --------------------------atggc--------caag----caa
O88498_BCL2L11-02       --------------------------atggc--------caag----caa
O54918_BCL2L11-01       --------------------------atggc--------caag----caa
O54918_BCL2L11-05       --------------------------atggc--------caag----caa
O54918_BCL2L11-06       --------------------------atggc--------caag----caa
O54918_BCL2L11-08       --------------------------atggc--------caag----caa
G1SSY0_BCL2L11-01       --------------------------atggc--------caag----caa
A0A286XJN2_BCL2L11      --------------------------atggc--------caag----caa
A0A286XJN2_BCL2L11      --------------------------atggc--------caag----caa
A0A286XJN2_BCL2L11      --------------------------atggc--------caag----caa
F7A7D2_BCL2L11-01       --------------------------atggc--------caaa----caa
F1SU81_BCL2L11-01       --------------------------atggc--------aaag----caa
C1KGB8_BCL2L11-01       --------------------------atggc--------aaag----caa
F1SU81_BCL2L11-02       --------------------------atggc--------aaag----caa
F1SU81_BCL2L11-03       --------------------------atggc--------aaag----caa
A0A287DFJ0_BCL2L11      --------------------------atggc--------aaag----caa
A0A287DFJ0_BCL2L11      --------------------------atggc--------aaag----caa
H0XW23_BCL2L11-01       --------------------------atggc--------aaag----caa
A0A1S3FHA8_BCL2L11      --------------------------atggc--------aaag----caa
A0A1S3FHA8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6GE31_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6GE31_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6GE31_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6GE31_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6GE31_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6GE31_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-06       --------------------------atggc--------aaag----caa
O43521_BCL2L11-15       --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-09       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-09       --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-05       --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-13       --------------------------atggc--------aaag----caa
O43521_BCL2L11-17       --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-01       --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-02       --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-06       --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-08       --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-04       --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-03       --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-05       --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-07       --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
H2P5E2_BCL2L11-01       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-21       --------------------------atggc--------aaag----caa
O43521_BCL2L11-02       --------------------------atggc--------aaag----caa
O43521_BCL2L11-03       --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-01       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
Q6JTU4_BCL2L11-01       --------------------------atg---------------------
O43521_BCL2L11-25       --------------------------atggc--------aaag----caa
O43521_BCL2L11-05       --------------------------atggc--------aaag----caa
O43521_BCL2L11-18       --------------------------atggc--------aaag----caa
O43521_BCL2L11-10       --------------------------atggc--------aaag----caa
O43521_BCL2L11-20       --------------------------atggc--------aaag----caa
O43521_BCL2L11-09       --------------------------atggc--------aaag----caa
O43521_BCL2L11-16       --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-22       --------------------------atggc--------aaag----caa
O43521_BCL2L11-08       --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-03       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-19       --------------------------atggc--------aaag----caa
O43521_BCL2L11-07       --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-12       --------------------------atggc--------aaag----caa
O43521_BCL2L11-24       --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-06       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-04       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A0D9RWE0_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-02       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-23       --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-07       --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
G3SU55_BCL2L11-01       --------------------------atggc--------aaag----caa
M3YDI3_BCL2L11-01       ggaaggggcggacaaaaaaagaccaaatggc--------aaag----caa
A0A337SW42_BCL2L11      --------------------------atggc--------aaag----caa
G1LDR8_BCL2L11-01       --------------------------atggc--------aaag----caa
J9NWV6_BCL2L11-01       --------------------------atggc--------aaag----caa
A0A337SW42_BCL2L11      --------------------------atggc--------aaag----caa
A0A337SW42_BCL2L11      --------------------------atggc--------aaag----caa
A0A337SW42_BCL2L11      --------------------------atggc--------aaag----caa
A0A337SW42_BCL2L11      --------------------------atggc--------aaag----caa
A0A337SW42_BCL2L11      --------------------------atggc--------aaag----caa

B2KKY9_BCL2L11-01       acg-------------------ctggccaatggcccggcc--tcgca---
B8JK68_BCL2L11-01       acg-------------------ctggccaatggcccggcc--tcgca---
Q4KMV9_BCL2L11-01       ccg------------------tcggtcttgagtccggactg-taatagtg
M3XHJ5_BCL2L11-01       tttgacaaagaccaaggtacatcagatgtaatttctgaatg---------
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       cca------------------gccac----agctttgcttgcttccc---
F7FTC8_BCL2L11-01       cct------------------tccgacctaaattctgaatg-tgaca---
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       cct------------------tctgatctgaattcagagtg-cgacg---
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       ccg------------------tcagatctaaattctgagtg-tgaca---
G3W979_BCL2L11-01       ccg------------------tcagatctaaattctgagtg-tgacc---
O43521_BCL2L11-11       cct------------------tctgatgtaagttctgagtg-tgacc---
F7HHA9_BCL2L11-08       cct------------------tctgatgtaagttctgagtg-tgacc---
Q2YDF0_BCL2L11-01       cct------------------tccgatgtaagttctgagtg-tgaca---
W5PY58_BCL2L11-01       cct------------------tccgatgtaagttctgagtg-tgaca---
A0A1U8BW10_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgaca---
A0A1U8BW10_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgaca---
A0A1U8BW10_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgaca---
O54918_BCL2L11-03       cct------------------tctgatgtaagttctgagtg-tgaca---
O88498_BCL2L11-01       cct------------------tctgatgtaaattctgagtg-tgaca---
O88498_BCL2L11-02       cct------------------tctgatgtaaattctgagtg-tgaca---
O54918_BCL2L11-01       cct------------------tctgatgtaagttctgagtg-tgaca---
O54918_BCL2L11-05       cct------------------tctgatgtaagttctgagtg-tgaca---
O54918_BCL2L11-06       cct------------------tctgatgtaagttctgagtg-tgaca---
O54918_BCL2L11-08       cct------------------tctgatgtaagttctgagtg-tgaca---
G1SSY0_BCL2L11-01       cct------------------tccgatgtaagttctgagtg-tgaca---
A0A286XJN2_BCL2L11      cct------------------tccgatgtaagttgtgagtg-tgaca---
A0A286XJN2_BCL2L11      cct------------------tccgatgtaagttgtgagtg-tgaca---
A0A286XJN2_BCL2L11      cct------------------tccgatgtaagttgtgagtg-tgaca---
F7A7D2_BCL2L11-01       cct------------------tccgatgtaagttctgagtg-tgaca---
F1SU81_BCL2L11-01       cct------------------tccgatgtaagttctgagtg-tgaca---
C1KGB8_BCL2L11-01       cct------------------tccgatgtaagttctgagtg-tgaca---
F1SU81_BCL2L11-02       cct------------------tccgatgtaagttctgagtg-tgaca---
F1SU81_BCL2L11-03       cct------------------tccgatgtaagttctgagtg-tgaca---
A0A287DFJ0_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgaca---
A0A287DFJ0_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgaca---
H0XW23_BCL2L11-01       cct------------------tcagatgtaggttctgagtg-tgacc---
A0A1S3FHA8_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A1S3FHA8_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K6GE31_BCL2L11      cct------------------tccgatgtaggttctgagtg-tgacc---
A0A2K6GE31_BCL2L11      cct------------------tccgatgtaggttctgagtg-tgacc---
A0A2K6GE31_BCL2L11      cct------------------tccgatgtaggttctgagtg-tgacc---
A0A2K6GE31_BCL2L11      cct------------------tccgatgtaggttctgagtg-tgacc---
A0A2K6GE31_BCL2L11      cct------------------tccgatgtaggttctgagtg-tgacc---
A0A2K6GE31_BCL2L11      cct------------------tccgatgtaggttctgagtg-tgacc---
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-06       cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-15       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
F7HHA9_BCL2L11-09       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
F6XMC1_BCL2L11-09       cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
F7HHA9_BCL2L11-05       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-13       cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-17       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
F6XMC1_BCL2L11-01       cct------------------tccgatgtaagttctgagtg-tgacc---
F6XMC1_BCL2L11-02       cct------------------tccgatgtaagttctgagtg-tgacc---
F6XMC1_BCL2L11-06       cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
F6XMC1_BCL2L11-08       cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
F6XMC1_BCL2L11-04       cct------------------tccgatgtaagttctgagtg-tgacc---
F6XMC1_BCL2L11-03       cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
F6XMC1_BCL2L11-05       cct------------------tccgatgtaagttctgagtg-tgacc---
F6XMC1_BCL2L11-07       cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
H2P5E2_BCL2L11-01       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-21       cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-02       cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-03       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
F7HHA9_BCL2L11-01       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-05       cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-18       cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-10       cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-20       cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-09       cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-16       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-22       cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-08       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
F7HHA9_BCL2L11-03       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-19       cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-07       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-12       cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-24       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
F7HHA9_BCL2L11-06       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
F7HHA9_BCL2L11-04       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A0D9RWE0_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
F7HHA9_BCL2L11-02       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
O43521_BCL2L11-23       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
F7HHA9_BCL2L11-07       cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctgagtg-tgacc---
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctgagtg-tgacc---
G3SU55_BCL2L11-01       cct------------------tcagatgtaagttctgagtg-tgaca---
M3YDI3_BCL2L11-01       cct------------------tcagatgtaagttctgagtg-tgacc---
A0A337SW42_BCL2L11      cct------------------tcagatgtaagttctgagtg-tgaca---
G1LDR8_BCL2L11-01       cct------------------tcagatgtaagttctgagtg-tgaca---
J9NWV6_BCL2L11-01       cct------------------tcagatgtaagttctgagtg-tgaca---
A0A337SW42_BCL2L11      cct------------------tcagatgtaagttctgagtg-tgaca---
A0A337SW42_BCL2L11      cct------------------tcagatgtaagttctgagtg-tgaca---
A0A337SW42_BCL2L11      cct------------------tcagatgtaagttctgagtg-tgaca---
A0A337SW42_BCL2L11      cct------------------tcagatgtaagttctgagtg-tgaca---
A0A337SW42_BCL2L11      cct------------------tcagatgtaagttctgagtg-tgaca---

B2KKY9_BCL2L11-01       gggaagcggagagagcaccggtggcggagtg---------gtgttgcccg
B8JK68_BCL2L11-01       gggaagcggagagagcaccggtggcggagtg---------gtgttgcccg
Q4KMV9_BCL2L11-01       gtgaaggtggccagttacaatcaacaagcagacaacattctcatcgccct
M3XHJ5_BCL2L11-01       -------tggacatttgcatcccacccaaagaccagatcaaccaccgttt
U3IW89_BCL2L11-01       ------------------------------------------tcctccag
R4G9R5_BCL2L11-01       aaacagctaaat----------------------------gtcctctctg
F7FTC8_BCL2L11-01       gcgaaggcggacgactggagcccgcagaggggccggctcagcccccgcag
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       gagaaggtggacagtttcagtcaattgaaaggccaagtcagcctcagcat
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       gagaaggtggacaattgcagcctacagaaaggcctactcagcctcaacaa
G3W979_BCL2L11-01       gtgaaggtggacaattgcagcctacagaaaggcctactcaacct---caa
O43521_BCL2L11-11       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
F7HHA9_BCL2L11-08       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
Q2YDF0_BCL2L11-01       gagaaggtggacaattgcagcctgccgagag---------gcctcctcag
W5PY58_BCL2L11-01       gagaaggtggacaattgcagcctgccgagag---------gcctcctcag
A0A1U8BW10_BCL2L11      gagaaggtggacaattgcagcctgctgagag---------gcctccccag
A0A1U8BW10_BCL2L11      gagaaggtggacaattgcagcctgctgagag---------gcctccccag
A0A1U8BW10_BCL2L11      gagaaggtggacaattgcagcctgctgagag---------gcctccccag
O54918_BCL2L11-03       gagaaggtggacaattgcagcctgctgagag---------gcctccccag
O88498_BCL2L11-01       gagaaggtggacaattgcagcctgctgagag---------gcctccccag
O88498_BCL2L11-02       gagaaggtggacaattgcagcctgctgagag---------gcctccccag
O54918_BCL2L11-01       gagaaggtggacaattgcagcctgctgagag---------gcctccccag
O54918_BCL2L11-05       gagaaggtggacaattgcagcctgctgagag---------gcctccccag
O54918_BCL2L11-06       gagaaggtggacaattgcagcctgctgagag---------gcctccccag
O54918_BCL2L11-08       gagaaggtggacaattgcagcctgctgagag---------gcctccccag
G1SSY0_BCL2L11-01       gagaaggtggacagttgcagcctgcggagag---------gccgccccag
A0A286XJN2_BCL2L11      gagaaggtggacaattgcagcctgctgagag---------gccatcccag
A0A286XJN2_BCL2L11      gagaaggtggacaattgcagcctgctgagag---------gccatcccag
A0A286XJN2_BCL2L11      gagaaggtggacaattgcagcctgctgagag---------gccatcccag
F7A7D2_BCL2L11-01       gagaaggcggacaattgcagcctgcggagag---------gcctcctcag
F1SU81_BCL2L11-01       gagaaggtggacagttgcagcctgcggaaag---------gcctcctcag
C1KGB8_BCL2L11-01       gagaaggtggacagttgcagcctgcggaaag---------gcctcctcag
F1SU81_BCL2L11-02       gagaaggtggacagttgcagcctgcggaaag---------gcctcctcag
F1SU81_BCL2L11-03       gagaaggtggacagttgcagcctgcggaaag---------gcctcctcag
A0A287DFJ0_BCL2L11      gagaaggtggacaattgcagcctgcagagag---------gcctccccag
A0A287DFJ0_BCL2L11      gagaaggtggacaattgcagcctgcagagag---------gcctccccag
H0XW23_BCL2L11-01       gagaaggtggacaattgcaacctgcggagag---------acctccccag
A0A1S3FHA8_BCL2L11      gagaaggtggacagttgcagcctgctgagag---------gcctccccag
A0A1S3FHA8_BCL2L11      gagaaggtggacagttgcagcctgctgagag---------gcctccccag
A0A2K6GE31_BCL2L11      gagaaggtggacagttgcaatctgtggagag---------acctccccag
A0A2K6GE31_BCL2L11      gagaaggtggacagttgcaatctgtggagag---------acctccccag
A0A2K6GE31_BCL2L11      gagaaggtggacagttgcaatctgtggagag---------acctccccag
A0A2K6GE31_BCL2L11      gagaaggtggacagttgcaatctgtggagag---------acctccccag
A0A2K6GE31_BCL2L11      gagaaggtggacagttgcaatctgtggagag---------acctccccag
A0A2K6GE31_BCL2L11      gagaaggtggacagttgcaatctgtggagag---------acctccccag
A0A2I3HW02_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2R9CA99_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2J8JCT2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I2YQ13_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-06       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-15       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5X2I7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
F7HHA9_BCL2L11-09       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6E226_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5NU92_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5Z8B6_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3M6I1_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5HZI7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6KJP8_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6QIL2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
F6XMC1_BCL2L11-09       gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K5CAB2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K6TRZ5_BCL2L11      gagaaggtagacagttgcagcctgcggagag---------acctccccag
A0A2K5NU92_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5X2I7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
F7HHA9_BCL2L11-05       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5Z8B6_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5HZI7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6QIL2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6KJP8_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-13       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-17       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2J8JCT2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3HW02_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I2YQ13_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2R9CA99_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
F6XMC1_BCL2L11-01       gagaaggtagacaattgcagcctgcggagag---------acctccccag
F6XMC1_BCL2L11-02       gagaaggtagacaattgcagcctgcggagag---------acctccccag
F6XMC1_BCL2L11-06       gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K5CAB2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K6TRZ5_BCL2L11      gagaaggtagacagttgcagcctgcggagag---------acctccccag
F6XMC1_BCL2L11-08       gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K5CAB2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K6TRZ5_BCL2L11      gagaaggtagacagttgcagcctgcggagag---------acctccccag
F6XMC1_BCL2L11-04       gagaaggtagacaattgcagcctgcggagag---------acctccccag
F6XMC1_BCL2L11-03       gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K5CAB2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K5CAB2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K5CAB2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K5CAB2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K6TRZ5_BCL2L11      gagaaggtagacagttgcagcctgcggagag---------acctccccag
A0A2K6TRZ5_BCL2L11      gagaaggtagacagttgcagcctgcggagag---------acctccccag
A0A2K6TRZ5_BCL2L11      gagaaggtagacagttgcagcctgcggagag---------acctccccag
A0A2K6TRZ5_BCL2L11      gagaaggtagacagttgcagcctgcggagag---------acctccccag
A0A2K5CAB2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K6TRZ5_BCL2L11      gagaaggtagacagttgcagcctgcggagag---------acctccccag
F6XMC1_BCL2L11-05       gagaaggtagacaattgcagcctgcggagag---------acctccccag
F6XMC1_BCL2L11-07       gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K5CAB2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K6TRZ5_BCL2L11      gagaaggtagacagttgcagcctgcggagag---------acctccccag
H2P5E2_BCL2L11-01       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6E226_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-21       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-02       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-03       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2J8JCT2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2J8JCT2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3HW02_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I2YQ13_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3HW02_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2R9CA99_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2J8JCT2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I2YQ13_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2R9CA99_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I2YQ13_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2R9CA99_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3M6I1_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3M6I1_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3M6I1_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5NU92_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5X2I7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
F7HHA9_BCL2L11-01       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6E226_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5Z8B6_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3M6I1_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5NU92_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5X2I7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6E226_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6E226_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5Z8B6_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5NU92_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5X2I7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6E226_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5Z8B6_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5HZI7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5HZI7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5HZI7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6QIL2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6QIL2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6QIL2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6KJP8_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6QIL2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6KJP8_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6KJP8_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6KJP8_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-05       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-18       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-10       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-20       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-09       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-16       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6KJP8_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6QIL2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5HZI7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-22       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-08       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I2YQ13_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3HW02_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2R9CA99_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2J8JCT2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5NU92_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5X2I7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
F7HHA9_BCL2L11-03       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6E226_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5Z8B6_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3M6I1_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-19       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-07       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I2YQ13_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2R9CA99_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2J8JCT2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2J8JCT2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I2YQ13_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2R9CA99_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3HW02_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6KJP8_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6QIL2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-12       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-24       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I2YQ13_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3HW02_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2R9CA99_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2J8JCT2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5NU92_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5X2I7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
F7HHA9_BCL2L11-06       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6E226_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5Z8B6_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3M6I1_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5HZI7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6KJP8_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6QIL2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5HZI7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5NU92_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5X2I7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
F7HHA9_BCL2L11-04       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6E226_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5Z8B6_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3M6I1_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A0D9RWE0_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5NU92_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5X2I7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
F7HHA9_BCL2L11-02       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6E226_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5Z8B6_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3M6I1_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6KJP8_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K6QIL2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5HZI7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3HW02_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I2YQ13_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
O43521_BCL2L11-23       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2R9CA99_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2J8JCT2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2I3M6I1_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5X2I7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
F7HHA9_BCL2L11-07       gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5HZI7_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5NU92_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5Z8B6_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------gcctccccag
A0A2K5CAB2_BCL2L11      gagaaggtagacaattgcagcctgcggagag---------acctccccag
A0A2K6TRZ5_BCL2L11      gagaaggtagacagttgcagcctgcggagag---------acctccccag
G3SU55_BCL2L11-01       gagaaggtggacagttacagcctgcggagaggcccccgcagcctcctcag
M3YDI3_BCL2L11-01       gagaaggtggacaattgcagcctgttgagag---------gcctcctcag
A0A337SW42_BCL2L11      gagaaggtggacaattgcagcctgctgagag---------gcctcctcag
G1LDR8_BCL2L11-01       gagaaggtggacaactgcagcctgctgagag---------gcctcctcag
J9NWV6_BCL2L11-01       gagaaggtggacaattgcagcctgctgagag---------gcctcctcag
A0A337SW42_BCL2L11      gagaaggtggacaattgcagcctgctgagag---------gcctcctcag
A0A337SW42_BCL2L11      gagaaggtggacaattgcagcctgctgagag---------gcctcctcag
A0A337SW42_BCL2L11      gagaaggtggacaattgcagcctgctgagag---------gcctcctcag
A0A337SW42_BCL2L11      gagaaggtggacaattgcagcctgctgagag---------gcctcctcag
A0A337SW42_BCL2L11      gagaaggtggacaattgcagcctgctgagag---------gcctcctcag

