Dataset for CDS BCL2L11 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

245 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B3QC78_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
W5UEE7_BCL2L11-01       --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       ------------------------------------atggggcgggcagg
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
Q2YDF0_BCL2L11-02       --------------------------------------------------
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcg
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
                                                                          

A0A3B3QC78_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
W5UEE7_BCL2L11-01       --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       gcgcgggccgggagctgcacaatcagtgcaggcgccgcgccgcgtcccag
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
Q2YDF0_BCL2L11-02       --------------------------------------------------
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       cggagccctcggctgccggacggctcgcggcggcgggcgggctgccagtg
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
                                                                          

A0A3B3QC78_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
W5UEE7_BCL2L11-01       --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       ccttttgtcccgtggcgggggggtccgagcgcgcggctgcccgattccca
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
Q2YDF0_BCL2L11-02       --------------------------------------------------
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       gccggctctgcgctgccccgggggctctgaaggcgagtcccaggctttgt
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
                                                                          

A0A3B3QC78_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      -----------------------------atgtcca--------------
W5UEE7_BCL2L11-01       --------------------------atgctctttgctcgtcgtcgtcgg
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------cttctgtccgccagaaaagctcgt
A0A3B4BVX1_BCL2L11      -----------------------------atgtcca--------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       gctccggccggggcggactcggagcgccggggtctggctgaggaattgct
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
Q2YDF0_BCL2L11-02       --------------------------------------------------
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       ------------------------------atgccgctcagcgtgcggag
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       ctcccgcgcttctttcgtgctgagggtcagggagctccgggtcggcgaag
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
                                                                          

A0A3B3QC78_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
W5UEE7_BCL2L11-01       tttttcttctgtccttggtctcctgaagccgtatgccccagaaacatgtc
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      ttcagtgtttgcccgtgttcttctccggaggaccgtatacatcaccttcc
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      -----------------atgaaagcccaggctgacggtgccgctctattc
A0A3B4XZH1_BCL2L11      -----------------atgaaagcccaggctgacggtgccgctctattc
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      ---------------------------atgctcacggtgacgctctgttc
A0A3B5QAM1_BCL2L11      ---------------------------atgctcacggtgacgctctgttc
A0A3B5QAM1_BCL2L11      ---------------------------atgc--------actcttta---
A0A3B3VNE0_BCL2L11      ---------------------------atgc--------actcttca---
A0A3B3YII5_BCL2L11      ---------------------------atgc--------actcttta---
A0A3B3YII5_BCL2L11      ---------------------------atgc--------actcttta---
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       -------------------------------------------------t
K7GA86_BCL2L11-01       cttggagcctgactcgcttttgttcagacaaagcctttctgcgagttact
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
Q2YDF0_BCL2L11-02       --------------------------------------------------
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       ttacttgtggatttggctggggtcgccaggagccggcttgggggaccttg
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-01       --------------------------------------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       gacgcgagcgggacgccgcggggctcgggcccggacgcgacggtcggaag
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
                                                                          