B2KKY9_BCL2L11-01       cc---------gggcactttgatttccctcagccgggcgaaggggacccg
B8JK68_BCL2L11-01       cc---------gggcactttgatttccctcagccgggcgaaggggacccg
Q4KMV9_BCL2L11-01       ctcagaagag-gggcccccacctctcttagcagtccttttcaaggtaatc
M3XHJ5_BCL2L11-01       gtaaagcaagagggctgctactgcattatcagcccactttcaaaa-----
U3IW89_BCL2L11-01       c-----------ggctact-tctccttcgaggccgagc------------
R4G9R5_BCL2L11-01       ccaatgcttt-tgctatttcttgctttttataccgtg-------------
F7FTC8_BCL2L11-01       ctccgacccg-gggcacctacctctatccgaacccagtatca--------
G1MV54_BCL2L11-01       ---------------------ctctgtgca--------------------
K7GA86_BCL2L11-01       cttagacctg-gggcccctacctctatacaaacacagtacca--------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       ctcagaccag-gggcccctacctctatacaaacacagtatcaaggtaatt
G3W979_BCL2L11-01       ctcagaccag-gggcccctacctctatacaaacacaatatcaaggtaatt
O43521_BCL2L11-11       ctcagacctg-gggcccctacctccctacagacagagccacaag------
F7HHA9_BCL2L11-08       ctcagacctg-gggcccctacctccctacagacagagccacaag------
Q2YDF0_BCL2L11-01       ctcagacctg-gggcccccacctctttacagacagagcggca--------
W5PY58_BCL2L11-01       ctcagaccag-gggcccccacctctttacagacagagcggcaaggtaatc
A0A1U8BW10_BCL2L11      ctcaggcctg-gggcccctacctccctacagacagaacagca--------
A0A1U8BW10_BCL2L11      ctcaggcctg-gggcccctacctccctacagacagaacagcaaggtaatc
A0A1U8BW10_BCL2L11      ctcaggcctg-gggcccctacctccctacagacagaacagca--------
O54918_BCL2L11-03       ctcaggcctg-gggcccctacctccctacagacagaaccgca--------
O88498_BCL2L11-01       ctcaggcctg-gggcccctacctccctacagacagaatcgcaaggtaatc
O88498_BCL2L11-02       ctcaggcctg-gggcccctacctccctacagacagaatcgca--------
O54918_BCL2L11-01       ctcaggcctg-gggcccctacctccctacagacagaaccgcaaggtaatc
O54918_BCL2L11-05       ctcaggcctg-gggcccctacctccctacagacagaaccgca--------
O54918_BCL2L11-06       ctcaggcctg-gggcccctacctccctacagacagaaccgca--------
O54918_BCL2L11-08       ctcaggcctg-gggcccctacctccctacagacagaaccgca--------
G1SSY0_BCL2L11-01       ctcaggcctg-gggcccccacctccctgcagtcggagccgcaaggtaatc
A0A286XJN2_BCL2L11      ctcagggctg-gggccccaacctccctacagacggagcccca--------
A0A286XJN2_BCL2L11      ctcagggctg-gggccccaacctccctacagacggagccccaaggtaatc
A0A286XJN2_BCL2L11      ctcagggctg-gggccccaacctccctacagacggagccccaaggtaatc
F7A7D2_BCL2L11-01       ctcaggcctg-gggcccccacctctctacagatagagcagcaaggtaatc
F1SU81_BCL2L11-01       ctcaggcctg-gggcccccacctctctacaaacagagcggcaaggtaatc
C1KGB8_BCL2L11-01       ctcaggcctg-gggcccccacctctctacagacagagcggca--------
F1SU81_BCL2L11-02       ctcaggcctg-gggcccccacctctctacaaacagagcggcaaggtaatc
F1SU81_BCL2L11-03       ctcaggcctg-gggcccccacctctctacaaacagagcggca--------
A0A287DFJ0_BCL2L11      ctcaggccgg-gggcccctacctcccttcagacagagcctca--------
A0A287DFJ0_BCL2L11      ctcaggccgg-gggcccctacctcccttcagacagagcctcaaggtaatc
H0XW23_BCL2L11-01       ctcaggcctg-gggcccctacctctctacatacagagccccaaggtaatc
A0A1S3FHA8_BCL2L11      ctcaggcctg-gggcccctacctccctacagacagagcagca--------
A0A1S3FHA8_BCL2L11      ctcaggcctg-gggcccctacctccctacagacagagcagcaaggtaatc
A0A2K6GE31_BCL2L11      ctcaggcctg-gggcccctacctccctacagacagagccccaag------
A0A2K6GE31_BCL2L11      ctcaggcctg-gggcccctacctccctacagacagagccccaaggtaatc
A0A2K6GE31_BCL2L11      ctcaggcctg-gggcccctacctccctacagacagagccccaaggtaatc
A0A2K6GE31_BCL2L11      ctcaggcctg-gggcccctacctccctacagacagagccccaaggtaatc
A0A2K6GE31_BCL2L11      ctcaggcctg-gggcccctacctccctacagacagagccccaaggtaatc
A0A2K6GE31_BCL2L11      ctcaggcctg-gggcccctacctccctacagacagagcccca--------
A0A2I3HW02_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2R9CA99_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2J8JCT2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2I2YQ13_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
O43521_BCL2L11-06       ctcagacctg-gggcccctacctccctacagacagagccaca--------
O43521_BCL2L11-15       ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5X2I7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
F7HHA9_BCL2L11-09       ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K6E226_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5NU92_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5Z8B6_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2I3M6I1_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5HZI7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccaca--------
A0A2K6KJP8_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccaca--------
A0A2K6QIL2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccaca--------
F6XMC1_BCL2L11-09       ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5CAB2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K6TRZ5_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5NU92_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaa-------
A0A2K5X2I7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaa-------
F7HHA9_BCL2L11-05       ctcagacctg-gggcccctacctccctacagacagagccacaa-------
A0A2K5Z8B6_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaa-------
A0A2K5HZI7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaa-------
A0A2K6QIL2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaa-------
A0A2K6KJP8_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaa-------
O43521_BCL2L11-13       ctcagacctg-gggcccctacctccctacagacagagccacaa-------
O43521_BCL2L11-17       ctcagacctg-gggcccctacctccctacagacagagccacaa-------
A0A2J8JCT2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaa-------
A0A2I3HW02_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaa-------
A0A2I2YQ13_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaa-------
A0A2R9CA99_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaa-------
F6XMC1_BCL2L11-01       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
F6XMC1_BCL2L11-02       ctcagacctg-gggcccctacctccctacagacagagccaca--------
F6XMC1_BCL2L11-06       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5CAB2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6TRZ5_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
F6XMC1_BCL2L11-08       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5CAB2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6TRZ5_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
F6XMC1_BCL2L11-04       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
F6XMC1_BCL2L11-03       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5CAB2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5CAB2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5CAB2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5CAB2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K6TRZ5_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6TRZ5_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6TRZ5_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6TRZ5_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5CAB2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6TRZ5_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
F6XMC1_BCL2L11-05       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
F6XMC1_BCL2L11-07       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5CAB2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6TRZ5_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
H2P5E2_BCL2L11-01       ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K6E226_BCL2L11      ctcagacctg-gggcccctacctccctacagacaga--------------
O43521_BCL2L11-21       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
O43521_BCL2L11-02       ctcagacctg-gggcccctacctccctacagacagagccaca--------
O43521_BCL2L11-03       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2J8JCT2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2J8JCT2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I3HW02_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I2YQ13_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I3HW02_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2R9CA99_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2J8JCT2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I2YQ13_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2R9CA99_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2I2YQ13_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2R9CA99_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I3M6I1_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2I3M6I1_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2I3M6I1_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5NU92_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5X2I7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
F7HHA9_BCL2L11-01       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6E226_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5Z8B6_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I3M6I1_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5NU92_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5X2I7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6E226_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6E226_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5Z8B6_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5NU92_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5X2I7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K6E226_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5Z8B6_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5HZI7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K5HZI7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K5HZI7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccaca--------
A0A2K6QIL2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K6QIL2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K6QIL2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccaca--------
A0A2K6KJP8_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K6QIL2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K6KJP8_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccaca--------
A0A2K6KJP8_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K6KJP8_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       ctcagacctg-gggcccctacctccctacagacagagccaca--------
O43521_BCL2L11-05       ctcagacctg-gggcccctacctccctacagacagagccaca--------
O43521_BCL2L11-18       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
O43521_BCL2L11-10       ctcagacctg-gggcccctacctccctacagacagagccacaa-------
O43521_BCL2L11-20       ctcagacctg-gggcccctacctccctacagacagagccacaa-------
O43521_BCL2L11-09       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
O43521_BCL2L11-16       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6KJP8_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K6QIL2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K5HZI7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
O43521_BCL2L11-22       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
O43521_BCL2L11-08       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I2YQ13_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I3HW02_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2R9CA99_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2J8JCT2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5NU92_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5X2I7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
F7HHA9_BCL2L11-03       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6E226_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5Z8B6_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I3M6I1_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
O43521_BCL2L11-19       ctcagacctg-gggcccctacctccctacagacagagccaca--------
O43521_BCL2L11-07       ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2I2YQ13_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2R9CA99_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2J8JCT2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2J8JCT2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I2YQ13_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2R9CA99_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I3HW02_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6KJP8_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K6QIL2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
O43521_BCL2L11-12       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
O43521_BCL2L11-24       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I2YQ13_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I3HW02_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2R9CA99_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2J8JCT2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5NU92_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5X2I7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
F7HHA9_BCL2L11-06       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6E226_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5Z8B6_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I3M6I1_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5HZI7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K6KJP8_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K6QIL2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K5HZI7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K5NU92_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5X2I7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
F7HHA9_BCL2L11-04       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6E226_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5Z8B6_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I3M6I1_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A0D9RWE0_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5NU92_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5X2I7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
F7HHA9_BCL2L11-02       ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6E226_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K5Z8B6_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2I3M6I1_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccacaaggtaatc
A0A2K6KJP8_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K6QIL2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2K5HZI7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccacaaggtaatc
A0A2I3HW02_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2I2YQ13_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
O43521_BCL2L11-23       ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2R9CA99_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2J8JCT2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2I3M6I1_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5X2I7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
F7HHA9_BCL2L11-07       ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5HZI7_BCL2L11      ctcagacctg-gggcccctacctccctacagacagaaccaca--------
A0A2K5NU92_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5Z8B6_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K5CAB2_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
A0A2K6TRZ5_BCL2L11      ctcagacctg-gggcccctacctccctacagacagagccaca--------
G3SU55_BCL2L11-01       ctcaggcctg-gggcccctacctctctgctcacggagcctcaaggtaatc
M3YDI3_BCL2L11-01       ctcaggcctg-gggcccctacctctctacagacagagcagcaag------
A0A337SW42_BCL2L11      ctcaggcctg-gggcccctacctctctacagacagagcagcaag------
G1LDR8_BCL2L11-01       ctcaggcctg-gggcccctacctctctacagacagagcagcaaggtaatc
J9NWV6_BCL2L11-01       ctcaggcctg-gggcccctacctctctacagacagaacagcaaggtaatc
A0A337SW42_BCL2L11      ctcaggcctg-gggcccctacctctctacagacagagcagcaaggtaatc
A0A337SW42_BCL2L11      ctcaggcctg-gggcccctacctctctacagacagagcagcaaggtaatc
A0A337SW42_BCL2L11      ctcaggcctg-gggcccctacctctctacagacagagcagcaaggtaatc
A0A337SW42_BCL2L11      ctcaggcctg-gggcccctacctctctacagacagagcagcaaggtaatc
A0A337SW42_BCL2L11      ctcaggcctg-gggcccctacctctctacagacagagcagca--------

B2KKY9_BCL2L11-01       ttaagggg------------------------------------------
B8JK68_BCL2L11-01       ttaagggg------------------------------------------
Q4KMV9_BCL2L11-01       aatcagat------------gagggtgggagctcctcagccagcactcca
M3XHJ5_BCL2L11-01       --gtgatcgcactggtgaggtggagagacagatctttactcagcaccctg
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       c---------------aggtgaaggggacagctgctcacccagcagtcct
G3W979_BCL2L11-01       c---------------aggtgaaggggacagctgctcacctagcagccct
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       ctgaagga------------gaaggggaccgctgcccccaaggcagcccg
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      ctgacggt------------gaaggggaccgctgcccccacggcagcccg
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       ccgacggc------------gaaggggaccgctgcccccacggcagccct
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       ccgacggc------------gaaggggaccgctgcccccacggcagccct
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       cggaaggc------------------gaccgctgtgcgcacggcagccct
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      ctgaaggc------------gcaggggaccgctccccccacggcagccct
A0A286XJN2_BCL2L11      ctgaaggc------------gcaggggaccgctccccccacggcagccct
F7A7D2_BCL2L11-01       ccggaggc------------gaaggggaccgctgcccccaaggcagccct
F1SU81_BCL2L11-01       cggaagga------------gaaggggaccgctgcccccaaggcagcccc
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       cggaagga------------gaaggggaccgctgcccccaaggcagcccc
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      ccgaaggc------------gaaggggaccgctgcccccacggcagccca
H0XW23_BCL2L11-01       ccgaaggcaatccggaagtcgaaggggaccgctgcccccaaggcagccct
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      ccgaaggcagtcccgaaggcgaaggggaccgctgcccccaaggcagccct
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ccgaaggcagtcgggaaggcgaaggggaccgctgctcccacggcagccct
A0A2K6GE31_BCL2L11      ccgaaggcagtcgggaaggcgaaggggaccgctgctcccacggcagccct
A0A2K6GE31_BCL2L11      ccgaaggcagtcgggaaggcgaaggggaccgctgctcccacggcagccct
A0A2K6GE31_BCL2L11      ccgaaggcagtcgggaaggcgaaggggaccgctgctcccacggcagccct
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       ccgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccct
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       ccgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccct
A0A2K5CAB2_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6TRZ5_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
F6XMC1_BCL2L11-08       ccgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccct
A0A2K5CAB2_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6TRZ5_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
F6XMC1_BCL2L11-04       ccgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccct
F6XMC1_BCL2L11-03       ccgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccct
A0A2K5CAB2_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5CAB2_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5CAB2_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6TRZ5_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6TRZ5_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6TRZ5_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
F6XMC1_BCL2L11-05       ccgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccct
F6XMC1_BCL2L11-07       ccgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccct
A0A2K5CAB2_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6TRZ5_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I3HW02_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I2YQ13_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I3HW02_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2R9CA99_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2J8JCT2_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2R9CA99_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5NU92_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5X2I7_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
F7HHA9_BCL2L11-01       ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6E226_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5Z8B6_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I3M6I1_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5NU92_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5X2I7_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6E226_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6E226_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5Z8B6_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5HZI7_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6QIL2_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6QIL2_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6KJP8_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
O43521_BCL2L11-16       ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6KJP8_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6QIL2_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5HZI7_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
O43521_BCL2L11-22       ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
O43521_BCL2L11-08       ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I2YQ13_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I3HW02_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2R9CA99_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2J8JCT2_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5NU92_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5X2I7_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
F7HHA9_BCL2L11-03       ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6E226_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5Z8B6_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I3M6I1_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2R9CA99_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2J8JCT2_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2J8JCT2_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I2YQ13_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2R9CA99_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I3HW02_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6KJP8_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6QIL2_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
O43521_BCL2L11-12       ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
O43521_BCL2L11-24       ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I2YQ13_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I3HW02_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2R9CA99_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2J8JCT2_BCL2L11      ctgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5NU92_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5X2I7_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
F7HHA9_BCL2L11-06       ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6E226_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5Z8B6_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I3M6I1_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5HZI7_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6KJP8_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6QIL2_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5HZI7_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5NU92_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5X2I7_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
F7HHA9_BCL2L11-04       ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6E226_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5Z8B6_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I3M6I1_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5X2I7_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
F7HHA9_BCL2L11-02       ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6E226_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5Z8B6_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I3M6I1_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6KJP8_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K6QIL2_BCL2L11      ccgaagacaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2K5HZI7_BCL2L11      ccgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccct
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       ctgacggt------------gaaggggacagctgcccccagggcagccca
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       ctgaaggc------------gaaggggaccgctgcccccaaggcagccct
J9NWV6_BCL2L11-01       ctgaaggc------------gaaggggaccgctgcccccaaggcagccct
A0A337SW42_BCL2L11      ctgaaggc------------gaaggggaccgctgcccccaaggcagccct
A0A337SW42_BCL2L11      ctgaaggc------------gaaggggaccgctgcccccaaggcagccct
A0A337SW42_BCL2L11      ctgaaggc------------gaaggggaccgctgcccccaaggcagccct
A0A337SW42_BCL2L11      ctgaaggc------------gaaggggaccgctgcccccaaggcagccct
A0A337SW42_BCL2L11      --------------------------------------------------

B2KKY9_BCL2L11-01       -agggatatccatgtcgaataaccagtcgaggtcaccgatgaaccggact
B8JK68_BCL2L11-01       -agggatatccatgtcgaataaccagtcgaggtcaccgatgaaccggact
Q4KMV9_BCL2L11-01       tggggtcctactatatcgccttatagtcccagttcctttgtcaacagatc
M3XHJ5_BCL2L11-01       atgggaggacttctgttgccccccagcccctgtccttttgtcactaggtc
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       cagggaccgtttgcaccacccactagccctagtccatttgctaccagatc
G3W979_BCL2L11-01       cagggaccgtttgcaccacccactagccctagcccgtttgctaccagatc
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       cagggcccgctggccccaccggccagccccggccctttcgctaccagatc
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      cagggcccgctggccccaccggccagccctggcccttctgctaccagatc
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       cagggcccgctggccccaccggccagccctggtccttttgctaccagatc
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       cagggcccgctggccccatcggccagccctggccctttcgctaccaggtc
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      cagggcccgctggccccaccggccagtcctggcccttttgctaccagatc
A0A286XJN2_BCL2L11      cagggcccgctggccccaccggccagtcctggcccttttgctaccagatc
F7A7D2_BCL2L11-01       ctgggcccgctggccccaccggccagccctggcccttttgctaccagatc
F1SU81_BCL2L11-01       cagggcccactggccccaccgaccagccctggcccctttgctaccagatc
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       cagggcccactggccccaccgaccagccctggcccctttgctaccagatc
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
H0XW23_BCL2L11-01       cagggcccactggccccaccggccagccctggtccttttgctaccagatc
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6GE31_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6GE31_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6GE31_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       cagggcccgctggccccaccggccagccccggcccttttgctaccagatc
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       cagggcccgctggccccaccggccagccccggcccttttgctaccagatc
A0A2K5CAB2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6TRZ5_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
F6XMC1_BCL2L11-08       cagggcccgctggccccaccggccagccccggcccttttgctaccagatc
A0A2K5CAB2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6TRZ5_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
F6XMC1_BCL2L11-04       cagggcccgctggccccaccggccagccccggcccttttgctaccagatc
F6XMC1_BCL2L11-03       cagggcccgctggccccaccggccagccccggcccttttgctaccagatc
A0A2K5CAB2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5CAB2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5CAB2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6TRZ5_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6TRZ5_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6TRZ5_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
F6XMC1_BCL2L11-05       cagggcccgctggccccaccggccagccccggcccttttgctaccagatc
F6XMC1_BCL2L11-07       cagggcccgctggccccaccggccagccccggcccttttgctaccagatc
A0A2K5CAB2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6TRZ5_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------ccctggcccttttgctaccagatc
O43521_BCL2L11-21       cagggcccgctggccccacctgccagccctggcccttttgctaccagatc
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       cagggcccgctggccccacctgccagccctggcccttttgctaccagatc
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I3HW02_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I2YQ13_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I3HW02_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2R9CA99_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2J8JCT2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2R9CA99_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5NU92_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5X2I7_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
F7HHA9_BCL2L11-01       cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6E226_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5Z8B6_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I3M6I1_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5NU92_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5X2I7_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6E226_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6E226_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5Z8B6_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5HZI7_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6QIL2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6QIL2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6KJP8_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       cagggcccgctggccccacctgccagccctggcccttttgctaccagatc
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       cagggcccgctggccccacctgccagccctggcccttttgctaccagatc
O43521_BCL2L11-16       cagggcccgctggccccacctgccagccctggcccttttgctaccagatc
A0A2K6KJP8_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6QIL2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5HZI7_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
O43521_BCL2L11-22       cagggcccgctggccccacctgccagccctggcccttttgctaccagatc
O43521_BCL2L11-08       cagggcccgctggccccacctgccagccctggcccttttgctaccagatc
A0A2I2YQ13_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I3HW02_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2R9CA99_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2J8JCT2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5NU92_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5X2I7_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
F7HHA9_BCL2L11-03       cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6E226_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5Z8B6_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I3M6I1_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2R9CA99_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2J8JCT2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2J8JCT2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I2YQ13_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2R9CA99_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I3HW02_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6KJP8_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6QIL2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
O43521_BCL2L11-12       cagggcccgctggccccacctgccagccctggcccttttgctaccagatc
O43521_BCL2L11-24       cagggcccgctggccccacctgccagccctggcccttttgctaccagatc
A0A2I2YQ13_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I3HW02_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2R9CA99_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2J8JCT2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5NU92_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5X2I7_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
F7HHA9_BCL2L11-06       cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6E226_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5Z8B6_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I3M6I1_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5HZI7_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6KJP8_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6QIL2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5HZI7_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5NU92_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5X2I7_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
F7HHA9_BCL2L11-04       cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6E226_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5Z8B6_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I3M6I1_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5X2I7_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
F7HHA9_BCL2L11-02       cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6E226_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5Z8B6_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I3M6I1_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6KJP8_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K6QIL2_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2K5HZI7_BCL2L11      cagggcccgctggccccaccggccagccctggcccttttgctaccagatc
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       cagggcccgcaggccccaccagccagccccggcccttttgctaccagatc
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       cagggcccgctggccccaccagccagcccaggcccttttgctaccagatc
J9NWV6_BCL2L11-01       cagggcccgctggccccaccagccagccccggcccttttgctaccagatc
A0A337SW42_BCL2L11      cagggcccgctggccccaccagccagccccgggccttttgctaccagatc
A0A337SW42_BCL2L11      cagggcccgctggccccaccagccagccccgggccttttgctaccagatc
A0A337SW42_BCL2L11      cagggcccgctggccccaccagccagccccgggccttttgctaccagatc
A0A337SW42_BCL2L11      cagggcccgctggccccaccagccagccccgggccttttgctaccagatc
A0A337SW42_BCL2L11      --------------------------------------------------

B2KKY9_BCL2L11-01       ttc----------------------------------tccaggtcctcta
B8JK68_BCL2L11-01       ttc----------------------------------tccaggtcctcta
Q4KMV9_BCL2L11-01       accccattgcatgctggtaagaggatcatcacttgtctccaaaacctcaa
M3XHJ5_BCL2L11-01       cccgtttttcatcttcatgaggcggtccttagttttatccacatcttcca
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       cccacttttcatctttttaagaagatctccactgctgcctcgatcttcca
G3W979_BCL2L11-01       cccacttttcatctttgtaagaagatccccactgctgcctcgatcttcta
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       cccgctcttcatcttcgtgagaagatcctccttgctgtctcggtcctcca
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      cccacttttcatctttgtgagaagatcttctctgctgtcccggtcctcca
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       cccacttttcatctttgtgagaagatcttctctgctgtcccggtcctcca
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       cccacttttcatctttgtgagaagatcttctctgctgtcccggtcctcca
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       cccgctcttcatctttgtccgaagatcctccctgctgtctcgatcgtcca
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      cccgctattcatctttgtgagaagatcttccctgctgtctcgatcctcca
A0A286XJN2_BCL2L11      cccgctattcatctttgtgagaagatcttccctgctgtctcgatcctcca
F7A7D2_BCL2L11-01       cccgtttttcatctttgtgagaagatcttccctgctgtctcgctcctcca
F1SU81_BCL2L11-01       cccgcttttcatcttcgtgagaagatcctccctgctgtctcgatcctcca
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       cccgcttttcatcttcgtgagaagatcctccctgctgtctcgatcctcca
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      cccgcttttcatctttgtgagaagatcttccctgctgtctcgatcctcca
H0XW23_BCL2L11-01       cccgcttttcatctttgtaagaagatcctccctgctgtctcgatcctcca
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      cccgcttttcatctttgtgagaagatcttccctgctgtctcgatcctcca
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      cccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctcca
A0A2K6GE31_BCL2L11      cccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctcca
A0A2K6GE31_BCL2L11      cccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctcca
A0A2K6GE31_BCL2L11      cccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctcca
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-06       cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K5CAB2_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K6TRZ5_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
F6XMC1_BCL2L11-08       cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K5CAB2_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K6TRZ5_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
F6XMC1_BCL2L11-04       cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
F6XMC1_BCL2L11-03       cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K5CAB2_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K5CAB2_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K5CAB2_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K6TRZ5_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K6TRZ5_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K6TRZ5_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
F6XMC1_BCL2L11-05       cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
F6XMC1_BCL2L11-07       cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K5CAB2_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
A0A2K6TRZ5_BCL2L11      cccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctcca
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      ccc-----------------------------------------------
O43521_BCL2L11-21       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I3HW02_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I2YQ13_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I3HW02_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2R9CA99_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2J8JCT2_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2R9CA99_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5NU92_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5X2I7_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
F7HHA9_BCL2L11-01       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6E226_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5Z8B6_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I3M6I1_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5NU92_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5X2I7_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6E226_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6E226_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5Z8B6_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5HZI7_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6QIL2_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6QIL2_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6KJP8_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
O43521_BCL2L11-16       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6KJP8_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6QIL2_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5HZI7_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
O43521_BCL2L11-22       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
O43521_BCL2L11-08       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I2YQ13_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I3HW02_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2R9CA99_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2J8JCT2_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5NU92_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5X2I7_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
F7HHA9_BCL2L11-03       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6E226_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5Z8B6_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I3M6I1_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2R9CA99_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2J8JCT2_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2J8JCT2_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I2YQ13_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2R9CA99_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I3HW02_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6KJP8_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6QIL2_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
O43521_BCL2L11-12       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
O43521_BCL2L11-24       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I2YQ13_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I3HW02_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2R9CA99_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2J8JCT2_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5NU92_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5X2I7_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
F7HHA9_BCL2L11-06       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6E226_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5Z8B6_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I3M6I1_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5HZI7_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6KJP8_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6QIL2_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5HZI7_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5NU92_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5X2I7_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
F7HHA9_BCL2L11-04       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6E226_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5Z8B6_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I3M6I1_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5X2I7_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
F7HHA9_BCL2L11-02       cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6E226_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5Z8B6_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I3M6I1_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6KJP8_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K6QIL2_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2K5HZI7_BCL2L11      cccgcttttcatctttatgagaagatcctccctgctgtctcgatcctcca
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       cccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctcca
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       cccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctcca
J9NWV6_BCL2L11-01       cccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctcca
A0A337SW42_BCL2L11      cccgtttttcatctttgtcagaagatcctccctgctgtctcgatcctcca
A0A337SW42_BCL2L11      cccgtttttcatctttgtcagaagatcctccctgctgtctcgatcctcca
A0A337SW42_BCL2L11      cccgtttttcatctttgtcagaagatcctccctgctgtctcgatcctcca
A0A337SW42_BCL2L11      cccgtttttcatctttgtcagaagatcctccctgctgtctcgatcctcca
A0A337SW42_BCL2L11      --------------------------------------------------

B2KKY9_BCL2L11-01       gtggctatttttccgtcgacagcgattctgtgccaggttcccctctaatg
B8JK68_BCL2L11-01       gtggctatttttccgtcgacagcgattctgtgccaggttcccctctaatg
Q4KMV9_BCL2L11-01       gtggctatttttcattcgaag------------tgag------tcctggg
M3XHJ5_BCL2L11-01       gtggatattttacttttgactctgatatagttcatag------ccctgca
U3IW89_BCL2L11-01       ---------------------------------gcag------ccccgcg
R4G9R5_BCL2L11-01       -------------atgtgccgtggaga------agaa------cagggag
F7FTC8_BCL2L11-01       ----------------------agaca------ggag------ccctccg
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       ----------------------agaca------ggag------ccctgtg
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       gtgggtatttctcttttgacacagaca------ggag------tccagcg
G3W979_BCL2L11-01       gtgggtatttctcttttgacacagaca------ggag------tccagcg
O43521_BCL2L11-11       ------tctcactctgtcacccaggct------ggag------t---gca
F7HHA9_BCL2L11-08       ------tctcactctgttgcccaagct------ggag------t---gca
Q2YDF0_BCL2L11-01       ----------------------agaca------ggag------cccggca
W5PY58_BCL2L11-01       gcgggtatttctcttttgacacagaca------ggag------cccggca
A0A1U8BW10_BCL2L11      ----------------------agaca------ggag------tccggca
A0A1U8BW10_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------tccggca
A0A1U8BW10_BCL2L11      ----------------------agaca------ggag------tccggca
O54918_BCL2L11-03       ----------------------agaca------ggag------cccggca
O88498_BCL2L11-01       gtgggtatttctcttttgacacagaca------ggag------cccggca
O88498_BCL2L11-02       ----------------------agaca------ggag------cccggca
O54918_BCL2L11-01       gtgggtatttctcttttgacacagaca------ggag------cccggca
O54918_BCL2L11-05       ----------------------agaca------ggag------cccggca
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       gtgggtatttctcttttgacacagaca------ggag------cccggca
A0A286XJN2_BCL2L11      ----------------------agaca------ggag------cccggca
A0A286XJN2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccggca
A0A286XJN2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccggca
F7A7D2_BCL2L11-01       gtgggtatttctcttttgacacagaca------ggag------cccggca
F1SU81_BCL2L11-01       gtgggtatttctcttttgacacagaca------ggag------cccagca
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       gtgggtatttctcttttgacacagaca------ggag------cccagca
F1SU81_BCL2L11-03       ----------------------agaca------ggag------cccagca
A0A287DFJ0_BCL2L11      ----------------------agaca------ggag------cccagca
A0A287DFJ0_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
H0XW23_BCL2L11-01       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A1S3FHA8_BCL2L11      ----------------------agaca------ggag------cccggca
A0A1S3FHA8_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccggca
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6GE31_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6GE31_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6GE31_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6GE31_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2I3HW02_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2R9CA99_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2J8JCT2_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2I2YQ13_BCL2L11      ----------------------agaca------ggag------cccagca
O43521_BCL2L11-06       ----------------------agaca------ggag------cccagca
O43521_BCL2L11-15       ----------------------agaca------ggag------cccagca
A0A2K5X2I7_BCL2L11      ----------------------agaca------ggag------cccagca
F7HHA9_BCL2L11-09       ----------------------agaca------ggag------cccagca
A0A2K6E226_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K5NU92_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K5Z8B6_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2I3M6I1_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K5HZI7_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K6KJP8_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K6QIL2_BCL2L11      ----------------------agaca------ggag------cccagca
F6XMC1_BCL2L11-09       ----------------------agaca------ggag------cccagca
A0A2K5CAB2_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K6TRZ5_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       gtgggtatttctcttttgacacagaca------ggag------cccagca
F6XMC1_BCL2L11-02       ----------------------agaca------ggag------cccagca
F6XMC1_BCL2L11-06       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5CAB2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6TRZ5_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
F6XMC1_BCL2L11-08       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5CAB2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6TRZ5_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
F6XMC1_BCL2L11-04       gtgggtatttctcttttgacacagaca------ggag------cccagca
F6XMC1_BCL2L11-03       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5CAB2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5CAB2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5CAB2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5CAB2_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K6TRZ5_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6TRZ5_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6TRZ5_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6TRZ5_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K5CAB2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6TRZ5_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
F6XMC1_BCL2L11-05       gtgggtatttctcttttgacacagaca------ggag------cccagca
F6XMC1_BCL2L11-07       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5CAB2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6TRZ5_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
H2P5E2_BCL2L11-01       ----------------------agaca------ggag------cccggca
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       gtgggtatttctcttttgacacagaca------ggag------cccagca
O43521_BCL2L11-02       ----------------------agaca------ggag------cccagca
O43521_BCL2L11-03       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2J8JCT2_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2J8JCT2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I3HW02_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I2YQ13_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I3HW02_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2R9CA99_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2J8JCT2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I2YQ13_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2R9CA99_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2I2YQ13_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2R9CA99_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I3M6I1_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2I3M6I1_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2I3M6I1_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5NU92_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5X2I7_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
F7HHA9_BCL2L11-01       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6E226_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5Z8B6_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I3M6I1_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5NU92_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5X2I7_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6E226_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6E226_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5Z8B6_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5NU92_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K5X2I7_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K6E226_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K5Z8B6_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K5HZI7_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5HZI7_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5HZI7_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K6QIL2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6QIL2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6QIL2_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K6KJP8_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6QIL2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6KJP8_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K6KJP8_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6KJP8_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       ----------------------agaca------ggag------cccagca
O43521_BCL2L11-05       ----------------------agaca------ggag------cccagca
O43521_BCL2L11-18       gtgggtatttctcttttgacacagaca------ggag------cccagca
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       gtgggtatttctcttttgacacagaca------ggag------cccagca
O43521_BCL2L11-16       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6KJP8_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6QIL2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5HZI7_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
O43521_BCL2L11-22       gtgggtatttctcttttgacacagaca------ggag------cccagca
O43521_BCL2L11-08       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I2YQ13_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I3HW02_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2R9CA99_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2J8JCT2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5NU92_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5X2I7_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
F7HHA9_BCL2L11-03       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6E226_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5Z8B6_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I3M6I1_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
O43521_BCL2L11-19       ----------------------agaca------ggag------cccagca
O43521_BCL2L11-07       ----------------------agaca------ggag------cccagca
A0A2I2YQ13_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2R9CA99_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2J8JCT2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2J8JCT2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I2YQ13_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2R9CA99_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I3HW02_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6KJP8_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6QIL2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
O43521_BCL2L11-12       gtgggtatttctcttttgacacagaca------ggag------cccagca
O43521_BCL2L11-24       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I2YQ13_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I3HW02_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2R9CA99_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2J8JCT2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5NU92_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5X2I7_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
F7HHA9_BCL2L11-06       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6E226_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5Z8B6_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I3M6I1_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5HZI7_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6KJP8_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6QIL2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5HZI7_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5NU92_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5X2I7_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
F7HHA9_BCL2L11-04       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6E226_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5Z8B6_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I3M6I1_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A0D9RWE0_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K5NU92_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5X2I7_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
F7HHA9_BCL2L11-02       gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6E226_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5Z8B6_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I3M6I1_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6KJP8_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K6QIL2_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2K5HZI7_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccagca
A0A2I3HW02_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2I2YQ13_BCL2L11      ----------------------agaca------ggag------cccagca
O43521_BCL2L11-23       ----------------------agaca------ggag------cccagca
A0A2R9CA99_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2J8JCT2_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2I3M6I1_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K5X2I7_BCL2L11      ----------------------agaca------ggag------cccagca
F7HHA9_BCL2L11-07       ----------------------agaca------ggag------cccagca
A0A2K5HZI7_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K5NU92_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K5Z8B6_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K5CAB2_BCL2L11      ----------------------agaca------ggag------cccagca
A0A2K6TRZ5_BCL2L11      ----------------------agaca------ggag------cccagca
G3SU55_BCL2L11-01       gcgggtatttctcttttgacacagaca------ggag------cccagca
M3YDI3_BCL2L11-01       ------------------------aca------ggag------cccggca
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       gtgggtatttctcttttgacacagaca------ggag------cccggca
J9NWV6_BCL2L11-01       gtgggtatttctcttttgacacagaca------ggag------cccggca
A0A337SW42_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccggca
A0A337SW42_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccggca
A0A337SW42_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccggca
A0A337SW42_BCL2L11      gtgggtatttctcttttgacacagaca------ggag------cccggca
A0A337SW42_BCL2L11      ----------------------agaca------ggag------cccggca

B2KKY9_BCL2L11-01       cccaatatttccgaagcgcaagacggacaaaatgatgaggtatggttatc
B8JK68_BCL2L11-01       cccaatatttccgaagcgcaagacggacaaaatgatgaggtatggttatc
Q4KMV9_BCL2L11-01       cctgtgagctgtga----taaatcaactcaaacaccaagccctccttgtc
M3XHJ5_BCL2L11-01       cctgtaagtgtcca----caaggctacacagactccaagcccatcaagcc
U3IW89_BCL2L11-01       cccatgagctgcga----caaggccacgcagacccccagcccgccctgcc
R4G9R5_BCL2L11-01       gagatggtgtgagg----cagaa---------------------------
F7FTC8_BCL2L11-01       cctgtgagttgcga----taaatcgacccagacccccagtccccactgtc
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       cctatgagttgcga----caagtcgacgcagactccaagtcccccttgtc
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       cctatgagttgtga----taaatctacacaaactccaagccctccttgtc
G3W979_BCL2L11-01       cctatgagttgtga----taaatctacacaaactccaagccctccttgtc
O43521_BCL2L11-11       ctggtgcgatct------tggctcactgcaacctccaactc-------cc
F7HHA9_BCL2L11-08       ctggtactatct------tggctcactgcaacctccaactc-------cc
Q2YDF0_BCL2L11-01       cccatgagttgtga----caaatccacacagaccccaagccctccttgcc
W5PY58_BCL2L11-01       cccatgagttgtga----caaatccacacagaccccaagccctccttgcc
A0A1U8BW10_BCL2L11      cccatgagttgtga----caagtcaacacaaaccccaagtcctccttgcc
A0A1U8BW10_BCL2L11      cccatgagttgtga----caagtcaacacaaaccccaagtcctccttgcc
A0A1U8BW10_BCL2L11      cccatgagttgtga----caagtcaacacaaaccccaagtcctccttgcc
O54918_BCL2L11-03       cccatgagttgtga----caagtcaacacaaaccccaagtcctccttgcc
O88498_BCL2L11-01       cccatgagttgtga----caagtcaacacaaaccccaagtcctccttgcc
O88498_BCL2L11-02       cccatgagttgtga----caagtcaacacaaaccccaagtcctccttgcc
O54918_BCL2L11-01       cccatgagttgtga----caagtcaacacaaaccccaagtcctccttgcc
O54918_BCL2L11-05       cccatgagttgtga----caagtcaacacaaaccccaagtcctccttgcc
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       cccatgagctgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A286XJN2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A286XJN2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A286XJN2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F7A7D2_BCL2L11-01       cccatgagttgtga----caaatcaacacaaacgccaagtcctccttgcc
F1SU81_BCL2L11-01       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F1SU81_BCL2L11-03       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A287DFJ0_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A287DFJ0_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
H0XW23_BCL2L11-01       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A1S3FHA8_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccctgcc
A0A1S3FHA8_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccctgcc
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6GE31_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6GE31_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6GE31_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6GE31_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3HW02_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2R9CA99_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2J8JCT2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I2YQ13_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-06       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-15       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5X2I7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F7HHA9_BCL2L11-09       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6E226_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5NU92_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5Z8B6_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3M6I1_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5HZI7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6KJP8_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6QIL2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F6XMC1_BCL2L11-09       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5CAB2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6TRZ5_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F6XMC1_BCL2L11-02       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F6XMC1_BCL2L11-06       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5CAB2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6TRZ5_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F6XMC1_BCL2L11-08       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5CAB2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6TRZ5_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F6XMC1_BCL2L11-04       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F6XMC1_BCL2L11-03       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5CAB2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5CAB2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5CAB2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5CAB2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6TRZ5_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6TRZ5_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6TRZ5_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6TRZ5_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5CAB2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6TRZ5_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F6XMC1_BCL2L11-05       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F6XMC1_BCL2L11-07       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5CAB2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6TRZ5_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
H2P5E2_BCL2L11-01       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6E226_BCL2L11      --------ttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-21       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-02       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-03       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2J8JCT2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2J8JCT2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3HW02_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I2YQ13_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3HW02_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2R9CA99_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2J8JCT2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I2YQ13_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2R9CA99_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I2YQ13_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2R9CA99_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3M6I1_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3M6I1_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3M6I1_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5NU92_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5X2I7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F7HHA9_BCL2L11-01       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6E226_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5Z8B6_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3M6I1_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5NU92_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5X2I7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6E226_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6E226_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5Z8B6_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5NU92_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5X2I7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6E226_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5Z8B6_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5HZI7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5HZI7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5HZI7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6QIL2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6QIL2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6QIL2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6KJP8_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6QIL2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6KJP8_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6KJP8_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6KJP8_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-05       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-18       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-16       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6KJP8_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6QIL2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5HZI7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-22       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-08       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I2YQ13_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3HW02_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2R9CA99_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2J8JCT2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5NU92_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5X2I7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F7HHA9_BCL2L11-03       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6E226_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5Z8B6_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3M6I1_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-19       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-07       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I2YQ13_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2R9CA99_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2J8JCT2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2J8JCT2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I2YQ13_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2R9CA99_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3HW02_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6KJP8_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6QIL2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-12       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-24       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I2YQ13_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3HW02_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2R9CA99_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2J8JCT2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5NU92_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5X2I7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F7HHA9_BCL2L11-06       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6E226_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5Z8B6_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3M6I1_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5HZI7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6KJP8_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6QIL2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5HZI7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5NU92_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5X2I7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F7HHA9_BCL2L11-04       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6E226_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5Z8B6_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3M6I1_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A0D9RWE0_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5NU92_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5X2I7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F7HHA9_BCL2L11-02       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6E226_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5Z8B6_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3M6I1_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6KJP8_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6QIL2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5HZI7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3HW02_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I2YQ13_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
O43521_BCL2L11-23       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2R9CA99_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2J8JCT2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2I3M6I1_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5X2I7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
F7HHA9_BCL2L11-07       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5HZI7_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5NU92_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5Z8B6_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K5CAB2_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A2K6TRZ5_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
G3SU55_BCL2L11-01       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
M3YDI3_BCL2L11-01       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
J9NWV6_BCL2L11-01       cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A337SW42_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A337SW42_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A337SW42_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A337SW42_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc
A0A337SW42_BCL2L11      cccatgagttgtga----caaatcaacacaaaccccaagtcctccttgcc

B2KKY9_BCL2L11-01       agaacat-agccac--------cagc------------------------
B8JK68_BCL2L11-01       agaacat-agccac--------cagc------------------------
Q4KMV9_BCL2L11-01       aggcatttaatcat--------ctcctttccgcaatg-------------
M3XHJ5_BCL2L11-01       aactcatcgtacacgtacagcattgcttagcgcaaag-------------
U3IW89_BCL2L11-01       aggccgtcagccac------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       aagccttcaatcat--------tatctaagtgcaatg-------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       aagcctttaatcat--------tatctaagtgcaatgggtaagcaagatc
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       aagccttcaatcat--------tatctaagtgcaatg-------------
G3W979_BCL2L11-01       aagccttcaatcat--------tatctaagtgcaatggataca-------
O43521_BCL2L11-11       aag--ttcaagc------------------------g-------------
F7HHA9_BCL2L11-08       aag--ttcaagc------------------------g-------------
Q2YDF0_BCL2L11-01       aggccttcaaccat--------tatctcagtgcaatg-------------
W5PY58_BCL2L11-01       aggccttcaaccat--------tatctcagtgcaatg-------------
A0A1U8BW10_BCL2L11      aagccttcaaccat--------tatctcagtgcaatg-------------
A0A1U8BW10_BCL2L11      aagccttcaaccat--------tatctcagtgcaatg-------------
A0A1U8BW10_BCL2L11      aagccttcaaccat--------tatctcagtgcaatg-------------
O54918_BCL2L11-03       aggccttcaaccac--------tatctcagtgcaatg-------------
O88498_BCL2L11-01       aggccttcaaccat--------tatctcagtgcaatg-------------
O88498_BCL2L11-02       aggccttcaaccat--------tatctcagtgcaatg-------------
O54918_BCL2L11-01       aggccttcaaccac--------tatctcagtgcaatg-------------
O54918_BCL2L11-05       aggccttcaaccac--------tatctcagtgcaatg-------------
O54918_BCL2L11-06       ------------------------------------a-------------
O54918_BCL2L11-08       ------------------------------------a-------------
G1SSY0_BCL2L11-01       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A286XJN2_BCL2L11      aggccttcaaccat--------tatctcagtgcaatg-------------
A0A286XJN2_BCL2L11      aggccttcaaccat--------tatctcagtgcaatg-------------
A0A286XJN2_BCL2L11      aggccttcaaccat--------tatctcagtgcaatg-------------
F7A7D2_BCL2L11-01       aagccttcaaccac--------tatctcagtgcaatg-------------
F1SU81_BCL2L11-01       aagccttcaaccat--------tatctcagtgcgatg-------------
C1KGB8_BCL2L11-01       ------------------------------------a-------------
F1SU81_BCL2L11-02       aagccttcaaccat--------tatctcagtgcgatg-------------
F1SU81_BCL2L11-03       aagccttcaaccat--------tatctcagtgcgatg-------------
A0A287DFJ0_BCL2L11      aggccttcaaccat--------tatctgagtgcaatg-------------
A0A287DFJ0_BCL2L11      aggccttcaaccat--------tatctgagtgcaatg-------------
H0XW23_BCL2L11-01       aggccttcaaccat--------tatctcagtgcaatg-------------
A0A1S3FHA8_BCL2L11      aggccttcaaccat--------tatctcagcgcaatg-------------
A0A1S3FHA8_BCL2L11      aggccttcaaccat--------tatctcagcgcaatg-------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      aggccttcaaccat--------tatctcagtgcaatg-------------
A0A2K6GE31_BCL2L11      aggccttcaaccat--------tatctcagtgcaatg-------------
A0A2K6GE31_BCL2L11      aggccttcaaccat--------tatctcagtgcaat--------------
A0A2K6GE31_BCL2L11      aggccttcaaccat--------tatctcagtgcaatg-------------
A0A2K6GE31_BCL2L11      aggccttcaaccat--------tatctcagtgcaatg-------------
A0A2I3HW02_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2R9CA99_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2J8JCT2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I2YQ13_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-06       aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-15       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5X2I7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
F7HHA9_BCL2L11-09       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6E226_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5NU92_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5Z8B6_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3M6I1_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5HZI7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6KJP8_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6QIL2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
F6XMC1_BCL2L11-09       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5CAB2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6TRZ5_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       aggccttcaaccac--------tatctcagtgcaatg-------------
F6XMC1_BCL2L11-02       aggccttcaaccac--------tatctcagtgcaatg-------------
F6XMC1_BCL2L11-06       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5CAB2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6TRZ5_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
F6XMC1_BCL2L11-08       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5CAB2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6TRZ5_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
F6XMC1_BCL2L11-04       aggccttcaaccac--------tatctcagtgcaat--------------
F6XMC1_BCL2L11-03       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5CAB2_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
A0A2K5CAB2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5CAB2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5CAB2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6TRZ5_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
A0A2K6TRZ5_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6TRZ5_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6TRZ5_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5CAB2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6TRZ5_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
F6XMC1_BCL2L11-05       aggccttcaaccac--------tatctcagtgcaatg-------------
F6XMC1_BCL2L11-07       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5CAB2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6TRZ5_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
H2P5E2_BCL2L11-01       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6E226_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-21       aggccttcaaccac--------tatctcagtgcaat--------------
O43521_BCL2L11-02       aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-03       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2J8JCT2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2J8JCT2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3HW02_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I2YQ13_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
A0A2I3HW02_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
A0A2R9CA99_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
A0A2J8JCT2_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
A0A2I2YQ13_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2R9CA99_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I2YQ13_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2R9CA99_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3M6I1_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3M6I1_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3M6I1_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5NU92_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
A0A2K5X2I7_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
F7HHA9_BCL2L11-01       aggccttcaaccac--------tatctcagtgcaat--------------
A0A2K6E226_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
A0A2K5Z8B6_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
A0A2I3M6I1_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
A0A2K5NU92_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5X2I7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6E226_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6E226_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5Z8B6_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5NU92_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5X2I7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6E226_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5Z8B6_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5HZI7_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
A0A2K5HZI7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5HZI7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6QIL2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6QIL2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6QIL2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6KJP8_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
A0A2K6QIL2_BCL2L11      aggccttcaaccac--------tatctcagtgcaat--------------
A0A2K6KJP8_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6KJP8_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6KJP8_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-05       aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-18       aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-16       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6KJP8_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6QIL2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5HZI7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-22       aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-08       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I2YQ13_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3HW02_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2R9CA99_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2J8JCT2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5NU92_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5X2I7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
F7HHA9_BCL2L11-03       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6E226_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5Z8B6_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3M6I1_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-19       aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-07       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I2YQ13_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2R9CA99_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2J8JCT2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2J8JCT2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I2YQ13_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2R9CA99_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3HW02_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6KJP8_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6QIL2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-12       aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-24       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I2YQ13_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3HW02_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2R9CA99_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2J8JCT2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5NU92_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5X2I7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
F7HHA9_BCL2L11-06       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6E226_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5Z8B6_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3M6I1_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5HZI7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6KJP8_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6QIL2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5HZI7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5NU92_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5X2I7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
F7HHA9_BCL2L11-04       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6E226_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5Z8B6_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3M6I1_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A0D9RWE0_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5NU92_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5X2I7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
F7HHA9_BCL2L11-02       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6E226_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5Z8B6_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3M6I1_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6KJP8_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6QIL2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5HZI7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3HW02_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I2YQ13_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
O43521_BCL2L11-23       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2R9CA99_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2J8JCT2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2I3M6I1_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5X2I7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
F7HHA9_BCL2L11-07       aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5HZI7_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5NU92_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5Z8B6_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K5CAB2_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
A0A2K6TRZ5_BCL2L11      aggccttcaaccac--------tatctcagtgcaatg-------------
G3SU55_BCL2L11-01       aggccatcaaccat--------tacctcagtgcaatg-------------
M3YDI3_BCL2L11-01       aggccttcaaccat--------tatctcagtgcaatg-------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       aggccttcaaccat--------tatctcagtgcaatg-------------
J9NWV6_BCL2L11-01       aggccttcaaccat--------tatctcagtgcaatg-------------
A0A337SW42_BCL2L11      aggccttcaaccat--------tatctcagtgcaatg-------------
A0A337SW42_BCL2L11      aggccttcaaccat--------tatctcagtgcaatg-------------
A0A337SW42_BCL2L11      aggccttcaaccat--------tatctcagtgcaat--------------
A0A337SW42_BCL2L11      aggccttcaaccat--------tatctcagtgcaatg-------------
A0A337SW42_BCL2L11      aggccttcaaccat--------tatctcagtgcaatg-------------