A0A3B3QC78_BCL2L11      --------------------------atgggacaaattctattaacgatc
B2KKY9_BCL2L11-01       --------------------------atgtctgacacgtccagagagcaa
B8JK68_BCL2L11-01       --------------------------atgtctgacacgtccagagagcaa
Q4KMV9_BCL2L11-01       --------------------------atggc--------caaa----caa
M3XHJ5_BCL2L11-01       --------------------------atgccaacagaggaaagtttacaa
A0A3B1JXK6_BCL2L11      --------gaccgtcaaaccgggccacccgc-----------c----cac
W5UEE7_BCL2L11-01       ca------aacggcaataccgggccgatggc-----------c----cag
A0A3B4BVX1_BCL2L11      ---------------atgcagaacagtaatt-----------a----ctg
A0A3B4BVX1_BCL2L11      tcattatctgcggtcaaaccgggccggccgc-----------c----cag
A0A3B4BVX1_BCL2L11      --------ggcggtcaaaccgggccggccgc-----------c----cag
A0A3B4V919_BCL2L11      atccaacagaccacaaaaccggtccgatggc-------------------
A0A3B4XZH1_BCL2L11      atccaacagaccacaaaaccggtccgatggc-------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      atccaacagaccgccaaatctgctcgatggc-------------------
A0A3B5QAM1_BCL2L11      atccaacagaccgccaaatctgctcgatggc-------------------
A0A3B5QAM1_BCL2L11      -------agaccgccaaatctgctcgatggc-------------------
A0A3B3VNE0_BCL2L11      -------agaccgccaaatctgctcgatggc-------------------
A0A3B3YII5_BCL2L11      -------agaccgccaaatctgctcgatggc-------------------
A0A3B3YII5_BCL2L11      -------agaccgccaaatctgctcgatggc-------------------
R4G9R5_BCL2L11-01       --------------------------atgctggtcgttggaag----cag
F7FTC8_BCL2L11-01       --------------------------atggc--------caag----caa
G1MV54_BCL2L11-01       ttttg---------------------------------------------
K7GA86_BCL2L11-01       ctttggacgcaggaaaaggcgaccaaatggc--------aaag----caa
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------atggc--------aaaa----caa
G3W979_BCL2L11-01       --------------------------atggc--------aaag----caa
O43521_BCL2L11-11       --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-08       --------------------------atggc--------aaag----caa
G1SSY0_BCL2L11-01       --------------------------atggc--------caag----caa
O54918_BCL2L11-03       --------------------------atggc--------caag----caa
O88498_BCL2L11-01       --------------------------atggc--------caag----caa
O88498_BCL2L11-02       --------------------------atggc--------caag----caa
O54918_BCL2L11-05       --------------------------atggc--------caag----caa
O54918_BCL2L11-01       --------------------------atggc--------caag----caa
O54918_BCL2L11-08       --------------------------atggc--------caag----caa
O54918_BCL2L11-06       --------------------------atggc--------caag----caa
W5PY58_BCL2L11-01       --------------------------atggc--------aaag----caa
Q2YDF0_BCL2L11-02       --------------------------atggc--------aaag----caa
Q2YDF0_BCL2L11-03       --------------------------atggc--------aaag----caa
Q2YDF0_BCL2L11-01       ctcccattcggagaaaaaaagaccaaatggc--------aaag----caa
A0A286XJN2_BCL2L11      --------------------------atggc--------caag----caa
A0A286XJN2_BCL2L11      --------------------------atggc--------caag----caa
A0A286XJN2_BCL2L11      --------------------------atggc--------caag----caa
A0A287DFJ0_BCL2L11      --------------------------atggc--------aaag----caa
A0A287DFJ0_BCL2L11      --------------------------atggc--------aaag----caa
H0XW23_BCL2L11-01       --------------------------atggc--------aaag----caa
A0A2K6GE31_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6GE31_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6GE31_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6GE31_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6GE31_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6GE31_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-06       --------------------------atggc--------aaag----caa
O43521_BCL2L11-15       --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-09       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-09       --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-05       --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-13       --------------------------atggc--------aaag----caa
O43521_BCL2L11-17       --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-02       --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-01       --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-06       --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-08       --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-03       --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-04       --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-05       --------------------------atggc--------aaag----caa
F6XMC1_BCL2L11-07       --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
H2P5E2_BCL2L11-01       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-21       --------------------------atggc--------aaag----caa
O43521_BCL2L11-02       --------------------------atggc--------aaag----caa
O43521_BCL2L11-03       --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-01       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
Q6JTU4_BCL2L11-01       --------------------------atg---------------------
O43521_BCL2L11-05       --------------------------atggc--------aaag----caa
O43521_BCL2L11-25       --------------------------atggc--------aaag----caa
O43521_BCL2L11-18       --------------------------atggc--------aaag----caa
O43521_BCL2L11-09       --------------------------atggc--------aaag----caa
O43521_BCL2L11-16       --------------------------atggc--------aaag----caa
O43521_BCL2L11-10       --------------------------atggc--------aaag----caa
O43521_BCL2L11-20       --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-22       --------------------------atggc--------aaag----caa
O43521_BCL2L11-08       --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-03       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-07       --------------------------atggc--------aaag----caa
O43521_BCL2L11-19       --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-24       --------------------------atggc--------aaag----caa
O43521_BCL2L11-12       --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-06       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-04       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A0D9RWE0_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-02       --------------------------atggc--------aaag----caa
A0A2K6E226_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6KJP8_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6QIL2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3HW02_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I2YQ13_BCL2L11      --------------------------atggc--------aaag----caa
O43521_BCL2L11-23       --------------------------atggc--------aaag----caa
A0A2R9CA99_BCL2L11      --------------------------atggc--------aaag----caa
A0A2J8JCT2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2I3M6I1_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5X2I7_BCL2L11      --------------------------atggc--------aaag----caa
F7HHA9_BCL2L11-07       --------------------------atggc--------aaag----caa
A0A2K5HZI7_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5NU92_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5Z8B6_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K5CAB2_BCL2L11      --------------------------atggc--------aaag----caa
A0A2K6TRZ5_BCL2L11      --------------------------atggc--------aaag----caa
F1SU81_BCL2L11-01       --------------------------atggc--------aaag----caa
C1KGB8_BCL2L11-01       --------------------------atggc--------aaag----caa
F1SU81_BCL2L11-02       --------------------------atggc--------aaag----caa
F1SU81_BCL2L11-03       --------------------------atggc--------aaag----caa
G3SU55_BCL2L11-01       --------------------------atggc--------aaag----caa
M3YDI3_BCL2L11-01       ggaaggggcggacaaaaaaagaccaaatggc--------aaag----caa
A0A337SW42_BCL2L11      --------------------------atggc--------aaag----caa
G1LDR8_BCL2L11-01       --------------------------atggc--------aaag----caa
J9NWV6_BCL2L11-01       --------------------------atggc--------aaag----caa
A0A337SW42_BCL2L11      --------------------------atggc--------aaag----caa
A0A337SW42_BCL2L11      --------------------------atggc--------aaag----caa
A0A337SW42_BCL2L11      --------------------------atggc--------aaag----caa
A0A337SW42_BCL2L11      --------------------------atggc--------aaag----caa
A0A337SW42_BCL2L11      --------------------------atggc--------aaag----caa
                                                                          