B2KKY9_BCL2L11-01       --acttgcagatggcagcacca--------gtcgcagccctgccgccgga
B8JK68_BCL2L11-01       --acttgcagatggcagcacca--------gtcgcagccctgccgccgga
Q4KMV9_BCL2L11-01       --gctgacagaaatc--------ctgtgaatc-----agatgtcaccaga
M3XHJ5_BCL2L11-01       -----------------------------------agaacagcatcccga
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --acttccagatggcagtcacg-gccaattcctgaagatatgcagccaga
F7FTC8_BCL2L11-01       --gcttccattagacagcctca-gtctgttcctgaagatatgcggccgga
G1MV54_BCL2L11-01       --gcttccaggtggcgatctca-ctcacttgcagaagaaatacaaccaga
K7GA86_BCL2L11-01       atgcttccaggtgggagtcccc-ctcaatacgtgaagacatgcagccaga
G1PDJ5_BCL2L11-01       -----tccatgcagcagtctca-ggccctacctgtagacatgcgtccgga
F7CXT2_BCL2L11-01       --gcttccatgaggcagtctca-atcaatacctgcagatatgcggccaga
G3W979_BCL2L11-01       --gcttccatgaggcagtctca-gtcaatacctgcagatatgcgaccaga
O43521_BCL2L11-11       --gttctcctgcctcagcctcc----------------------------
F7HHA9_BCL2L11-08       --gttctcctgcctcagcctcc----------------------------
Q2YDF0_BCL2L11-01       --gcttccatgaggcagtctca-ggctgtacctgcagatacacgcccaga
W5PY58_BCL2L11-01       --gcttccatgaggcagtctca-ggctgtacctgcagatacacgcccaga
A0A1U8BW10_BCL2L11      --gcttccataaggcagtctca-ggaggaacctgcagatatccgcccgga
A0A1U8BW10_BCL2L11      --gcttccataaggcagtctca-ggaggaacctgcagatatccgcccgga
A0A1U8BW10_BCL2L11      --ga-tctgtgtgagaatctta-ag-------------------------
O54918_BCL2L11-03       --gat---------cagt--------------------------------
O88498_BCL2L11-01       --gcttccataaggcagtctca-ggaggaacctgaagatctgcgcccaga
O88498_BCL2L11-02       --gcttccataaggcagtctca-ggaggaacctgaagatctgcgcccaga
O54918_BCL2L11-01       --gcttccatacgacagtctca-ggaggaacctgaagatctgcgcccgga
O54918_BCL2L11-05       --gcttccatacgacagtctca-ggaggaacctgaagatctgcgcccgga
O54918_BCL2L11-06       --gcttccatacgacagtctca-ggaggaacctgaagatctgcgcccgga
O54918_BCL2L11-08       --gcttccatacgacagtctca-ggaggaacctgaagatctgcgcccgga
G1SSY0_BCL2L11-01       --gcttccatgaggcagtctca-ggctgaacctgcagacacgcgtccgga
A0A286XJN2_BCL2L11      --gcttccatgaggcagtctca-ggctggacctccgcatttgcgcccaga
A0A286XJN2_BCL2L11      --gcttccatgaggcagtctca-ggctggacctccgcatttgcgcccaga
A0A286XJN2_BCL2L11      --gcttccatgaggcagtctca-ggctggacctccgcatttgcgcccaga
F7A7D2_BCL2L11-01       --gcttccatgaggcagtcgca-ggcggtccctgcagacatgcgcccgga
F1SU81_BCL2L11-01       --gcttccatgaggcagtctca-ggctgaacccgcagatatgcgcccgga
C1KGB8_BCL2L11-01       --gcttccatgaggcagtctca-ggctgaacccgcagatatgcgcccgga
F1SU81_BCL2L11-02       --gcttccatgaggcagtctca-ggctgaacccgcagatatgcgcccgga
F1SU81_BCL2L11-03       --gcttccatgaggcagtctca-ggctgaacccgcagatatgcgcccgga
A0A287DFJ0_BCL2L11      --gcttccatgcgggagtctca-ggcagaacctgcagacatgcgcccgga
A0A287DFJ0_BCL2L11      --gcttccatgcgggagtctca-ggcagaacctgcagacatgcgcccgga
H0XW23_BCL2L11-01       --gcttccatgaggcagtctca-ggccgaacctgcagatttgcgcccgga
A0A1S3FHA8_BCL2L11      --gcttccatgaggcagtctca-ggaagagcctgcagatttgcgcccaga
A0A1S3FHA8_BCL2L11      --gcttccatgaggcagtctca-ggaagagcctgcagatttgcgcccaga
A0A2K6GE31_BCL2L11      ---cttccatgaggcaatttca-ggctgaacctgcagatatgcgcccgga
A0A2K6GE31_BCL2L11      --gtt------------------------------------------aga
A0A2K6GE31_BCL2L11      --gcttccatgaggcaatttca-ggctgaacctgcagatatgcgcccgga
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --gcttccatgaggcaatttca-ggctgaacctgcagatatgcgcccgga
A0A2K6GE31_BCL2L11      --gcttccatgaggcaatttca-ggctgaacctgcagatatgcgcccgga
A0A2I3HW02_BCL2L11      --gtagtcatcctagaggatgt-aggtgatatttcactgtggtttggatt
A0A2R9CA99_BCL2L11      --gtagtcatcctagaggatat-aggtgatctttcactgtgctttggatt
A0A2J8JCT2_BCL2L11      --gtagtcatcctagaggatat-aggtgatctttcactgtgctttggatt
A0A2I2YQ13_BCL2L11      --gtagtcatcctagaggatat-aggtgatctttcactgtggtttggatt
O43521_BCL2L11-06       --gtagtcatcctagaggatat-aggtgatctttcactgtgctttggatt
O43521_BCL2L11-15       --gtagtcatcctagaggatat-aggtgatctttcactgtgctttggatt
A0A2K5X2I7_BCL2L11      --gtagtcatcctagaggatat-aggtgatagttcattgtggtttggatt
F7HHA9_BCL2L11-09       --gtagtcatcctagaggatat-aggtgatagttcattgtggtttggatt
A0A2K6E226_BCL2L11      --gtagtcatcctagaggatat-aggtgatagttcattgtggtttggatt
A0A2K5NU92_BCL2L11      --gtagtcattctggaggatat-aggtgatagttcattgtggtttggatt
A0A2K5Z8B6_BCL2L11      --gtagtcattctagaggatat-aggtgatagttcatt---gtttggatt
A0A2I3M6I1_BCL2L11      --gtagtcattctagaggatat-aggtgatagttcattgtggtttggatt
A0A2K5HZI7_BCL2L11      --gtagtcatcctagaggatat-aggtgatacttcattgtggtttggatt
A0A2K6KJP8_BCL2L11      --gtagtcatcctagaggatat-aggtgatacttcattgtggtttggatt
A0A2K6QIL2_BCL2L11      --gtagtcatcctagaggatat-aggtgatacttcattgtggtttggatt
F6XMC1_BCL2L11-09       --gtagtcatccgaatggatat-aggtgatatttcattgtggtttagatt
A0A2K5CAB2_BCL2L11      ------------------------ggtgatatttcattgtggtttagatt
A0A2K6TRZ5_BCL2L11      --gtagtcatccgaatggatat-aggtgatatttcattgtggtttaggtt
A0A2K5NU92_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5X2I7_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
F7HHA9_BCL2L11-05       --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5Z8B6_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5HZI7_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6QIL2_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6KJP8_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
O43521_BCL2L11-13       --gcttccatgaggca-------ggctgaacctgcagatatgcgcccaga
O43521_BCL2L11-17       --gcttccatgaggca-------ggctgaacctgcagatatgcgcccaga
A0A2J8JCT2_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgaccgga
A0A2I3HW02_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
A0A2I2YQ13_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
A0A2R9CA99_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
F6XMC1_BCL2L11-01       --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
F6XMC1_BCL2L11-02       --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
F6XMC1_BCL2L11-06       --gtt---------------------------------------------
A0A2K5CAB2_BCL2L11      --gtt---------------------------------------------
A0A2K6TRZ5_BCL2L11      --gtt---------------------------------------------
F6XMC1_BCL2L11-08       --g-------gatacagactcactggtcagcagccatgtctgccctggaa
A0A2K5CAB2_BCL2L11      --gct------------------gactgg---------------------
A0A2K6TRZ5_BCL2L11      --gct------------------gactgg---------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
A0A2K5CAB2_BCL2L11      --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
A0A2K5CAB2_BCL2L11      --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
A0A2K6TRZ5_BCL2L11      --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
A0A2K6TRZ5_BCL2L11      --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
A0A2K5CAB2_BCL2L11      --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
A0A2K6TRZ5_BCL2L11      --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
F6XMC1_BCL2L11-05       --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
F6XMC1_BCL2L11-07       --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
A0A2K5CAB2_BCL2L11      --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
A0A2K6TRZ5_BCL2L11      --gcttccatgaggcaatctca-ggctgaacctgcaggtatgcgcccgga
H2P5E2_BCL2L11-01       --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6E226_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --gcttccatgaggca-------ggctgaacctgcagatatgcgcccaga
O43521_BCL2L11-03       --gcttccatgaggca-------ggctgaacctgcagatatgcgcccaga
A0A2J8JCT2_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgaccgga
A0A2J8JCT2_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgaccgga
A0A2I3HW02_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
A0A2R9CA99_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
A0A2I2YQ13_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
A0A2R9CA99_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
A0A2I3M6I1_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2I3M6I1_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2I3M6I1_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5X2I7_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6E226_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6E226_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5Z8B6_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5NU92_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5X2I7_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6E226_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5Z8B6_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5HZI7_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6QIL2_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6QIL2_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6QIL2_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6KJP8_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6KJP8_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
Q6JTU4_BCL2L11-01       -----------aggca-------ggctgaacctgcagatatgcgcccaga
O43521_BCL2L11-25       --gcttccatgaggca-------ggctgaacctgcagatatgcgcccaga
O43521_BCL2L11-05       --gcttccatgaggca-------ggctgaacctgcagatatgcgcccaga
O43521_BCL2L11-18       --gcttccatgaggca-------ggctgaacctgcagatatgcgcccaga
O43521_BCL2L11-10       --gcttccatgaggca-------ggctgaacctgcagatatgcgcccaga
O43521_BCL2L11-20       --gcttccatgaggca-------ggctgaacctgcagatatgcgcccaga
O43521_BCL2L11-09       --gcttccatgaggca-------ggctgaacctgcagatatgcgcccaga
O43521_BCL2L11-16       --gcttccatgaggca-------ggctgaacctgcagatatgcgcccaga
A0A2K6KJP8_BCL2L11      --gtt------------------------------------------aga
A0A2K6QIL2_BCL2L11      --gtt------------------------------------------aga
A0A2K5HZI7_BCL2L11      --gtt------------------------------------------aga
O43521_BCL2L11-22       --gtt------------------------------------------aga
O43521_BCL2L11-08       --gtt------------------------------------------aga
A0A2I2YQ13_BCL2L11      --gtt------------------------------------------aga
A0A2I3HW02_BCL2L11      --gtt------------------------------------------aga
A0A2R9CA99_BCL2L11      --gtt------------------------------------------aga
A0A2J8JCT2_BCL2L11      --gtt------------------------------------------aga
A0A2K5NU92_BCL2L11      --gtt------------------------------------------aga
A0A2K5X2I7_BCL2L11      --gtt------------------------------------------aga
F7HHA9_BCL2L11-03       --gtt------------------------------------------aga
A0A2K6E226_BCL2L11      --gtt------------------------------------------aga
A0A2K5Z8B6_BCL2L11      --gtt------------------------------------------aga
A0A2I3M6I1_BCL2L11      --gtt------------------------------------------aga
O43521_BCL2L11-19       --gtt------------------------------------------aga
O43521_BCL2L11-07       --gtt------------------------------------------aga
A0A2I2YQ13_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
A0A2R9CA99_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
A0A2J8JCT2_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgaccgga
A0A2J8JCT2_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgaccgga
A0A2I2YQ13_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
A0A2R9CA99_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
A0A2I3HW02_BCL2L11      --gcttccatgaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6KJP8_BCL2L11      --gctaactgg---------------------------------------
A0A2K6QIL2_BCL2L11      --gctaactgg---------------------------------------
O43521_BCL2L11-12       --gctaactgg---------------------------------------
O43521_BCL2L11-24       --gctaactgg---------------------------------------
A0A2I2YQ13_BCL2L11      --gctaactgg---------------------------------------
A0A2I3HW02_BCL2L11      --gctaactgg---------------------------------------
A0A2R9CA99_BCL2L11      --gctaactgg---------------------------------------
A0A2J8JCT2_BCL2L11      --gctaactgg---------------------------------------
A0A2K5NU92_BCL2L11      --gctaactgg---------------------------------------
A0A2K5X2I7_BCL2L11      --gctaactgg---------------------------------------
F7HHA9_BCL2L11-06       --gctaactgg---------------------------------------
A0A2K6E226_BCL2L11      --gctaactgg---------------------------------------
A0A2K5Z8B6_BCL2L11      --gctaactgg---------------------------------------
A0A2I3M6I1_BCL2L11      --gctaactgg---------------------------------------
A0A2K5HZI7_BCL2L11      --gctaactgg---------------------------------------
A0A2K6KJP8_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6QIL2_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5HZI7_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5NU92_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5X2I7_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
F7HHA9_BCL2L11-04       --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6E226_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5Z8B6_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2I3M6I1_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A0D9RWE0_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5NU92_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5X2I7_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
F7HHA9_BCL2L11-02       --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6E226_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5Z8B6_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2I3M6I1_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6KJP8_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K6QIL2_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2K5HZI7_BCL2L11      --gcttccaggaggca-------ggctgaacctgcagatatgcgcccgga
A0A2I3HW02_BCL2L11      --g-----atgaggc--------cgctggatcctc---------------
A0A2I2YQ13_BCL2L11      --g-----atgactc--------cgctggatcctc---------------
O43521_BCL2L11-23       --g-----atgactc--------cgctggatcctc---------------
A0A2R9CA99_BCL2L11      --g-----atgactc--------cgctggatcctc---------------
A0A2J8JCT2_BCL2L11      --g-----atgactc--------cgctggatcctc---------------
A0A2I3M6I1_BCL2L11      --g-----atgaggc--------cactggatcctc---------------
A0A2K5X2I7_BCL2L11      --g-----atgaggc--------cactggatcctc---------------
F7HHA9_BCL2L11-07       --g-----atgaggc--------cactggatcctc---------------
A0A2K5HZI7_BCL2L11      --g-----atgaggc--------cactggatcctc---------------
A0A2K5NU92_BCL2L11      --g-----atgaggc--------cactggatcctc---------------
A0A2K5Z8B6_BCL2L11      --g-----atgaggc--------cactggatcctc---------------
A0A2K5CAB2_BCL2L11      --g-----atgaggc--------cactgaatcctc---------------
A0A2K6TRZ5_BCL2L11      --g-----atgaggc--------cactggatcctc---------------
G3SU55_BCL2L11-01       --gcttccatgaggcagtctca-ggctctacctgcagacctgcgcccgga
M3YDI3_BCL2L11-01       --gcttccaggaggcagtctca-ggctgtacctgcagatatgcgcccgga
A0A337SW42_BCL2L11      ---cttccatgaggcagcctca-ggctgtacccgcagatatgcgcccgga
G1LDR8_BCL2L11-01       --gcttccatgaggcagtctca-ggctgtacctgccgatatgcgcccgga
J9NWV6_BCL2L11-01       --gcttccatgaggcagtctca-ggctgtacctgcagatatgcgcccgga
A0A337SW42_BCL2L11      --gtt------------------------------------------aga
A0A337SW42_BCL2L11      --gcttccatgaggcagcctca-ggctgtacccgcagatatgcgcccgga
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --gcttccatgaggcagcctca-ggctgtacccgcagatatgcgcccgga
A0A337SW42_BCL2L11      --gcttccatgaggcagcctca-ggctgtacccgcagatatgcgcccgga

B2KKY9_BCL2L11-01       gatggtggtcgctcgtgaactgcga--------------------cgcat
B8JK68_BCL2L11-01       gatggtggtcgctcgtgaactgcga--------------------cgcat
Q4KMV9_BCL2L11-01       actgtggatagcacaggaactccgg--------------------cggat
M3XHJ5_BCL2L11-01       aa-------------------------------------------ctcat
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       aatatggattgcacaggaattacgg--------------------cgcat
F7FTC8_BCL2L11-01       aatatggattgcccaggagttacgg--------------------cgaat
G1MV54_BCL2L11-01       aatatggattgcacaggagctgcgg--------------------cgcat
K7GA86_BCL2L11-01       aatatggattgcacaggagctgcgg--------------------cgaat
G1PDJ5_BCL2L11-01       gatgtggatcgctcaggagctgcgg--------------------cggat
F7CXT2_BCL2L11-01       aatttggattgcacaagaattgcgc--------------------cgtat
G3W979_BCL2L11-01       aatttggattgcacaagaattgcga--------------------cgtat
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       gatatggattgcccaagagctacgg--------------------cgtat
W5PY58_BCL2L11-01       gatatggattgctcaagagctacgg--------------------cgtat
A0A1U8BW10_BCL2L11      gatatggattgcacaggagcttcgg--------------------cggat
A0A1U8BW10_BCL2L11      gatatggattgcacaggagcttcgg--------------------cggat
A0A1U8BW10_BCL2L11      -------------cacgag---tgg--------------------cagat
O54918_BCL2L11-03       ----------------------tgg--------------------agaat
O88498_BCL2L11-01       gatacggatcgcacaggagctgcgg--------------------cggat
O88498_BCL2L11-02       gatacggatcgcacaggagctgcgg--------------------cggat
O54918_BCL2L11-01       gatacggattgcacaggagctgcgg--------------------cggat
O54918_BCL2L11-05       gatacggattgcacaggagctgcgg--------------------cggat
O54918_BCL2L11-06       gatacggattgcacaggagctgcgg--------------------cggat
O54918_BCL2L11-08       gatacggattgcacaggagctgcgg--------------------cggat
G1SSY0_BCL2L11-01       gacctggatcgcgcaggagttgcgg--------------------cggat
A0A286XJN2_BCL2L11      gatatggatcgcacaggaattgcgt--------------------cgcat
A0A286XJN2_BCL2L11      gatatggatcgcacaggaattgcgt--------------------cgcat
A0A286XJN2_BCL2L11      gatatggatcgcacaggaattgcgt--------------------cgcat
F7A7D2_BCL2L11-01       ggtatggatcgctcaagagctgcgg--------------------agaat
F1SU81_BCL2L11-01       gatatggattgcgcaggagttacgg--------------------cgtat
C1KGB8_BCL2L11-01       gatatggattgcgcaggagttacgg--------------------cgtat
F1SU81_BCL2L11-02       gatatggattgcgcaggagttacgg--------------------cgtat
F1SU81_BCL2L11-03       gatatggattgcgcaggagttacgg--------------------cgtat
A0A287DFJ0_BCL2L11      gatctggatcgcgcaggagctgcgg--------------------cgaat
A0A287DFJ0_BCL2L11      gatctggatcgcgcaggagctgcgg--------------------cgaat
H0XW23_BCL2L11-01       gatgtggatcgcccaagagttgcgg--------------------cgtat
A0A1S3FHA8_BCL2L11      gatatggatcgcccaggaattgcgg--------------------cgtat
A0A1S3FHA8_BCL2L11      gatatggatcgcccaggaattgcgg--------------------cgtat
A0A2K6GE31_BCL2L11      gatatggatcgcgcaggagttgcgg--------------------cgtat
A0A2K6GE31_BCL2L11      gaaataga------------------------------------------
A0A2K6GE31_BCL2L11      gatatggatcgcgcaggagttgcgg--------------------cgtat
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      gatatggatcgcgcaggagttgcgg--------------------cgtat
A0A2K6GE31_BCL2L11      gatatggatcgcgcaggagttgcgg--------------------cgtat
A0A2I3HW02_BCL2L11      tatatttactggcttagatttgtatg---------------gccac-cac
A0A2R9CA99_BCL2L11      tatatttactggcttagatttgtatg---------------gccac-cac
A0A2J8JCT2_BCL2L11      tatatttactggcttagatttgtatg---------------gccac-cac
A0A2I2YQ13_BCL2L11      tatatttactggcttagatttgtatg---------------gccac-cac
O43521_BCL2L11-06       tatatttactggcttagatttgtatg---------------gccac-cac
O43521_BCL2L11-15       tatatttactggcttagatttgtatg---------------gccac-cac
A0A2K5X2I7_BCL2L11      tatatttactggcttagatttgtatg---------------gccac-cac
F7HHA9_BCL2L11-09       tatatttactggcttagatttgtatg---------------gccac-cac
A0A2K6E226_BCL2L11      tatatttactggcttagatttgtatg---------------gccac-cac
A0A2K5NU92_BCL2L11      tatatttactggcttagatttgtatg---------------gccac-cac
A0A2K5Z8B6_BCL2L11      tatatttactggcttagatttgtatg---------------gccac-cac
A0A2I3M6I1_BCL2L11      tatatttactggcttagatttgtatg---------------gccac-cac
A0A2K5HZI7_BCL2L11      tatatttactggcttagatttgtatg---------------gccac-cac
A0A2K6KJP8_BCL2L11      tatatttactggcttagatttgtatgtggtttggatttatatttac-cac
A0A2K6QIL2_BCL2L11      tatatttactggcttagatttgtatgtggtttggatttatatttac-cac
F6XMC1_BCL2L11-09       tacatttaccttctttgatttgtgtg---------------gccac-cac
A0A2K5CAB2_BCL2L11      tatatttaccttctttgatttgtatg---------------gccac-cac
A0A2K6TRZ5_BCL2L11      tatatttaccttctttgatttgtatg---------------gctac-cac
A0A2K5NU92_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5X2I7_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
F7HHA9_BCL2L11-05       gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5Z8B6_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5HZI7_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6QIL2_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6KJP8_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
O43521_BCL2L11-13       gatatggatcgcccaagagttgcgg--------------------cgtat
O43521_BCL2L11-17       gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2J8JCT2_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2I3HW02_BCL2L11      gatatggattgcccaagagttgcgg--------------------cgtat
A0A2I2YQ13_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2R9CA99_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
F6XMC1_BCL2L11-01       gatatggatcgcccaagagttgcgg--------------------cgtat
F6XMC1_BCL2L11-02       gatatggatcgcccaagagttgcgg--------------------cgtat
F6XMC1_BCL2L11-06       ---------------agagaaatag-------------------------
A0A2K5CAB2_BCL2L11      ---------------agagaaatag-------------------------
A0A2K6TRZ5_BCL2L11      ---------------agagaaatag-------------------------
F6XMC1_BCL2L11-08       agtgaggggcatcggggagaagcaggaagaacgtgtgaacccacacacat
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2K5CAB2_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2K5CAB2_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2K6TRZ5_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2K6TRZ5_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2K5CAB2_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2K6TRZ5_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
F6XMC1_BCL2L11-05       gatatggatcgcccaagagttgcgg--------------------cgtat
F6XMC1_BCL2L11-07       gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2K5CAB2_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2K6TRZ5_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
H2P5E2_BCL2L11-01       gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2K6E226_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       gatatggatcgcccaagagttgcgg--------------------cgtat
O43521_BCL2L11-03       gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2J8JCT2_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2J8JCT2_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2I3HW02_BCL2L11      gatatggattgcccaagagttgcgg--------------------cgtat
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2R9CA99_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2I2YQ13_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2R9CA99_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2I3M6I1_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2I3M6I1_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2I3M6I1_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5X2I7_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6E226_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6E226_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5Z8B6_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5NU92_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5X2I7_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6E226_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5Z8B6_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5HZI7_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6QIL2_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6QIL2_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6QIL2_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6KJP8_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6KJP8_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
Q6JTU4_BCL2L11-01       gatatggatcgcccaagagttgcgg--------------------cgtat
O43521_BCL2L11-25       gatatggatcgcccaagagttgcgg--------------------cgtat
O43521_BCL2L11-05       gatatggatcgcccaagagttgcgg--------------------cgtat
O43521_BCL2L11-18       gatatggatcgcccaagagttgcgg--------------------cgtat
O43521_BCL2L11-10       gatatggatcgcccaagagttgcgg--------------------cgtat
O43521_BCL2L11-20       gatatggatcgcccaagagttgcgg--------------------cgtat
O43521_BCL2L11-09       gatatggatcgcccaagagttgcgg--------------------cgtat
O43521_BCL2L11-16       gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2K6KJP8_BCL2L11      gaaatag-------------------------------------------
A0A2K6QIL2_BCL2L11      gaaatag-------------------------------------------
A0A2K5HZI7_BCL2L11      gaaatag-------------------------------------------
O43521_BCL2L11-22       gaaatag-------------------------------------------
O43521_BCL2L11-08       gaaatag-------------------------------------------
A0A2I2YQ13_BCL2L11      gaaatag-------------------------------------------
A0A2I3HW02_BCL2L11      gaaatag-------------------------------------------
A0A2R9CA99_BCL2L11      gaaatag-------------------------------------------
A0A2J8JCT2_BCL2L11      gaaatag-------------------------------------------
A0A2K5NU92_BCL2L11      gaaatag-------------------------------------------
A0A2K5X2I7_BCL2L11      gaaatag-------------------------------------------
F7HHA9_BCL2L11-03       gaaatag-------------------------------------------
A0A2K6E226_BCL2L11      gaaatag-------------------------------------------
A0A2K5Z8B6_BCL2L11      gaaatag-------------------------------------------
A0A2I3M6I1_BCL2L11      gaaatag-------------------------------------------
O43521_BCL2L11-19       gaaatag-------------------------------------------
O43521_BCL2L11-07       gaaatag-------------------------------------------
A0A2I2YQ13_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2R9CA99_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2J8JCT2_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2J8JCT2_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2I2YQ13_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2R9CA99_BCL2L11      gatatggatcgcccaagagttgcgg--------------------cgtat
A0A2I3HW02_BCL2L11      gatatggattgcccaagagttgcgg--------------------cgtat
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6QIL2_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5HZI7_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5NU92_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5X2I7_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
F7HHA9_BCL2L11-04       gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6E226_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5Z8B6_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2I3M6I1_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A0D9RWE0_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5NU92_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5X2I7_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
F7HHA9_BCL2L11-02       gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6E226_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5Z8B6_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2I3M6I1_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6KJP8_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K6QIL2_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2K5HZI7_BCL2L11      gatacggatcgcccaagagttgcgg--------------------cgaat
A0A2I3HW02_BCL2L11      -----------cctc-----------------------------------
A0A2I2YQ13_BCL2L11      -----------cctcagaattg-----------------------ccctt
O43521_BCL2L11-23       -----------cctcagaattg-----------------------ccctt
A0A2R9CA99_BCL2L11      -----------cctcagaattg-----------------------ccctt
A0A2J8JCT2_BCL2L11      -----------cctcagaattg-----------------------ccctt
A0A2I3M6I1_BCL2L11      -----------cctcggaattg-----------------------ccctt
A0A2K5X2I7_BCL2L11      -----------cctcggaattg-----------------------ccctt
F7HHA9_BCL2L11-07       -----------cctcggaattg-----------------------ccctt
A0A2K5HZI7_BCL2L11      -----------cctcagaattg-----------------------ccctt
A0A2K5NU92_BCL2L11      -----------cctcagaattg-----------------------ccctt
A0A2K5Z8B6_BCL2L11      -----------cctcggaattg-----------------------ccctt
A0A2K5CAB2_BCL2L11      -----------ccttggaattg-----------------------ccctt
A0A2K6TRZ5_BCL2L11      -----------cc------ttg-----------------------ccctt
G3SU55_BCL2L11-01       gatctggattgcgcgagagctacgg--------------------cgcat
M3YDI3_BCL2L11-01       gatgtggattgcgcaggagttgcgg--------------------cgtat
A0A337SW42_BCL2L11      gatatggattgcacaagagttgcgg--------------------cgtat
G1LDR8_BCL2L11-01       gatatggattgcgcaagagttgcgg--------------------cgtat
J9NWV6_BCL2L11-01       gatatggattgcacaagagttgcgg--------------------cgtat
A0A337SW42_BCL2L11      gcaatag-------------------------------------------
A0A337SW42_BCL2L11      gatatggattgcacaagagttgcgg--------------------cgtat
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      gatatggattgcacaagagttgcgg--------------------cgtat
A0A337SW42_BCL2L11      gatatggattgcacaagagttgcgg--------------------cgtat

B2KKY9_BCL2L11-01       aggcgat---------gagttcaatcgcctctactgtgaggccggagcag
B8JK68_BCL2L11-01       aggcgat---------gagttcaatcgcctctactgtgaggccggagcag
Q4KMV9_BCL2L11-01       tggggat---------gactttaatgcatcatt---cagtccaagaaggg
M3XHJ5_BCL2L11-01       ggtaa-----------gaaccctttgaacttta-----------------
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       cggagat---------gaattcaatgcttccca---ctgtccaagaaggg
F7FTC8_BCL2L11-01       tggagat---------gagtttaacgcttccta---ttgtccaagaaggg
G1MV54_BCL2L11-01       cggggat---------gaattcaatgcctccta---ttgtccaagaaggg
K7GA86_BCL2L11-01       tggagat---------gagtttaatgcctctta---ctgcccaagaaggg
G1PDJ5_BCL2L11-01       cggggac---------gagttcaacaactcctaccgcaacccacggaggg
F7CXT2_BCL2L11-01       tggagat---------gaatttaatg---cttcctattatccaagaaggg
G3W979_BCL2L11-01       tggagat---------gaatttaatg---cttc---ttatccaagaaggg
O43521_BCL2L11-11       -----------------------------------------caagtag--
F7HHA9_BCL2L11-08       -----------------------------------------caagtag--
Q2YDF0_BCL2L11-01       cggagac---------gagtttaatg---cata---ttacccaagaaggg
W5PY58_BCL2L11-01       cggagac---------gagtttaatg---cgta---ttatccaagaaggg
A0A1U8BW10_BCL2L11      tggagac---------gagttcaacg---aatc---ttacagaaggaggg
A0A1U8BW10_BCL2L11      tggagac---------gagttcaacg---aatc---ttacagaaggaggg
A0A1U8BW10_BCL2L11      tcatggt---------ga--tcaa------------------------ag
O54918_BCL2L11-03       cttaacc---------aagtggcaca---aaat---atccacggtga---
O88498_BCL2L11-01       cggagac---------gagttcaatg---agac---ttacacgaggaggg
O88498_BCL2L11-02       cggagac---------gagttcaatg---agac---ttacacgaggaggg
O54918_BCL2L11-01       cggagac---------gagttcaacg---aaac---ttacacaaggaggg
O54918_BCL2L11-05       cggagac---------gagttcaacg---aaac---ttacacaaggaggg
O54918_BCL2L11-06       cggagac---------gagttcaacg---aaac---ttacacaaggaggg
O54918_BCL2L11-08       cggagac---------gagttcaacg---aaac---ttacacaaggaggg
G1SSY0_BCL2L11-01       cggagac---------gagttcaacg---cgta---ttacccacgcaggg
A0A286XJN2_BCL2L11      cggagat---------gagtttaatg---cctc---gtacccaaggcggg
A0A286XJN2_BCL2L11      cggagat---------gagtttaatg---cctc---gtacccaaggcggg
A0A286XJN2_BCL2L11      cggagat---------gagtttaatg---cctc---gtacccaaggcggg
F7A7D2_BCL2L11-01       tggagac---------gaatttaatg---cctc---ttacccacggaggg
F1SU81_BCL2L11-01       tggagac---------gaatttaatg---cata---ttacccaaggaggg
C1KGB8_BCL2L11-01       tggagac---------gaatttaatg---cata---ttacccaaggaggg
F1SU81_BCL2L11-02       tggagac---------gaatttaatg---cata---ttacccaaggaggg
F1SU81_BCL2L11-03       tggagac---------gaatttaatg---cata---ttacccaaggaggg
A0A287DFJ0_BCL2L11      cggagat---------gagtttaacc---tgta---ttacccacggaggg
A0A287DFJ0_BCL2L11      cggagat---------gagtttaacc---tgta---ttacccacggaggg
H0XW23_BCL2L11-01       tggagac---------gagtttaacg---ctta---ctacccaacgaggg
A0A1S3FHA8_BCL2L11      tggagac---------gagtttgatg---ccta---ttatccaaggaggg
A0A1S3FHA8_BCL2L11      tggagac---------gagtttgatg---ccta---ttatccaaggaggg
A0A2K6GE31_BCL2L11      tggagat---------gagtttaacg---ctta---ttacccaaggaggc
A0A2K6GE31_BCL2L11      -----------------------------------------------gga
A0A2K6GE31_BCL2L11      tggagat---------gagtttaacg---ctta---ttacccaaggagga
A0A2K6GE31_BCL2L11      -----------------------------------------------ggg
A0A2K6GE31_BCL2L11      tggagat---------gagtttaacg---ctta---ttacccaaggaggg
A0A2K6GE31_BCL2L11      tggagat---------gagtttaacg---ctta---ttacccaaggaggg
A0A2I3HW02_BCL2L11      catagtc---------aagatacaga---acaa---ttcaaccacaagga
A0A2R9CA99_BCL2L11      catagtc---------aagatgcaga---acaa---ctcaaccacaagga
A0A2J8JCT2_BCL2L11      catagtc---------aagatgcaga---acaa---ctcaaccacaagga
A0A2I2YQ13_BCL2L11      catagtc---------aagatacaga---acaa---ctcaaccacaagga
O43521_BCL2L11-06       catagtc---------aagatacaga---acaa---ctcaaccacaagga
O43521_BCL2L11-15       catagtc---------aagatacaga---acaa---ctcaaccacaagga
A0A2K5X2I7_BCL2L11      cacagtc---------aagatacaga---acaa---ctcaaccacaagga
F7HHA9_BCL2L11-09       cacagtc---------aagatacaga---acaa---ctcaaccacaagga
A0A2K6E226_BCL2L11      cacagtc---------aagatacaga---acaa---ctcaaccacaagga
A0A2K5NU92_BCL2L11      cacagtc---------aagatacaga---acaa---ctcaaccacaagga
A0A2K5Z8B6_BCL2L11      cacagtc---------aagatacaga---acaa---ctcaaccacaagga
A0A2I3M6I1_BCL2L11      cacagtc---------aagatacaga---acaa---ctcaaccacaagga
A0A2K5HZI7_BCL2L11      cacagtc---------aagatacaga---acaa---ctcaaccacaggga
A0A2K6KJP8_BCL2L11      cacagtc---------aagatacaga---acaa---ctcaaccacaggga
A0A2K6QIL2_BCL2L11      cacagtc---------aagatacaga---acaa---ctcaaccacaggga
F6XMC1_BCL2L11-09       cacagtc---------aaggtacaga---acaa------cagcacaagga
A0A2K5CAB2_BCL2L11      cacagtc---------aaggtacaga---acaa---ctccaccacaagta
A0A2K6TRZ5_BCL2L11      cacagtc---------aaggtacaga---acaa---ctccaccacaagta
A0A2K5NU92_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2K5X2I7_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
F7HHA9_BCL2L11-05       cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2K5Z8B6_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2K5HZI7_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2K6QIL2_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2K6KJP8_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
O43521_BCL2L11-13       tggagac---------gagtttaacg---ctta---ctatgcaaggaggc
O43521_BCL2L11-17       tggagac---------gagtttaacg---ctta---ctatgcaaggaggc
A0A2J8JCT2_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggc
A0A2I3HW02_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggc
A0A2I2YQ13_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggc
A0A2R9CA99_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggc
F6XMC1_BCL2L11-01       cggagac---------gagtttaacg---ctta---ttatccaaggaggg
F6XMC1_BCL2L11-02       cggagac---------gagtttaacg---ctta---ttatccaaggaggg
F6XMC1_BCL2L11-06       -------------------------------------------aggaagt
A0A2K5CAB2_BCL2L11      -------------------------------------------aggaagt
A0A2K6TRZ5_BCL2L11      -------------------------------------------aggaagt
F6XMC1_BCL2L11-08       gggagaccttcaaaagcaccagaact---caca---gtctttcagcacgt
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       -----------------------------------------------ggg
F6XMC1_BCL2L11-03       cggagac---------gagtttaacg---ctta---ttatccaaggaggg
A0A2K5CAB2_BCL2L11      -----------------------------------------------ggg
A0A2K5CAB2_BCL2L11      cggagac---------gagtttaacg---ctta---ttatccaaggaggg
A0A2K5CAB2_BCL2L11      cggagac---------gagtttaacg---ctta---ttatccaaggaggg
A0A2K5CAB2_BCL2L11      cggagac---------gagtttaacg---ctta---ttatccaaggaggg
A0A2K6TRZ5_BCL2L11      -----------------------------------------------ggg
A0A2K6TRZ5_BCL2L11      cggagac---------gagtttaacg---ctta---ttatccaaggaggg
A0A2K6TRZ5_BCL2L11      cggagac---------gagtttaacg---ctta---ttatccaaggaggg
A0A2K6TRZ5_BCL2L11      cggagac---------gagtttaacg---ctta---ttatccaaggaggg
A0A2K5CAB2_BCL2L11      cggagac---------gagtttaacg---ctta---ttatccaaggagga
A0A2K6TRZ5_BCL2L11      cggagac---------gagtttaacg---ctta---ttatccaaggagga
F6XMC1_BCL2L11-05       cggagac---------gagtttaacg---ctta---ttatccaaggagga
F6XMC1_BCL2L11-07       cggagac---------gagtttaacg---ctta---ttatccaaggagg-
A0A2K5CAB2_BCL2L11      cggagac---------gagtttaacg---ctta---ttatccaaggagg-
A0A2K6TRZ5_BCL2L11      cggagac---------gagtttaacg---ctta---ttatccaaggagg-
H2P5E2_BCL2L11-01       cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K6E226_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
O43521_BCL2L11-21       -----------------------------------------------ggg
O43521_BCL2L11-02       tggagac---------gagtttaacg---ctta---ctatgcaaggaggg
O43521_BCL2L11-03       tggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2J8JCT2_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2J8JCT2_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2I3HW02_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2I2YQ13_BCL2L11      -----------------------------------------------ggg
A0A2I3HW02_BCL2L11      -----------------------------------------------ggg
A0A2R9CA99_BCL2L11      -----------------------------------------------ggg
A0A2J8JCT2_BCL2L11      -----------------------------------------------ggg
A0A2I2YQ13_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2R9CA99_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2I2YQ13_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2R9CA99_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2I3M6I1_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2I3M6I1_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2I3M6I1_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K5NU92_BCL2L11      -----------------------------------------------ggg
A0A2K5X2I7_BCL2L11      -----------------------------------------------ggg
F7HHA9_BCL2L11-01       -----------------------------------------------ggg
A0A2K6E226_BCL2L11      -----------------------------------------------ggg
A0A2K5Z8B6_BCL2L11      -----------------------------------------------ggg
A0A2I3M6I1_BCL2L11      -----------------------------------------------ggg
A0A2K5NU92_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K5X2I7_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K6E226_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K6E226_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K5Z8B6_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K5NU92_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K5X2I7_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K6E226_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K5Z8B6_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K5HZI7_BCL2L11      -----------------------------------------------ggg
A0A2K5HZI7_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K5HZI7_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K6QIL2_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K6QIL2_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K6QIL2_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K6KJP8_BCL2L11      -----------------------------------------------ggg
A0A2K6QIL2_BCL2L11      -----------------------------------------------ggg
A0A2K6KJP8_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K6KJP8_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
A0A2K6KJP8_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggg
Q6JTU4_BCL2L11-01       cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
O43521_BCL2L11-25       tggagac---------gagtttaacg---ctta---ctatgcaaggaggt
O43521_BCL2L11-05       tggagac---------gagtttaacg---ctta---ctatgcaaggaggt
O43521_BCL2L11-18       tggagac---------gagtttaacg---ctta---ctatgcaaggaggt
O43521_BCL2L11-10       tggagac---------gagtttaacg---ctta---ctatgcaaggagga
O43521_BCL2L11-20       tggagac---------gagtttaacg---ctta---ctatgcaaggagga
O43521_BCL2L11-09       tggagac---------gagtttaacg---ctta---ctatgcaaggagga
O43521_BCL2L11-16       tggagac---------gagtttaacg---ctta---ctatgcaaggagga
A0A2K6KJP8_BCL2L11      -------------------------------------------aggaagt
A0A2K6QIL2_BCL2L11      -------------------------------------------aggaagt
A0A2K5HZI7_BCL2L11      -------------------------------------------aggaagt
O43521_BCL2L11-22       -------------------------------------------aggaagt
O43521_BCL2L11-08       -------------------------------------------aggaagt
A0A2I2YQ13_BCL2L11      -------------------------------------------aggaagt
A0A2I3HW02_BCL2L11      -------------------------------------------aggaagt
A0A2R9CA99_BCL2L11      -------------------------------------------aggaagt
A0A2J8JCT2_BCL2L11      -------------------------------------------aggaagt
A0A2K5NU92_BCL2L11      -------------------------------------------aggaagt
A0A2K5X2I7_BCL2L11      -------------------------------------------aggaagt
F7HHA9_BCL2L11-03       -------------------------------------------aggaagt
A0A2K6E226_BCL2L11      -------------------------------------------aggaagt
A0A2K5Z8B6_BCL2L11      -------------------------------------------aggaagt
A0A2I3M6I1_BCL2L11      -------------------------------------------aggaagt
O43521_BCL2L11-19       -------------------------------------------aggaagt
O43521_BCL2L11-07       -------------------------------------------aggaagt
A0A2I2YQ13_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggagga
A0A2R9CA99_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggagga
A0A2J8JCT2_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggagga
A0A2J8JCT2_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2I2YQ13_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2R9CA99_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2I3HW02_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2K6QIL2_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2K5HZI7_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2K5NU92_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2K5X2I7_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
F7HHA9_BCL2L11-04       cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2K6E226_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2K5Z8B6_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2I3M6I1_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A0D9RWE0_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggaggt
A0A2K5NU92_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggagga
A0A2K5X2I7_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggagga
F7HHA9_BCL2L11-02       cggagac---------gagtttaacg---ctta---ctatgcaaggagga
A0A2K6E226_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggagga
A0A2K5Z8B6_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggagga
A0A2I3M6I1_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggagga
A0A2K6KJP8_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggagga
A0A2K6QIL2_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggagga
A0A2K5HZI7_BCL2L11      cggagac---------gagtttaacg---ctta---ctatgcaaggagga
A0A2I3HW02_BCL2L11      ------g---------aagttcagtg---gcca---ttc----gagtggt
A0A2I2YQ13_BCL2L11      cataggg---------aagttcagtg---gcca---ctc----gagtggt
O43521_BCL2L11-23       cataggg---------aagttcagtg---gcca---ctc----aagtggt
A0A2R9CA99_BCL2L11      cataggg---------aagttcagtg---gcca---ctc----aagtggt
A0A2J8JCT2_BCL2L11      cataggg---------aagttcagtg---gcca---ctc----aagtggt
A0A2I3M6I1_BCL2L11      cataggg---------aagttcagtg---gcca---ctg----gaatggt
A0A2K5X2I7_BCL2L11      cataggg---------aagttcagtg---gccg---ctc----gagtggt
F7HHA9_BCL2L11-07       cataggg---------aagttcagtg---gccg---ctc----gagtggt
A0A2K5HZI7_BCL2L11      cataggg---------aagttcagta---g--------------------
A0A2K5NU92_BCL2L11      cataggg---------aagttcagtg---gccg---ctc----gaatgct
A0A2K5Z8B6_BCL2L11      cataggg---------aagttcagtg---gccg---ctc----gaatgct
A0A2K5CAB2_BCL2L11      cgtaggg---------aggttcagtg---gcca---ctt----gagtggt
A0A2K6TRZ5_BCL2L11      cgtaggg---------aggttcagtg---ccca---ctt----gagtggt
G3SU55_BCL2L11-01       tggagac---------gaattcaatg---ccta---ctacccaaggaggg
M3YDI3_BCL2L11-01       tggagac---------gagtttaatg---cgta---ttacccaaggaggg
A0A337SW42_BCL2L11      cggagac---------gaatttaatg---cata---ttacccaaggagg-
G1LDR8_BCL2L11-01       tggagac---------gaatttaatg---cata---ttacccaaggaggg
J9NWV6_BCL2L11-01       tggagac---------gaatttaatg---cata---ttacccaaggaggg
A0A337SW42_BCL2L11      -------------------------------------------aggaagg
A0A337SW42_BCL2L11      cggagac---------gaatttaatg---cata---ttacccaaggagg-
A0A337SW42_BCL2L11      -----------------------------------------------ggg
A0A337SW42_BCL2L11      cggagac---------gaatttaatg---cata---ttacccaaggaggg
A0A337SW42_BCL2L11      cggagac---------gaatttaatg---cata---ttacccaaggaggg

B2KKY9_BCL2L11-01       ga------------------------------------------------
B8JK68_BCL2L11-01       ga------------------------------------------------
Q4KMV9_BCL2L11-01       gc------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       gt------------------------------------------------
F7FTC8_BCL2L11-01       gt------------------------------------------------
G1MV54_BCL2L11-01       gt------------------------------------------------
K7GA86_BCL2L11-01       gt------------------------------------------------
G1PDJ5_BCL2L11-01       ac------------------------------------------------
F7CXT2_BCL2L11-01       gg------------------------------------------------
G3W979_BCL2L11-01       gt------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       tc------------------------------------------------
W5PY58_BCL2L11-01       tc------------------------------------------------
A0A1U8BW10_BCL2L11      t-------------------------------------------------
A0A1U8BW10_BCL2L11      t-------------------------------------------------
A0A1U8BW10_BCL2L11      t-------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       cg------------------------------------------------
O88498_BCL2L11-02       cg------------------------------------------------
O54918_BCL2L11-01       tg------------------------------------------------
O54918_BCL2L11-05       tg------------------------------------------------
O54918_BCL2L11-06       tg------------------------------------------------
O54918_BCL2L11-08       tg------------------------------------------------
G1SSY0_BCL2L11-01       tt------------------------------------------------
A0A286XJN2_BCL2L11      tg------------------------------------------------
A0A286XJN2_BCL2L11      tg------------------------------------------------
A0A286XJN2_BCL2L11      tg------------------------------------------------
F7A7D2_BCL2L11-01       tc------------------------------------------------
F1SU81_BCL2L11-01       tc------------------------------------------------
C1KGB8_BCL2L11-01       ta------------------------------------------------
F1SU81_BCL2L11-02       ta------------------------------------------------
F1SU81_BCL2L11-03       ta------------------------------------------------
A0A287DFJ0_BCL2L11      ta------------------------------------------------
A0A287DFJ0_BCL2L11      ta------------------------------------------------
H0XW23_BCL2L11-01       ta------------------------------------------------
A0A1S3FHA8_BCL2L11      ta------------------------------------------------
A0A1S3FHA8_BCL2L11      ta------------------------------------------------
A0A2K6GE31_BCL2L11      tg------------------------------------------------
A0A2K6GE31_BCL2L11      ag------------------------------------------------
A0A2K6GE31_BCL2L11      tg------------------------------------------------
A0A2K6GE31_BCL2L11      ta------------------------------------------------
A0A2K6GE31_BCL2L11      ta------------------------------------------------
A0A2K6GE31_BCL2L11      ta------------------------------------------------
A0A2I3HW02_BCL2L11      tt------------------------------------------------
A0A2R9CA99_BCL2L11      tt------------------------------------------------
A0A2J8JCT2_BCL2L11      tt------------------------------------------------
A0A2I2YQ13_BCL2L11      tt------------------------------------------------
O43521_BCL2L11-06       tt------------------------------------------------
O43521_BCL2L11-15       tt------------------------------------------------
A0A2K5X2I7_BCL2L11      tt------------------------------------------------
F7HHA9_BCL2L11-09       tt------------------------------------------------
A0A2K6E226_BCL2L11      tt------------------------------------------------
A0A2K5NU92_BCL2L11      tt------------------------------------------------
A0A2K5Z8B6_BCL2L11      tt------------------------------------------------
A0A2I3M6I1_BCL2L11      tt------------------------------------------------
A0A2K5HZI7_BCL2L11      tt------------------------------------------------
A0A2K6KJP8_BCL2L11      tt------------------------------------------------
A0A2K6QIL2_BCL2L11      tt------------------------------------------------
F6XMC1_BCL2L11-09       tt------------------------------------------------
A0A2K5CAB2_BCL2L11      tt------------------------------------------------
A0A2K6TRZ5_BCL2L11      tg------------------------------------------------
A0A2K5NU92_BCL2L11      tg------------------------------------------------
A0A2K5X2I7_BCL2L11      tg------------------------------------------------
F7HHA9_BCL2L11-05       tg------------------------------------------------
A0A2K5Z8B6_BCL2L11      tg------------------------------------------------
A0A2K5HZI7_BCL2L11      tg------------------------------------------------
A0A2K6QIL2_BCL2L11      tg------------------------------------------------
A0A2K6KJP8_BCL2L11      tg------------------------------------------------
O43521_BCL2L11-13       tg------------------------------------------------
O43521_BCL2L11-17       tg------------------------------------------------
A0A2J8JCT2_BCL2L11      tg------------------------------------------------
A0A2I3HW02_BCL2L11      tg------------------------------------------------
A0A2I2YQ13_BCL2L11      tg------------------------------------------------
A0A2R9CA99_BCL2L11      tg------------------------------------------------
F6XMC1_BCL2L11-01       taaactggatactgcccttttgccatcggaaggaagtgtgtcttgaagca
F6XMC1_BCL2L11-02       taaactggatactgcccttttgccatcggaaggaagtgtgtcttgaagca
F6XMC1_BCL2L11-06       tg------------------------------------------------
A0A2K5CAB2_BCL2L11      tg------------------------------------------------
A0A2K6TRZ5_BCL2L11      tg------------------------------------------------
F6XMC1_BCL2L11-08       aa------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       ta------------------------------------------------
F6XMC1_BCL2L11-03       ta------------------------------------------------
A0A2K5CAB2_BCL2L11      ta------------------------------------------------
A0A2K5CAB2_BCL2L11      ta------------------------------------------------
A0A2K5CAB2_BCL2L11      ta------------------------------------------------
A0A2K5CAB2_BCL2L11      ta------------------------------------------------
A0A2K6TRZ5_BCL2L11      ta------------------------------------------------
A0A2K6TRZ5_BCL2L11      ta------------------------------------------------
A0A2K6TRZ5_BCL2L11      ta------------------------------------------------
A0A2K6TRZ5_BCL2L11      ta------------------------------------------------
A0A2K5CAB2_BCL2L11      ta------------------------------------------------
A0A2K6TRZ5_BCL2L11      ta------------------------------------------------
F6XMC1_BCL2L11-05       ta------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       ta------------------------------------------------
A0A2K6E226_BCL2L11      ta------------------------------------------------
O43521_BCL2L11-21       ta------------------------------------------------
O43521_BCL2L11-02       ta------------------------------------------------
O43521_BCL2L11-03       ta------------------------------------------------
A0A2J8JCT2_BCL2L11      ta------------------------------------------------
A0A2J8JCT2_BCL2L11      ta------------------------------------------------
A0A2I3HW02_BCL2L11      ta------------------------------------------------
A0A2I2YQ13_BCL2L11      ta------------------------------------------------
A0A2I3HW02_BCL2L11      ta------------------------------------------------
A0A2R9CA99_BCL2L11      ta------------------------------------------------
A0A2J8JCT2_BCL2L11      ta------------------------------------------------
A0A2I2YQ13_BCL2L11      ta------------------------------------------------
A0A2R9CA99_BCL2L11      ta------------------------------------------------
A0A2I2YQ13_BCL2L11      ta------------------------------------------------
A0A2R9CA99_BCL2L11      ta------------------------------------------------
A0A2I3M6I1_BCL2L11      ta------------------------------------------------
A0A2I3M6I1_BCL2L11      ta------------------------------------------------
A0A2I3M6I1_BCL2L11      ta------------------------------------------------
A0A2K5NU92_BCL2L11      ta------------------------------------------------
A0A2K5X2I7_BCL2L11      ta------------------------------------------------
F7HHA9_BCL2L11-01       ta------------------------------------------------
A0A2K6E226_BCL2L11      ta------------------------------------------------
A0A2K5Z8B6_BCL2L11      ta------------------------------------------------
A0A2I3M6I1_BCL2L11      ta------------------------------------------------
A0A2K5NU92_BCL2L11      ta------------------------------------------------
A0A2K5X2I7_BCL2L11      ta------------------------------------------------
A0A2K6E226_BCL2L11      ta------------------------------------------------
A0A2K6E226_BCL2L11      ta------------------------------------------------
A0A2K5Z8B6_BCL2L11      ta------------------------------------------------
A0A2K5NU92_BCL2L11      ta------------------------------------------------
A0A2K5X2I7_BCL2L11      ta------------------------------------------------
A0A2K6E226_BCL2L11      ta------------------------------------------------
A0A2K5Z8B6_BCL2L11      ta------------------------------------------------
A0A2K5HZI7_BCL2L11      tg------------------------------------------------
A0A2K5HZI7_BCL2L11      tg------------------------------------------------
A0A2K5HZI7_BCL2L11      tg------------------------------------------------
A0A2K6QIL2_BCL2L11      ta------------------------------------------------
A0A2K6QIL2_BCL2L11      ta------------------------------------------------
A0A2K6QIL2_BCL2L11      ta------------------------------------------------
A0A2K6KJP8_BCL2L11      ta------------------------------------------------
A0A2K6QIL2_BCL2L11      ta------------------------------------------------
A0A2K6KJP8_BCL2L11      ta------------------------------------------------
A0A2K6KJP8_BCL2L11      ta------------------------------------------------
A0A2K6KJP8_BCL2L11      ta------------------------------------------------
Q6JTU4_BCL2L11-01       t-------------------------------------------------
O43521_BCL2L11-25       t-------------------------------------------------
O43521_BCL2L11-05       t-------------------------------------------------
O43521_BCL2L11-18       t-------------------------------------------------
O43521_BCL2L11-10       tg------------------------------------------------
O43521_BCL2L11-20       tg------------------------------------------------
O43521_BCL2L11-09       tg------------------------------------------------
O43521_BCL2L11-16       tg------------------------------------------------
A0A2K6KJP8_BCL2L11      tg------------------------------------------------
A0A2K6QIL2_BCL2L11      tg------------------------------------------------
A0A2K5HZI7_BCL2L11      tg------------------------------------------------
O43521_BCL2L11-22       tg------------------------------------------------
O43521_BCL2L11-08       tg------------------------------------------------
A0A2I2YQ13_BCL2L11      tg------------------------------------------------
A0A2I3HW02_BCL2L11      tg------------------------------------------------
A0A2R9CA99_BCL2L11      tg------------------------------------------------
A0A2J8JCT2_BCL2L11      tg------------------------------------------------
A0A2K5NU92_BCL2L11      tg------------------------------------------------
A0A2K5X2I7_BCL2L11      tg------------------------------------------------
F7HHA9_BCL2L11-03       tg------------------------------------------------
A0A2K6E226_BCL2L11      tg------------------------------------------------
A0A2K5Z8B6_BCL2L11      tg------------------------------------------------
A0A2I3M6I1_BCL2L11      tg------------------------------------------------
O43521_BCL2L11-19       tg------------------------------------------------
O43521_BCL2L11-07       tg------------------------------------------------
A0A2I2YQ13_BCL2L11      tg------------------------------------------------
A0A2R9CA99_BCL2L11      tg------------------------------------------------
A0A2J8JCT2_BCL2L11      tg------------------------------------------------
A0A2J8JCT2_BCL2L11      t-------------------------------------------------
A0A2I2YQ13_BCL2L11      t-------------------------------------------------
A0A2R9CA99_BCL2L11      t-------------------------------------------------
A0A2I3HW02_BCL2L11      t-------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      t-------------------------------------------------
A0A2K6QIL2_BCL2L11      t-------------------------------------------------
A0A2K5HZI7_BCL2L11      t-------------------------------------------------
A0A2K5NU92_BCL2L11      t-------------------------------------------------
A0A2K5X2I7_BCL2L11      t-------------------------------------------------
F7HHA9_BCL2L11-04       t-------------------------------------------------
A0A2K6E226_BCL2L11      t-------------------------------------------------
A0A2K5Z8B6_BCL2L11      t-------------------------------------------------
A0A2I3M6I1_BCL2L11      t-------------------------------------------------
A0A0D9RWE0_BCL2L11      t-------------------------------------------------
A0A2K5NU92_BCL2L11      tg------------------------------------------------
A0A2K5X2I7_BCL2L11      tg------------------------------------------------
F7HHA9_BCL2L11-02       tg------------------------------------------------
A0A2K6E226_BCL2L11      tg------------------------------------------------
A0A2K5Z8B6_BCL2L11      tg------------------------------------------------
A0A2I3M6I1_BCL2L11      tg------------------------------------------------
A0A2K6KJP8_BCL2L11      tg------------------------------------------------
A0A2K6QIL2_BCL2L11      tg------------------------------------------------
A0A2K5HZI7_BCL2L11      tg------------------------------------------------
A0A2I3HW02_BCL2L11      ta------------------------------------------------
A0A2I2YQ13_BCL2L11      ta------------------------------------------------
O43521_BCL2L11-23       ta------------------------------------------------
A0A2R9CA99_BCL2L11      ta------------------------------------------------
A0A2J8JCT2_BCL2L11      ta------------------------------------------------
A0A2I3M6I1_BCL2L11      ta------------------------------------------------
A0A2K5X2I7_BCL2L11      ta------------------------------------------------
F7HHA9_BCL2L11-07       ta------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      ta------------------------------------------------
A0A2K5Z8B6_BCL2L11      ta------------------------------------------------
A0A2K5CAB2_BCL2L11      ta------------------------------------------------
A0A2K6TRZ5_BCL2L11      ta------------------------------------------------
G3SU55_BCL2L11-01       ct------------------------------------------------
M3YDI3_BCL2L11-01       tc------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       tc------------------------------------------------
J9NWV6_BCL2L11-01       tc------------------------------------------------
A0A337SW42_BCL2L11      tg------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      tc------------------------------------------------
A0A337SW42_BCL2L11      tc------------------------------------------------
A0A337SW42_BCL2L11      tc------------------------------------------------

B2KKY9_BCL2L11-01       ---------------------------------------------gtgaa
B8JK68_BCL2L11-01       ---------------------------------------------gtgaa
Q4KMV9_BCL2L11-01       ------------------------------------------attttcaa
M3XHJ5_BCL2L11-01       ------------------------------------------------ca
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       ------------------------------------------ttcttgga
F7FTC8_BCL2L11-01       ------------------------------------------ctcttgga
G1MV54_BCL2L11-01       ------------------------------------------ttcttgga
K7GA86_BCL2L11-01       ------------------------------------------ttcttgga
G1PDJ5_BCL2L11-01       ------------------------------------------tttctgaa
F7CXT2_BCL2L11-01       ------------------------------------------tttttgga
G3W979_BCL2L11-01       ------------------------------------------tttttgga
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       ------------------------------------------ttcgtgcg
W5PY58_BCL2L11-01       ------------------------------------------ttcgtgcg
A0A1U8BW10_BCL2L11      -----------------------------------------------aaa
A0A1U8BW10_BCL2L11      -----------------------------------------------aaa
A0A1U8BW10_BCL2L11      -----------------------------------------------aaa
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       ------------------------------------------tttgcaaa
O88498_BCL2L11-02       ------------------------------------------tttgcaaa
O54918_BCL2L11-01       ------------------------------------------tttgcaaa
O54918_BCL2L11-05       ------------------------------------------tttgcaaa
O54918_BCL2L11-06       ------------------------------------------tttgcaaa
O54918_BCL2L11-08       ------------------------------------------tttgcaaa
G1SSY0_BCL2L11-01       ------------------------------------------tttttgaa
A0A286XJN2_BCL2L11      ------------------------------------------ttcttgaa
A0A286XJN2_BCL2L11      ------------------------------------------ttcttgaa
A0A286XJN2_BCL2L11      ------------------------------------------ttcttgaa
F7A7D2_BCL2L11-01       ------------------------------------------gttttgaa
F1SU81_BCL2L11-01       ------------------------------------------tttctgaa
C1KGB8_BCL2L11-01       ------------------------------------------atgctgtt
F1SU81_BCL2L11-02       ------------------------------------------atgctgtt
F1SU81_BCL2L11-03       ------------------------------------------atgctgtt
A0A287DFJ0_BCL2L11      ---------------------------------------------ttttt
A0A287DFJ0_BCL2L11      ---------------------------------------------ttttt
H0XW23_BCL2L11-01       ------------------------------------------tttttgca
A0A1S3FHA8_BCL2L11      ------------------------------------------tttttgaa
A0A1S3FHA8_BCL2L11      ------------------------------------------tttttgaa
A0A2K6GE31_BCL2L11      -----------------------------------------------gca
A0A2K6GE31_BCL2L11      ------------------------------------------ttgtcgtg
A0A2K6GE31_BCL2L11      ------------------------------------------cctct---
A0A2K6GE31_BCL2L11      ------------------------------------------tttttgaa
A0A2K6GE31_BCL2L11      ------------------------------------------tttttgaa
A0A2K6GE31_BCL2L11      ------------------------------------------tttttgaa
A0A2I3HW02_BCL2L11      ---------------------------------------------tctca
A0A2R9CA99_BCL2L11      ---------------------------------------------tctca
A0A2J8JCT2_BCL2L11      ---------------------------------------------tctca
A0A2I2YQ13_BCL2L11      ---------------------------------------------tctca
O43521_BCL2L11-06       ---------------------------------------------tctca
O43521_BCL2L11-15       ---------------------------------------------tctca
A0A2K5X2I7_BCL2L11      ---------------------------------------------tctca
F7HHA9_BCL2L11-09       ---------------------------------------------tctca
A0A2K6E226_BCL2L11      ---------------------------------------------tctca
A0A2K5NU92_BCL2L11      ---------------------------------------------tctca
A0A2K5Z8B6_BCL2L11      ---------------------------------------------tctca
A0A2I3M6I1_BCL2L11      ---------------------------------------------tctca
A0A2K5HZI7_BCL2L11      ---------------------------------------------tctca
A0A2K6KJP8_BCL2L11      ---------------------------------------------tctca
A0A2K6QIL2_BCL2L11      ---------------------------------------------tctca
F6XMC1_BCL2L11-09       ---------------------------------------------tctca
A0A2K5CAB2_BCL2L11      ---------------------------------------------tctca
A0A2K6TRZ5_BCL2L11      ---------------------------------------------tctca
A0A2K5NU92_BCL2L11      -----------------------------------------------gca
A0A2K5X2I7_BCL2L11      -----------------------------------------------gca
F7HHA9_BCL2L11-05       -----------------------------------------------gca
A0A2K5Z8B6_BCL2L11      -----------------------------------------------gca
A0A2K5HZI7_BCL2L11      -----------------------------------------------gca
A0A2K6QIL2_BCL2L11      -----------------------------------------------gca
A0A2K6KJP8_BCL2L11      -----------------------------------------------gca
O43521_BCL2L11-13       -----------------------------------------------gca
O43521_BCL2L11-17       -----------------------------------------------gca
A0A2J8JCT2_BCL2L11      -----------------------------------------------gca
A0A2I3HW02_BCL2L11      -----------------------------------------------gca
A0A2I2YQ13_BCL2L11      -----------------------------------------------gca
A0A2R9CA99_BCL2L11      -----------------------------------------------gca
F6XMC1_BCL2L11-01       ttcccggttttaccatcgaaagccagccagagtgcttactggaccacaat
F6XMC1_BCL2L11-02       ttcccggttttaccatcgaaagccagccagagtgcttactggaccacaat
F6XMC1_BCL2L11-06       -----------------------------------tc----------gtg
A0A2K5CAB2_BCL2L11      -----------------------------------tc----------gtg
A0A2K6TRZ5_BCL2L11      -----------------------------------tc----------gtg
F6XMC1_BCL2L11-08       -----------------------------------ttcta--tacatcct
A0A2K5CAB2_BCL2L11      -----------------------------------------------gac
A0A2K6TRZ5_BCL2L11      -----------------------------------------------gac
F6XMC1_BCL2L11-04       -----------------------------------ttttt-------gaa
F6XMC1_BCL2L11-03       -----------------------------------ttttt-------gaa
A0A2K5CAB2_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5CAB2_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5CAB2_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5CAB2_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6TRZ5_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6TRZ5_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6TRZ5_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6TRZ5_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5CAB2_BCL2L11      -----------------------------------tctcttccatctgat
A0A2K6TRZ5_BCL2L11      -----------------------------------tctcttccacctgat
F6XMC1_BCL2L11-05       -----------------------------------tctcttctacctgat
F6XMC1_BCL2L11-07       -----------------------------------------ttagagaaa
A0A2K5CAB2_BCL2L11      -----------------------------------------ttagagaaa
A0A2K6TRZ5_BCL2L11      -----------------------------------------ttagagaaa
H2P5E2_BCL2L11-01       -----------------------------------ttttt-------gaa
A0A2K6E226_BCL2L11      -----------------------------------ttttt-------gaa
O43521_BCL2L11-21       -----------------------------------ttttt-------gaa
O43521_BCL2L11-02       -----------------------------------ttttt-------gaa
O43521_BCL2L11-03       -----------------------------------ttttt-------gaa
A0A2J8JCT2_BCL2L11      -----------------------------------ttttt-------gaa
A0A2J8JCT2_BCL2L11      -----------------------------------ttttt-------gaa
A0A2I3HW02_BCL2L11      -----------------------------------ttttt-------gaa
A0A2I2YQ13_BCL2L11      -----------------------------------ttttt-------gaa
A0A2I3HW02_BCL2L11      -----------------------------------ttttt-------gaa
A0A2R9CA99_BCL2L11      -----------------------------------ttttt-------gaa
A0A2J8JCT2_BCL2L11      -----------------------------------ttttt-------gaa
A0A2I2YQ13_BCL2L11      -----------------------------------ttttt-------gaa
A0A2R9CA99_BCL2L11      -----------------------------------ttttt-------gaa
A0A2I2YQ13_BCL2L11      -----------------------------------ttttt-------gaa
A0A2R9CA99_BCL2L11      -----------------------------------ttttt-------gaa
A0A2I3M6I1_BCL2L11      -----------------------------------ttttt-------gaa
A0A2I3M6I1_BCL2L11      -----------------------------------ttttt-------gaa
A0A2I3M6I1_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5NU92_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5X2I7_BCL2L11      -----------------------------------ttttt-------gaa
F7HHA9_BCL2L11-01       -----------------------------------ttttt-------gaa
A0A2K6E226_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5Z8B6_BCL2L11      -----------------------------------ttttt-------gaa
A0A2I3M6I1_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5NU92_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5X2I7_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6E226_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6E226_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5Z8B6_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5NU92_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5X2I7_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6E226_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5Z8B6_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5HZI7_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5HZI7_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K5HZI7_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6QIL2_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6QIL2_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6QIL2_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6KJP8_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6QIL2_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6KJP8_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6KJP8_BCL2L11      -----------------------------------ttttt-------gaa
A0A2K6KJP8_BCL2L11      -----------------------------------ttttt-------gaa
Q6JTU4_BCL2L11-01       -------------------------------------------agagaaa
O43521_BCL2L11-25       -------------------------------------------agagaaa
O43521_BCL2L11-05       -------------------------------------------agagaaa
O43521_BCL2L11-18       -------------------------------------------agagaaa
O43521_BCL2L11-10       -----------------------------------cctcttccacctgat
O43521_BCL2L11-20       -----------------------------------cctcttccacctgat
O43521_BCL2L11-09       -----------------------------------cctcttccacctgat
O43521_BCL2L11-16       -----------------------------------cctcttccacctgat
A0A2K6KJP8_BCL2L11      -----------------------------------tc----------gtg
A0A2K6QIL2_BCL2L11      -----------------------------------tc----------gtg
A0A2K5HZI7_BCL2L11      -----------------------------------tc----------gtg
O43521_BCL2L11-22       -----------------------------------tc----------gtg
O43521_BCL2L11-08       -----------------------------------tc----------gtg
A0A2I2YQ13_BCL2L11      -----------------------------------tc----------gtg
A0A2I3HW02_BCL2L11      -----------------------------------tc----------gtg
A0A2R9CA99_BCL2L11      -----------------------------------tc----------gtg
A0A2J8JCT2_BCL2L11      -----------------------------------tc----------gtg
A0A2K5NU92_BCL2L11      -----------------------------------tc----------gtg
A0A2K5X2I7_BCL2L11      -----------------------------------tc----------gtg
F7HHA9_BCL2L11-03       -----------------------------------tc----------gtg
A0A2K6E226_BCL2L11      -----------------------------------tc----------gtg
A0A2K5Z8B6_BCL2L11      -----------------------------------tc----------gtg
A0A2I3M6I1_BCL2L11      -----------------------------------tc----------gtg
O43521_BCL2L11-19       -----------------------------------tc----------gtg
O43521_BCL2L11-07       -----------------------------------tc----------gtg
A0A2I2YQ13_BCL2L11      -----------------------------------cctcttccacctgat
A0A2R9CA99_BCL2L11      -----------------------------------cctcttccacctgat
A0A2J8JCT2_BCL2L11      -----------------------------------cctcttccacctgat
A0A2J8JCT2_BCL2L11      -------------------------------------------agagaaa
A0A2I2YQ13_BCL2L11      -------------------------------------------agagaaa
A0A2R9CA99_BCL2L11      -------------------------------------------agagaaa
A0A2I3HW02_BCL2L11      -------------------------------------------agagaaa
A0A2K6KJP8_BCL2L11      -----------------------------------------------gac
A0A2K6QIL2_BCL2L11      -----------------------------------------------gac
O43521_BCL2L11-12       -----------------------------------------------gac
O43521_BCL2L11-24       -----------------------------------------------gac
A0A2I2YQ13_BCL2L11      -----------------------------------------------gac
A0A2I3HW02_BCL2L11      -----------------------------------------------gac
A0A2R9CA99_BCL2L11      -----------------------------------------------gac
A0A2J8JCT2_BCL2L11      -----------------------------------------------gac
A0A2K5NU92_BCL2L11      -----------------------------------------------gac
A0A2K5X2I7_BCL2L11      -----------------------------------------------gac
F7HHA9_BCL2L11-06       -----------------------------------------------gac
A0A2K6E226_BCL2L11      -----------------------------------------------gac
A0A2K5Z8B6_BCL2L11      -----------------------------------------------gac
A0A2I3M6I1_BCL2L11      -----------------------------------------------gac
A0A2K5HZI7_BCL2L11      -----------------------------------------------gac
A0A2K6KJP8_BCL2L11      -------------------------------------------agagaaa
A0A2K6QIL2_BCL2L11      -------------------------------------------agagaaa
A0A2K5HZI7_BCL2L11      -------------------------------------------agagaaa
A0A2K5NU92_BCL2L11      -------------------------------------------agagaaa
A0A2K5X2I7_BCL2L11      -------------------------------------------agagaaa
F7HHA9_BCL2L11-04       -------------------------------------------agagaaa
A0A2K6E226_BCL2L11      -------------------------------------------agagaaa
A0A2K5Z8B6_BCL2L11      -------------------------------------------agagaaa
A0A2I3M6I1_BCL2L11      -------------------------------------------agagaaa
A0A0D9RWE0_BCL2L11      -------------------------------------------agagaaa
A0A2K5NU92_BCL2L11      -----------------------------------tcgcttccacctgat
A0A2K5X2I7_BCL2L11      -----------------------------------tcgcttccacctgat
F7HHA9_BCL2L11-02       -----------------------------------tcgcttccacctgat
A0A2K6E226_BCL2L11      -----------------------------------tcgcttccacctgat
A0A2K5Z8B6_BCL2L11      -----------------------------------tcgcttccacctgat
A0A2I3M6I1_BCL2L11      -----------------------------------tcgcttccacctgat
A0A2K6KJP8_BCL2L11      -----------------------------------tctcttccacctgat
A0A2K6QIL2_BCL2L11      -----------------------------------tctcttccacctgat
A0A2K5HZI7_BCL2L11      -----------------------------------tctcttccacctgat
A0A2I3HW02_BCL2L11      -----------------------------------------------gca
A0A2I2YQ13_BCL2L11      -----------------------------------------------gca
O43521_BCL2L11-23       -----------------------------------------------gca
A0A2R9CA99_BCL2L11      -----------------------------------------------gca
A0A2J8JCT2_BCL2L11      -----------------------------------------------gca
A0A2I3M6I1_BCL2L11      -----------------------------------------------gc-
A0A2K5X2I7_BCL2L11      -----------------------------------------------gc-
F7HHA9_BCL2L11-07       -----------------------------------------------gc-
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      -----------------------------------------------gc-
A0A2K5Z8B6_BCL2L11      -----------------------------------------------gc-
A0A2K5CAB2_BCL2L11      -----------------------------------------------gca
A0A2K6TRZ5_BCL2L11      -----------------------------------------------gca
G3SU55_BCL2L11-01       ------------------------------------------tttttgaa
M3YDI3_BCL2L11-01       ------------------------------------------tttttgaa
A0A337SW42_BCL2L11      --------------------------------------------ctggca
G1LDR8_BCL2L11-01       ------------------------------------------tttctgaa
J9NWV6_BCL2L11-01       ------------------------------------------tttttgaa
A0A337SW42_BCL2L11      ------------------------------------------tcctgtag
A0A337SW42_BCL2L11      --------------------------------------------ttagag
A0A337SW42_BCL2L11      ------------------------------------------tttttgaa
A0A337SW42_BCL2L11      ------------------------------------------tttttgaa
A0A337SW42_BCL2L11      ------------------------------------------tttttgaa

B2KKY9_BCL2L11-01       ccagctgcgtgctcccaacgaacacgccatcgtcctgtggatgaacgtca
B8JK68_BCL2L11-01       ccagctgcatgctcccaacgaacacgccatcgtcctgtggatgaacgaca
Q4KMV9_BCL2L11-01       caaccttccacgacccttgg---------acaacgaccaagta------a
M3XHJ5_BCL2L11-01       taa-----------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       ttacca------agcagtaa------------accatcagatc------a
F7FTC8_BCL2L11-01       taataataatccggcaggaa---------acaaccaccaaatg------g
G1MV54_BCL2L11-01       taaccat------gctgga------------aacccccaggtg------g
K7GA86_BCL2L11-01       taatcaa------gcaata------------aaccaccaaatt------g
G1PDJ5_BCL2L11-01       tgtttaccgggaagcagaag---------gccacccccagatg------g
F7CXT2_BCL2L11-01       taataactatcaaggagcaggtg------accatcaccaaatg------g
G3W979_BCL2L11-01       taataactatcaagcagcagatg------atcatcaccaaatg------g
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       tca---ccaggcagttgagg---------gccacccgcaaatg------g
W5PY58_BCL2L11-01       tca---ccaggcgattgagg---------gccacccacaaatg------g
A0A1U8BW10_BCL2L11      taattaccaagaggatgaagaccaccctcaccaccctcaaatg------g
A0A1U8BW10_BCL2L11      taattaccaagaggatgaagaccaccctcaccaccctcaaatg------g
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       cgattaccgagaggcggaag---------accacccgcaaatg------g
O88498_BCL2L11-02       cgattaccgagaggcggaag---------accacccgcaaatg------g
O54918_BCL2L11-01       tgattaccgcgaggctgaag---------accaccctcaaatg------g
O54918_BCL2L11-05       tgattaccgcgaggctgaag---------accaccctcaaatg------g
O54918_BCL2L11-06       tgattaccgcgaggctgaag---------accaccctcaaatg------g
O54918_BCL2L11-08       tgattaccgcgaggctgaag---------accaccctcaaatg------g
G1SSY0_BCL2L11-01       taattacccagcagcggagg---------agcagccccaaatg------g
A0A286XJN2_BCL2L11      tcattaccagcccgctgaag---------accaaccccaaatg------g
A0A286XJN2_BCL2L11      tcattaccagcccgctgaag---------accaaccccaaatg------g
A0A286XJN2_BCL2L11      tcattaccagcccgctgaag---------accaaccccaaatg------g
F7A7D2_BCL2L11-01       tcatcaccaagcagctgaag---------cccacccccaaatg------a
F1SU81_BCL2L11-01       taattaccaagcagccgaag---------cccaccctcagatg------g
C1KGB8_BCL2L11-01       ttctt--------------------------taccccc------------
F1SU81_BCL2L11-02       ttctt--------------------------taccccc------------
F1SU81_BCL2L11-03       ttctt--------------------------taccccc------------
A0A287DFJ0_BCL2L11      taataattaccaacctgaag---------accgcccccaaatg------g
A0A287DFJ0_BCL2L11      taataattaccaacctgaag---------accgcccccaaatg------g
H0XW23_BCL2L11-01       taattaccaagcagccgaag---------accaccctcaaatg------g
A0A1S3FHA8_BCL2L11      taattaccaagcagccgaag---------accaaccccaaatg------g
A0A1S3FHA8_BCL2L11      taattaccaagcagccgaag---------accaaccccaaatg------g
A0A2K6GE31_BCL2L11      aaa-----------------------------------------------
A0A2K6GE31_BCL2L11      tag-----------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      taa-----------------------------------------------
A0A2K6GE31_BCL2L11      taattaccaagccgacgaag---------accaccctcaaatg------c
A0A2K6GE31_BCL2L11      taattaccaagccgacgaag---------accaccctcaaatg------c
A0A2I3HW02_BCL2L11      tga-----------------------------------------------
A0A2R9CA99_BCL2L11      tga-----------------------------------------------
A0A2J8JCT2_BCL2L11      tga-----------------------------------------------
A0A2I2YQ13_BCL2L11      tga-----------------------------------------------
O43521_BCL2L11-06       tga-----------------------------------------------
O43521_BCL2L11-15       tga-----------------------------------------------
A0A2K5X2I7_BCL2L11      tga-----------------------------------------------
F7HHA9_BCL2L11-09       tga-----------------------------------------------
A0A2K6E226_BCL2L11      tga-----------------------------------------------
A0A2K5NU92_BCL2L11      tga-----------------------------------------------
A0A2K5Z8B6_BCL2L11      tga-----------------------------------------------
A0A2I3M6I1_BCL2L11      tga-----------------------------------------------
A0A2K5HZI7_BCL2L11      tga-----------------------------------------------
A0A2K6KJP8_BCL2L11      tga-----------------------------------------------
A0A2K6QIL2_BCL2L11      tga-----------------------------------------------
F6XMC1_BCL2L11-09       tgg-----------------------------------------------
A0A2K5CAB2_BCL2L11      tga-----------------------------------------------
A0A2K6TRZ5_BCL2L11      tga-----------------------------------------------
A0A2K5NU92_BCL2L11      gaa-----------------------------------------------
A0A2K5X2I7_BCL2L11      gaa-----------------------------------------------
F7HHA9_BCL2L11-05       gaa-----------------------------------------------
A0A2K5Z8B6_BCL2L11      gaa-----------------------------------------------
A0A2K5HZI7_BCL2L11      aaa-----------------------------------------------
A0A2K6QIL2_BCL2L11      aaa-----------------------------------------------
A0A2K6KJP8_BCL2L11      aaa-----------------------------------------------
O43521_BCL2L11-13       aaa-----------------------------------------------
O43521_BCL2L11-17       aaa-----------------------------------------------
A0A2J8JCT2_BCL2L11      aaa-----------------------------------------------
A0A2I3HW02_BCL2L11      aaa-----------------------------------------------
A0A2I2YQ13_BCL2L11      aaa-----------------------------------------------
A0A2R9CA99_BCL2L11      aaa-----------------------------------------------
F6XMC1_BCL2L11-01       cagagatcgttcaatcaata---------cttgctgtgccaaa------g
F6XMC1_BCL2L11-02       cagagatcgttcaatcaata---------cttgctgtgccaaa------g
F6XMC1_BCL2L11-06       tag-----------------------------------------------
A0A2K5CAB2_BCL2L11      tag-----------------------------------------------
A0A2K6TRZ5_BCL2L11      tag-----------------------------------------------
F6XMC1_BCL2L11-08       taa-----------------------------------------------
A0A2K5CAB2_BCL2L11      tag-----------------------------------------------
A0A2K6TRZ5_BCL2L11      tag-----------------------------------------------
F6XMC1_BCL2L11-04       taa-----------------------------------------------
F6XMC1_BCL2L11-03       taattaccaagcagctgaag---------accacccacacatg------g
A0A2K5CAB2_BCL2L11      taa-----------------------------------------------
A0A2K5CAB2_BCL2L11      taattaccaagcagccgaag---------accacccacacatg------g
A0A2K5CAB2_BCL2L11      taattaccaagcagccgaag---------accacccacacatg------g
A0A2K5CAB2_BCL2L11      taattaccaagcagccgaag---------accacccacacatg------g
A0A2K6TRZ5_BCL2L11      taa-----------------------------------------------
A0A2K6TRZ5_BCL2L11      taattaccaagcagccgaag---------accacccgcacatg------g
A0A2K6TRZ5_BCL2L11      taattaccaagcagccgaag---------accacccgcacatg------g
A0A2K6TRZ5_BCL2L11      taattaccaagcagccgaag---------accacccgcacatg------g
A0A2K5CAB2_BCL2L11      tga-----------------------------------------------
A0A2K6TRZ5_BCL2L11      tga-----------------------------------------------
F6XMC1_BCL2L11-05       tga-----------------------------------------------
F6XMC1_BCL2L11-07       tag-----------------------------------------------
A0A2K5CAB2_BCL2L11      tag-----------------------------------------------
A0A2K6TRZ5_BCL2L11      tag-----------------------------------------------
H2P5E2_BCL2L11-01       taattaccaagcagccgaag---------accacccacgaatg------g
A0A2K6E226_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
O43521_BCL2L11-21       taa-----------------------------------------------
O43521_BCL2L11-02       taattaccaagcagccgaag---------accacccacgaatg------g
O43521_BCL2L11-03       taattaccaagcagccgaag---------accacccacgaatg------g
A0A2J8JCT2_BCL2L11      taattaccaagcagccgaag---------accacccacgaatg------g
A0A2J8JCT2_BCL2L11      taattaccaagcagccgaag---------accacccacgaatg------g
A0A2I3HW02_BCL2L11      taattaccaagcagccgaag---------accacccacgaatg------g
A0A2I2YQ13_BCL2L11      taa-----------------------------------------------
A0A2I3HW02_BCL2L11      taa-----------------------------------------------
A0A2R9CA99_BCL2L11      taa-----------------------------------------------
A0A2J8JCT2_BCL2L11      taa-----------------------------------------------
A0A2I2YQ13_BCL2L11      taattaccaagcagccgaag---------accacccacgaatg------g
A0A2R9CA99_BCL2L11      taattaccaagcagccgaag---------accacccacgaatg------g
A0A2I2YQ13_BCL2L11      taattaccaagcagccgaag---------accacccacgaatg------g
A0A2R9CA99_BCL2L11      taattaccaagcagccgaag---------accacccacgaatg------g
A0A2I3M6I1_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2I3M6I1_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2I3M6I1_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K5NU92_BCL2L11      taa-----------------------------------------------
A0A2K5X2I7_BCL2L11      taa-----------------------------------------------
F7HHA9_BCL2L11-01       taa-----------------------------------------------
A0A2K6E226_BCL2L11      taa-----------------------------------------------
A0A2K5Z8B6_BCL2L11      taa-----------------------------------------------
A0A2I3M6I1_BCL2L11      taa-----------------------------------------------
A0A2K5NU92_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K5X2I7_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K6E226_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K6E226_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K5Z8B6_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K5NU92_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K5X2I7_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K6E226_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K5Z8B6_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K5HZI7_BCL2L11      taa-----------------------------------------------
A0A2K5HZI7_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K5HZI7_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K6QIL2_BCL2L11      taattaccaagcagccgaag---------aacacccacaaatg------g
A0A2K6QIL2_BCL2L11      taattaccaagcagccgaag---------aacacccacaaatg------g
A0A2K6QIL2_BCL2L11      taattaccaagcagccgaag---------aacacccacaaatg------g
A0A2K6KJP8_BCL2L11      taa-----------------------------------------------
A0A2K6QIL2_BCL2L11      taa-----------------------------------------------
A0A2K6KJP8_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K6KJP8_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
A0A2K6KJP8_BCL2L11      taattaccaagcagccgaag---------accacccacaaatg------g
Q6JTU4_BCL2L11-01       tag-----------------------------------------------
O43521_BCL2L11-25       tag-----------------------------------------------
O43521_BCL2L11-05       tag-----------------------------------------------
O43521_BCL2L11-18       tag-----------------------------------------------
O43521_BCL2L11-10       taa-----------------------------------------------
O43521_BCL2L11-20       taa-----------------------------------------------
O43521_BCL2L11-09       taa-----------------------------------------------
O43521_BCL2L11-16       taa-----------------------------------------------
A0A2K6KJP8_BCL2L11      tag-----------------------------------------------
A0A2K6QIL2_BCL2L11      tag-----------------------------------------------
A0A2K5HZI7_BCL2L11      tag-----------------------------------------------
O43521_BCL2L11-22       tag-----------------------------------------------
O43521_BCL2L11-08       tag-----------------------------------------------
A0A2I2YQ13_BCL2L11      tag-----------------------------------------------
A0A2I3HW02_BCL2L11      tag-----------------------------------------------
A0A2R9CA99_BCL2L11      tag-----------------------------------------------
A0A2J8JCT2_BCL2L11      tag-----------------------------------------------
A0A2K5NU92_BCL2L11      tag-----------------------------------------------
A0A2K5X2I7_BCL2L11      tag-----------------------------------------------
F7HHA9_BCL2L11-03       tag-----------------------------------------------
A0A2K6E226_BCL2L11      tag-----------------------------------------------
A0A2K5Z8B6_BCL2L11      tag-----------------------------------------------
A0A2I3M6I1_BCL2L11      tag-----------------------------------------------
O43521_BCL2L11-19       tag-----------------------------------------------
O43521_BCL2L11-07       tag-----------------------------------------------
A0A2I2YQ13_BCL2L11      taa-----------------------------------------------
A0A2R9CA99_BCL2L11      taa-----------------------------------------------
A0A2J8JCT2_BCL2L11      taa-----------------------------------------------
A0A2J8JCT2_BCL2L11      tag-----------------------------------------------
A0A2I2YQ13_BCL2L11      tag-----------------------------------------------
A0A2R9CA99_BCL2L11      tag-----------------------------------------------
A0A2I3HW02_BCL2L11      tag-----------------------------------------------
A0A2K6KJP8_BCL2L11      tag-----------------------------------------------
A0A2K6QIL2_BCL2L11      tag-----------------------------------------------
O43521_BCL2L11-12       tag-----------------------------------------------
O43521_BCL2L11-24       tag-----------------------------------------------
A0A2I2YQ13_BCL2L11      tag-----------------------------------------------
A0A2I3HW02_BCL2L11      tag-----------------------------------------------
A0A2R9CA99_BCL2L11      tag-----------------------------------------------
A0A2J8JCT2_BCL2L11      tag-----------------------------------------------
A0A2K5NU92_BCL2L11      tag-----------------------------------------------
A0A2K5X2I7_BCL2L11      tag-----------------------------------------------
F7HHA9_BCL2L11-06       tag-----------------------------------------------
A0A2K6E226_BCL2L11      tag-----------------------------------------------
A0A2K5Z8B6_BCL2L11      tag-----------------------------------------------
A0A2I3M6I1_BCL2L11      tag-----------------------------------------------
A0A2K5HZI7_BCL2L11      tag-----------------------------------------------
A0A2K6KJP8_BCL2L11      tag-----------------------------------------------
A0A2K6QIL2_BCL2L11      tag-----------------------------------------------
A0A2K5HZI7_BCL2L11      tag-----------------------------------------------
A0A2K5NU92_BCL2L11      tag-----------------------------------------------
A0A2K5X2I7_BCL2L11      tag-----------------------------------------------
F7HHA9_BCL2L11-04       tag-----------------------------------------------
A0A2K6E226_BCL2L11      tag-----------------------------------------------
A0A2K5Z8B6_BCL2L11      tag-----------------------------------------------
A0A2I3M6I1_BCL2L11      tag-----------------------------------------------
A0A0D9RWE0_BCL2L11      tag-----------------------------------------------
A0A2K5NU92_BCL2L11      taa-----------------------------------------------
A0A2K5X2I7_BCL2L11      taa-----------------------------------------------
F7HHA9_BCL2L11-02       taa-----------------------------------------------
A0A2K6E226_BCL2L11      taa-----------------------------------------------
A0A2K5Z8B6_BCL2L11      taa-----------------------------------------------
A0A2I3M6I1_BCL2L11      taa-----------------------------------------------
A0A2K6KJP8_BCL2L11      taa-----------------------------------------------
A0A2K6QIL2_BCL2L11      taa-----------------------------------------------
A0A2K5HZI7_BCL2L11      taa-----------------------------------------------
A0A2I3HW02_BCL2L11      aaa-----------------------------------------------
A0A2I2YQ13_BCL2L11      aaa-----------------------------------------------
O43521_BCL2L11-23       aaa-----------------------------------------------
A0A2R9CA99_BCL2L11      aaa-----------------------------------------------
A0A2J8JCT2_BCL2L11      aaa-----------------------------------------------
A0A2I3M6I1_BCL2L11      --a-----------------------------------------------
A0A2K5X2I7_BCL2L11      --a-----------------------------------------------
F7HHA9_BCL2L11-07       --a-----------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --a-----------------------------------------------
A0A2K5Z8B6_BCL2L11      --a-----------------------------------------------
A0A2K5CAB2_BCL2L11      aaa-----------------------------------------------
A0A2K6TRZ5_BCL2L11      aaa-----------------------------------------------
G3SU55_BCL2L11-01       taattaccaagcagccgaag---------accaccctcaaatg------g
M3YDI3_BCL2L11-01       taattacccagcagccgaag---------cccacccccaaatg------a
A0A337SW42_BCL2L11      agggtaccg-----------------------------------------
G1LDR8_BCL2L11-01       taattaccaagcagccgaag---------cccacccccaaatg------a
J9NWV6_BCL2L11-01       taattaccaagcagccgaag---------cccacccccaaatg------a
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      caatag--------------------------------------------
A0A337SW42_BCL2L11      taa-----------------------------------------------
A0A337SW42_BCL2L11      taattaccaagcagccgaag---------cccagccccaaatg------a
A0A337SW42_BCL2L11      taattaccaagcagccgaag---------cccagccccaaatg------a

B2KKY9_BCL2L11-01       ttatcggacgcctagtacactttttcctgcgaagaagatga---------
B8JK68_BCL2L11-01       ttatcggacgcctagtacactttttcctgcgaagaagatga---------
Q4KMV9_BCL2L11-01       taatcctgcgtgttttacgtttcattatccgactgatcctgagattataa
M3XHJ5_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       taattttgcgcctgttacattacattgtccgcttcatttggagaatgcag
F7FTC8_BCL2L11-01       gttttgtgcacctgttacgttacatcatccgccgcgtttggagactgcag
G1MV54_BCL2L11-01       tcattctgcgcctcctgcattacatcatccgcctcatctggaggatgcag
K7GA86_BCL2L11-01       ---ttttgcgcttgttgcattacatcatccgcctcatttggagaatgcag
G1PDJ5_BCL2L11-01       tggtcttacgactgttgcgttacatcctccgtctggtgtggaggaggatg
F7CXT2_BCL2L11-01       ttattttacgcctgttacgttacatcatccgccttgtttggagaatgcag
G3W979_BCL2L11-01       ttattttacggctattacattacatcatccgccttgtttggagaatgcag
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       tcctcttgcgcgtcttgcgctacatcgtgcgtctggtgtggaggatgcag
W5PY58_BCL2L11-01       tcctcctgcgcgtcttgcgctacctggtgcgtctggtgtggaggatgcag
A0A1U8BW10_BCL2L11      ttatcttacaactgttacgcttcatcgtccgactagtatggagaaggcat
A0A1U8BW10_BCL2L11      ttatcttacaactgttacgcttcatcgtccgactagtatggagaaggcat
A0A1U8BW10_BCL2L11      ----------------------------------agt-------------
O54918_BCL2L11-03       -----------------------------tgcctggtaca--------ac
O88498_BCL2L11-01       ttatcttacaactgttacgattcatcttccgtctggtctggagaaggcac
O88498_BCL2L11-02       ttatcttacaactgttacgattcatcttccgtctggtctggagaaggcac
O54918_BCL2L11-01       ttatcttacaactgttacgctttatcttccgtctggtatggagaaggcat
O54918_BCL2L11-05       ttatcttacaactgttacgctttatcttccgtctggtatggagaaggcat
O54918_BCL2L11-06       ttatcttacaactgttacgctttatcttccgtctggtatggagaaggcat
O54918_BCL2L11-08       ttatcttacaactgttacgctttatcttccgtctggtatggagaaggcat
G1SSY0_BCL2L11-01       ttatcttgcgactgttgcgttacatcgtgcgcctggtgtggaggatgcat
A0A286XJN2_BCL2L11      ttatcttgcgattgttacgttacattatccgcctggtatggcgaatgcat
A0A286XJN2_BCL2L11      ttatcttgcgattgttacgttacattatccgcctggtatggcgaatgcat
A0A286XJN2_BCL2L11      ttatcttgcgattgttacgttacattatccgcctggtatggcgaatgcat
F7A7D2_BCL2L11-01       tcatcttgcgactgttacgttacatcatccgcctggtacggagactgcag
F1SU81_BCL2L11-01       ttatcttacgactgttacgctacatcgcccgtctggtgtggaggatgcag
C1KGB8_BCL2L11-01       ---cttttcccctcacaccctccctcccccttacatt-------------
F1SU81_BCL2L11-02       ---cttttcccctcacaccctccctcccccttacatt-------------
F1SU81_BCL2L11-03       ---cttttcccctcacaccctccctcccccttacatt-------------
A0A287DFJ0_BCL2L11      ttatcttgcgcctgttgcgttgcatcatccgcctggtgtggaggatgcac
A0A287DFJ0_BCL2L11      ttatcttgcgcctgttgcgttgcatcatccgcctggtgtggaggatgcac
H0XW23_BCL2L11-01       ttatattacgactgttgcgttacatcgtccgcctggtgtggaggctgcac
A0A1S3FHA8_BCL2L11      ttatcttacggctgttacgttacatcattcgcctggtgtggagaatgcat
A0A1S3FHA8_BCL2L11      ttatcttacggctgttacgttacatcattcgcctggtgtggagaatgcat
A0A2K6GE31_BCL2L11      ---------------tgcctggtaccctccatctga--------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ---------------------------tccatctg-------------at
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ttatcttgcgactgttacgttacattgtccgcctggtgtggaggaggcat
A0A2K6GE31_BCL2L11      ttatcttgcgactgttacgttacattgtccgcctggtgtggaggaggcat
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      ---------------ctcctggcatcctccacctga--------------
A0A2K5X2I7_BCL2L11      ---------------ctcctggcatcctccacctga--------------
F7HHA9_BCL2L11-05       ---------------ctcctggcatcctccacctga--------------
A0A2K5Z8B6_BCL2L11      ---------------ctcctggcatcctccacctga--------------
A0A2K5HZI7_BCL2L11      ---------------ctcctggcatcctccacctga--------------
A0A2K6QIL2_BCL2L11      ---------------ctcctggcatcctccacctga--------------
A0A2K6KJP8_BCL2L11      ---------------cttctggcatcctccacctga--------------
O43521_BCL2L11-13       ---------------ctcctggcatcctccacctga--------------
O43521_BCL2L11-17       ---------------ctcctggcatcctccacctga--------------
A0A2J8JCT2_BCL2L11      ---------------ctcctggcatcctccacctga--------------
A0A2I3HW02_BCL2L11      ---------------ctcctggcatcctccacctga--------------
A0A2I2YQ13_BCL2L11      ---------------ctcctggcatcctccacctga--------------
A0A2R9CA99_BCL2L11      ---------------ctcctg---tcctccacctga--------------
F6XMC1_BCL2L11-01       cccaaagaattatttctggtaatattctccaatctgtggccagatggtgc
F6XMC1_BCL2L11-02       cccaaagaattatttctggtaatattctccaatctgtggccagatggtgc
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2K5CAB2_BCL2L11      ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2K5CAB2_BCL2L11      ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2K6TRZ5_BCL2L11      ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2K6TRZ5_BCL2L11      ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       ttatcttacgactgttacgttacattgtccgcctggtatggagaatgcat
A0A2K6E226_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
O43521_BCL2L11-03       ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2J8JCT2_BCL2L11      ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2J8JCT2_BCL2L11      ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2I3HW02_BCL2L11      ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2R9CA99_BCL2L11      ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2I2YQ13_BCL2L11      ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2R9CA99_BCL2L11      ttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcat
A0A2I3M6I1_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggaggatgcat
A0A2I3M6I1_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggaggatgcat
A0A2I3M6I1_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggaggatgcat
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K5X2I7_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K6E226_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K6E226_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K5Z8B6_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K5NU92_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K5X2I7_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K6E226_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K5Z8B6_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K5HZI7_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K6QIL2_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K6QIL2_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K6QIL2_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K6KJP8_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
A0A2K6KJP8_BCL2L11      ttatcttacgactgttgcgttacattgtccgcctggtgtggagaatgcat
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      ---------------------------tcaagctaa--------------
A0A2I2YQ13_BCL2L11      ---------------------------tcaagctaa--------------
O43521_BCL2L11-23       ---------------------------tcaagctaa--------------
A0A2R9CA99_BCL2L11      ---------------------------tcaagctaa--------------
A0A2J8JCT2_BCL2L11      ---------------------------tcaagctaa--------------
A0A2I3M6I1_BCL2L11      ---------------------------tcaagctaa--------------
A0A2K5X2I7_BCL2L11      ---------------------------tcaagctaa--------------
F7HHA9_BCL2L11-07       ---------------------------------taa--------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      ---------------------------tcaagctaa--------------
A0A2K5Z8B6_BCL2L11      ---------------------------tcaagctaa--------------
A0A2K5CAB2_BCL2L11      ---------------------------tcaagctga--------------
A0A2K6TRZ5_BCL2L11      ---------------------------tcaagctga--------------
G3SU55_BCL2L11-01       ttatcttacgtctcttacgctacatcgtccgcctggtgtggaga------
M3YDI3_BCL2L11-01       ttatcttacgactgttacgttacatcatccgcctggtgtggagattacag
A0A337SW42_BCL2L11      ---------------------gcatcctacatctga--------------
G1LDR8_BCL2L11-01       ttatcttgcgactgttacgttacatcgtccgcctggtgtggagattgcag
J9NWV6_BCL2L11-01       ttatcttacgactgttacgttacatcgtccgcctggtgtggagattgcag
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      ttatcttacgactgttacgttacatcgtccgcctggtatggcgattgcag
A0A337SW42_BCL2L11      ttatcttacgactgttacgttacatcgtccgcctggtatggcgattgcag

B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       tga-----------------------------------------------
F7FTC8_BCL2L11-01       tga-----------------------------------------------
G1MV54_BCL2L11-01       tga-----------------------------------------------
K7GA86_BCL2L11-01       taa-----------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       tga-----------------------------------------------
G3W979_BCL2L11-01       tga-----------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       tga-----------------------------------------------
W5PY58_BCL2L11-01       tga-----------------------------------------------
A0A1U8BW10_BCL2L11      tga-----------------------------------------------
A0A1U8BW10_BCL2L11      tga-----------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       tga-----------------------------------------------
O88498_BCL2L11-01       tga-----------------------------------------------
O88498_BCL2L11-02       tga-----------------------------------------------
O54918_BCL2L11-01       tga-----------------------------------------------
O54918_BCL2L11-05       tga-----------------------------------------------
O54918_BCL2L11-06       tga-----------------------------------------------
O54918_BCL2L11-08       tga-----------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      tga-----------------------------------------------
A0A286XJN2_BCL2L11      tga-----------------------------------------------
A0A286XJN2_BCL2L11      tga-----------------------------------------------
F7A7D2_BCL2L11-01       tga-----------------------------------------------
F1SU81_BCL2L11-01       tga-----------------------------------------------
C1KGB8_BCL2L11-01       taa-----------------------------------------------
F1SU81_BCL2L11-02       taa-----------------------------------------------
F1SU81_BCL2L11-03       taa-----------------------------------------------
A0A287DFJ0_BCL2L11      tga-----------------------------------------------
A0A287DFJ0_BCL2L11      tga-----------------------------------------------
H0XW23_BCL2L11-01       tga-----------------------------------------------
A0A1S3FHA8_BCL2L11      tga-----------------------------------------------
A0A1S3FHA8_BCL2L11      tga-----------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      taa-----------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      tga-----------------------------------------------
A0A2K6GE31_BCL2L11      tga-----------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       caaatgatgttgaccccacagctgtacttggttctcaaggacggtggccc
F6XMC1_BCL2L11-02       caaatgatgttgaccccacagctgtacttggttctcaaggacggtggccc
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       tga-----------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      tga-----------------------------------------------
A0A2K5CAB2_BCL2L11      tga-----------------------------------------------
A0A2K5CAB2_BCL2L11      tga-----------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      tga-----------------------------------------------
A0A2K6TRZ5_BCL2L11      tga-----------------------------------------------
A0A2K6TRZ5_BCL2L11      tga-----------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       tga-----------------------------------------------
A0A2K6E226_BCL2L11      tga-----------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       tga-----------------------------------------------
O43521_BCL2L11-03       tga-----------------------------------------------
A0A2J8JCT2_BCL2L11      tga-----------------------------------------------
A0A2J8JCT2_BCL2L11      tga-----------------------------------------------
A0A2I3HW02_BCL2L11      tga-----------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      tga-----------------------------------------------
A0A2R9CA99_BCL2L11      tga-----------------------------------------------
A0A2I2YQ13_BCL2L11      tga-----------------------------------------------
A0A2R9CA99_BCL2L11      tga-----------------------------------------------
A0A2I3M6I1_BCL2L11      tga-----------------------------------------------
A0A2I3M6I1_BCL2L11      tga-----------------------------------------------
A0A2I3M6I1_BCL2L11      tga-----------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      tga-----------------------------------------------
A0A2K5X2I7_BCL2L11      tga-----------------------------------------------
A0A2K6E226_BCL2L11      tga-----------------------------------------------
A0A2K6E226_BCL2L11      tga-----------------------------------------------
A0A2K5Z8B6_BCL2L11      tga-----------------------------------------------
A0A2K5NU92_BCL2L11      tga-----------------------------------------------
A0A2K5X2I7_BCL2L11      tga-----------------------------------------------
A0A2K6E226_BCL2L11      tga-----------------------------------------------
A0A2K5Z8B6_BCL2L11      tga-----------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      tga-----------------------------------------------
A0A2K5HZI7_BCL2L11      tga-----------------------------------------------
A0A2K6QIL2_BCL2L11      tga-----------------------------------------------
A0A2K6QIL2_BCL2L11      tga-----------------------------------------------
A0A2K6QIL2_BCL2L11      tga-----------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      tga-----------------------------------------------
A0A2K6KJP8_BCL2L11      tga-----------------------------------------------
A0A2K6KJP8_BCL2L11      tga-----------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       tga-----------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       tga-----------------------------------------------
J9NWV6_BCL2L11-01       tga-----------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      tga-----------------------------------------------
A0A337SW42_BCL2L11      tga-----------------------------------------------

B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
A0A1U8BW10_BCL2L11      --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
F7A7D2_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A1S3FHA8_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-01       cgtggtcaaatctgctttaaaactgccatggttccactctccagtggcat
F6XMC1_BCL2L11-02       cgtggtcaaatctgctttaaaactgccatggttccactctccagtggcat
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------

B2KKY9_BCL2L11-01       --
B8JK68_BCL2L11-01       --
Q4KMV9_BCL2L11-01       --
M3XHJ5_BCL2L11-01       --
U3IW89_BCL2L11-01       --
R4G9R5_BCL2L11-01       --
F7FTC8_BCL2L11-01       --
G1MV54_BCL2L11-01       --
K7GA86_BCL2L11-01       --
G1PDJ5_BCL2L11-01       --
F7CXT2_BCL2L11-01       --
G3W979_BCL2L11-01       --
O43521_BCL2L11-11       --
F7HHA9_BCL2L11-08       --
Q2YDF0_BCL2L11-01       --
W5PY58_BCL2L11-01       --
A0A1U8BW10_BCL2L11      --
A0A1U8BW10_BCL2L11      --
A0A1U8BW10_BCL2L11      --
O54918_BCL2L11-03       --
O88498_BCL2L11-01       --
O88498_BCL2L11-02       --
O54918_BCL2L11-01       --
O54918_BCL2L11-05       --
O54918_BCL2L11-06       --
O54918_BCL2L11-08       --
G1SSY0_BCL2L11-01       --
A0A286XJN2_BCL2L11      --
A0A286XJN2_BCL2L11      --
A0A286XJN2_BCL2L11      --
F7A7D2_BCL2L11-01       --
F1SU81_BCL2L11-01       --
C1KGB8_BCL2L11-01       --
F1SU81_BCL2L11-02       --
F1SU81_BCL2L11-03       --
A0A287DFJ0_BCL2L11      --
A0A287DFJ0_BCL2L11      --
H0XW23_BCL2L11-01       --
A0A1S3FHA8_BCL2L11      --
A0A1S3FHA8_BCL2L11      --
A0A2K6GE31_BCL2L11      --
A0A2K6GE31_BCL2L11      --
A0A2K6GE31_BCL2L11      --
A0A2K6GE31_BCL2L11      --
A0A2K6GE31_BCL2L11      --
A0A2K6GE31_BCL2L11      --
A0A2I3HW02_BCL2L11      --
A0A2R9CA99_BCL2L11      --
A0A2J8JCT2_BCL2L11      --
A0A2I2YQ13_BCL2L11      --
O43521_BCL2L11-06       --
O43521_BCL2L11-15       --
A0A2K5X2I7_BCL2L11      --
F7HHA9_BCL2L11-09       --
A0A2K6E226_BCL2L11      --
A0A2K5NU92_BCL2L11      --
A0A2K5Z8B6_BCL2L11      --
A0A2I3M6I1_BCL2L11      --
A0A2K5HZI7_BCL2L11      --
A0A2K6KJP8_BCL2L11      --
A0A2K6QIL2_BCL2L11      --
F6XMC1_BCL2L11-09       --
A0A2K5CAB2_BCL2L11      --
A0A2K6TRZ5_BCL2L11      --
A0A2K5NU92_BCL2L11      --
A0A2K5X2I7_BCL2L11      --
F7HHA9_BCL2L11-05       --
A0A2K5Z8B6_BCL2L11      --
A0A2K5HZI7_BCL2L11      --
A0A2K6QIL2_BCL2L11      --
A0A2K6KJP8_BCL2L11      --
O43521_BCL2L11-13       --
O43521_BCL2L11-17       --
A0A2J8JCT2_BCL2L11      --
A0A2I3HW02_BCL2L11      --
A0A2I2YQ13_BCL2L11      --
A0A2R9CA99_BCL2L11      --
F6XMC1_BCL2L11-01       ga
F6XMC1_BCL2L11-02       ga
F6XMC1_BCL2L11-06       --
A0A2K5CAB2_BCL2L11      --
A0A2K6TRZ5_BCL2L11      --
F6XMC1_BCL2L11-08       --
A0A2K5CAB2_BCL2L11      --
A0A2K6TRZ5_BCL2L11      --
F6XMC1_BCL2L11-04       --
F6XMC1_BCL2L11-03       --
A0A2K5CAB2_BCL2L11      --
A0A2K5CAB2_BCL2L11      --
A0A2K5CAB2_BCL2L11      --
A0A2K5CAB2_BCL2L11      --
A0A2K6TRZ5_BCL2L11      --
A0A2K6TRZ5_BCL2L11      --
A0A2K6TRZ5_BCL2L11      --
A0A2K6TRZ5_BCL2L11      --
A0A2K5CAB2_BCL2L11      --
A0A2K6TRZ5_BCL2L11      --
F6XMC1_BCL2L11-05       --
F6XMC1_BCL2L11-07       --
A0A2K5CAB2_BCL2L11      --
A0A2K6TRZ5_BCL2L11      --
H2P5E2_BCL2L11-01       --
A0A2K6E226_BCL2L11      --
O43521_BCL2L11-21       --
O43521_BCL2L11-02       --
O43521_BCL2L11-03       --
A0A2J8JCT2_BCL2L11      --
A0A2J8JCT2_BCL2L11      --
A0A2I3HW02_BCL2L11      --
A0A2I2YQ13_BCL2L11      --
A0A2I3HW02_BCL2L11      --
A0A2R9CA99_BCL2L11      --
A0A2J8JCT2_BCL2L11      --
A0A2I2YQ13_BCL2L11      --
A0A2R9CA99_BCL2L11      --
A0A2I2YQ13_BCL2L11      --
A0A2R9CA99_BCL2L11      --
A0A2I3M6I1_BCL2L11      --
A0A2I3M6I1_BCL2L11      --
A0A2I3M6I1_BCL2L11      --
A0A2K5NU92_BCL2L11      --
A0A2K5X2I7_BCL2L11      --
F7HHA9_BCL2L11-01       --
A0A2K6E226_BCL2L11      --
A0A2K5Z8B6_BCL2L11      --
A0A2I3M6I1_BCL2L11      --
A0A2K5NU92_BCL2L11      --
A0A2K5X2I7_BCL2L11      --
A0A2K6E226_BCL2L11      --
A0A2K6E226_BCL2L11      --
A0A2K5Z8B6_BCL2L11      --
A0A2K5NU92_BCL2L11      --
A0A2K5X2I7_BCL2L11      --
A0A2K6E226_BCL2L11      --
A0A2K5Z8B6_BCL2L11      --
A0A2K5HZI7_BCL2L11      --
A0A2K5HZI7_BCL2L11      --
A0A2K5HZI7_BCL2L11      --
A0A2K6QIL2_BCL2L11      --
A0A2K6QIL2_BCL2L11      --
A0A2K6QIL2_BCL2L11      --
A0A2K6KJP8_BCL2L11      --
A0A2K6QIL2_BCL2L11      --
A0A2K6KJP8_BCL2L11      --
A0A2K6KJP8_BCL2L11      --
A0A2K6KJP8_BCL2L11      --
Q6JTU4_BCL2L11-01       --
O43521_BCL2L11-25       --
O43521_BCL2L11-05       --
O43521_BCL2L11-18       --
O43521_BCL2L11-10       --
O43521_BCL2L11-20       --
O43521_BCL2L11-09       --
O43521_BCL2L11-16       --
A0A2K6KJP8_BCL2L11      --
A0A2K6QIL2_BCL2L11      --
A0A2K5HZI7_BCL2L11      --
O43521_BCL2L11-22       --
O43521_BCL2L11-08       --
A0A2I2YQ13_BCL2L11      --
A0A2I3HW02_BCL2L11      --
A0A2R9CA99_BCL2L11      --
A0A2J8JCT2_BCL2L11      --
A0A2K5NU92_BCL2L11      --
A0A2K5X2I7_BCL2L11      --
F7HHA9_BCL2L11-03       --
A0A2K6E226_BCL2L11      --
A0A2K5Z8B6_BCL2L11      --
A0A2I3M6I1_BCL2L11      --
O43521_BCL2L11-19       --
O43521_BCL2L11-07       --
A0A2I2YQ13_BCL2L11      --
A0A2R9CA99_BCL2L11      --
A0A2J8JCT2_BCL2L11      --
A0A2J8JCT2_BCL2L11      --
A0A2I2YQ13_BCL2L11      --
A0A2R9CA99_BCL2L11      --
A0A2I3HW02_BCL2L11      --
A0A2K6KJP8_BCL2L11      --
A0A2K6QIL2_BCL2L11      --
O43521_BCL2L11-12       --
O43521_BCL2L11-24       --
A0A2I2YQ13_BCL2L11      --
A0A2I3HW02_BCL2L11      --
A0A2R9CA99_BCL2L11      --
A0A2J8JCT2_BCL2L11      --
A0A2K5NU92_BCL2L11      --
A0A2K5X2I7_BCL2L11      --
F7HHA9_BCL2L11-06       --
A0A2K6E226_BCL2L11      --
A0A2K5Z8B6_BCL2L11      --
A0A2I3M6I1_BCL2L11      --
A0A2K5HZI7_BCL2L11      --
A0A2K6KJP8_BCL2L11      --
A0A2K6QIL2_BCL2L11      --
A0A2K5HZI7_BCL2L11      --
A0A2K5NU92_BCL2L11      --
A0A2K5X2I7_BCL2L11      --
F7HHA9_BCL2L11-04       --
A0A2K6E226_BCL2L11      --
A0A2K5Z8B6_BCL2L11      --
A0A2I3M6I1_BCL2L11      --
A0A0D9RWE0_BCL2L11      --
A0A2K5NU92_BCL2L11      --
A0A2K5X2I7_BCL2L11      --
F7HHA9_BCL2L11-02       --
A0A2K6E226_BCL2L11      --
A0A2K5Z8B6_BCL2L11      --
A0A2I3M6I1_BCL2L11      --
A0A2K6KJP8_BCL2L11      --
A0A2K6QIL2_BCL2L11      --
A0A2K5HZI7_BCL2L11      --
A0A2I3HW02_BCL2L11      --
A0A2I2YQ13_BCL2L11      --
O43521_BCL2L11-23       --
A0A2R9CA99_BCL2L11      --
A0A2J8JCT2_BCL2L11      --
A0A2I3M6I1_BCL2L11      --
A0A2K5X2I7_BCL2L11      --
F7HHA9_BCL2L11-07       --
A0A2K5HZI7_BCL2L11      --
A0A2K5NU92_BCL2L11      --
A0A2K5Z8B6_BCL2L11      --
A0A2K5CAB2_BCL2L11      --
A0A2K6TRZ5_BCL2L11      --
G3SU55_BCL2L11-01       --
M3YDI3_BCL2L11-01       --
A0A337SW42_BCL2L11      --
G1LDR8_BCL2L11-01       --
J9NWV6_BCL2L11-01       --
A0A337SW42_BCL2L11      --
A0A337SW42_BCL2L11      --
A0A337SW42_BCL2L11      --
A0A337SW42_BCL2L11      --
A0A337SW42_BCL2L11      --

© 1998-2019