A0A3B3QC78_BCL2L11      ccc------------------tgctctgtctgttctgcagaggacaaaat
B2KKY9_BCL2L11-01       acgctggccaatggcccggcctcgcagggaagcggaga-----------g
B8JK68_BCL2L11-01       acgctggccaatggcccggcctcgcagggaagcggaga-----------g
Q4KMV9_BCL2L11-01       ccg------------------tcggtcttgagtccggactgta-----at
M3XHJ5_BCL2L11-01       tttgacaaagaccaaggtacatcagatgtaatttctga--atg-------
A0A3B1JXK6_BCL2L11      cct------------------tct-----------taa--agg-----ag
W5UEE7_BCL2L11-01       cct------------------tct-----------taa--agg-----ag
A0A3B4BVX1_BCL2L11      ctg------------------ttt-----------t------g-----ag
A0A3B4BVX1_BCL2L11      cct------------------tct-----------taa--agg-----ag
A0A3B4BVX1_BCL2L11      cct------------------tct-----------taa--agg-----ag
A0A3B4V919_BCL2L11      tcg------------------accgcagtaacggcaag--agg------g
A0A3B4XZH1_BCL2L11      tcg------------------accgcagtaacggcaag--agg------g
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      tcg------------------accgaagtaacgccagc--aga------g
A0A3B5QAM1_BCL2L11      tcg------------------accgaagtaacgccagc--aga------g
A0A3B5QAM1_BCL2L11      tcg------------------accgaagtaacgccagc--aga------g
A0A3B3VNE0_BCL2L11      tcg------------------accgaagtaacgccagc--aga------g
A0A3B3YII5_BCL2L11      tcg------------------accgaagtaacgccagc--aga------g
A0A3B3YII5_BCL2L11      tcg------------------accgaagtaacgccagc--aga------g
R4G9R5_BCL2L11-01       cca------------------gccac----agctttgc--ttg-----ct
F7FTC8_BCL2L11-01       cct------------------tccgacctaaattctga--atg------t
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       cct------------------tctgatctgaattcaga--gtg------c
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       ccg------------------tcagatctaaattctga--gtg------t
G3W979_BCL2L11-01       ccg------------------tcagatctaaattctga--gtg------t
O43521_BCL2L11-11       cct------------------tctgatgtaagttctga--gtg------t
F7HHA9_BCL2L11-08       cct------------------tctgatgtaagttctga--gtg------t
G1SSY0_BCL2L11-01       cct------------------tccgatgtaagttctga--gtg------t
O54918_BCL2L11-03       cct------------------tctgatgtaagttctga--gtg------t
O88498_BCL2L11-01       cct------------------tctgatgtaaattctga--gtg------t
O88498_BCL2L11-02       cct------------------tctgatgtaaattctga--gtg------t
O54918_BCL2L11-05       cct------------------tctgatgtaagttctga--gtg------t
O54918_BCL2L11-01       cct------------------tctgatgtaagttctga--gtg------t
O54918_BCL2L11-08       cct------------------tctgatgtaagttctga--gtg------t
O54918_BCL2L11-06       cct------------------tctgatgtaagttctga--gtg------t
W5PY58_BCL2L11-01       cct------------------tccgatgtaagttctga--gtg------t
Q2YDF0_BCL2L11-02       cct------------------tccgatgtaagttctga--gtg------t
Q2YDF0_BCL2L11-03       cct------------------tccgatgtaagttctga--gtg------t
Q2YDF0_BCL2L11-01       cct------------------tccgatgtaagttctga--gtg------t
A0A286XJN2_BCL2L11      cct------------------tccgatgtaagttgtga--gtg------t
A0A286XJN2_BCL2L11      cct------------------tccgatgtaagttgtga--gtg------t
A0A286XJN2_BCL2L11      cct------------------tccgatgtaagttgtga--gtg------t
A0A287DFJ0_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A287DFJ0_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
H0XW23_BCL2L11-01       cct------------------tcagatgtaggttctga--gtg------t
A0A2K6GE31_BCL2L11      cct------------------tccgatgtaggttctga--gtg------t
A0A2K6GE31_BCL2L11      cct------------------tccgatgtaggttctga--gtg------t
A0A2K6GE31_BCL2L11      cct------------------tccgatgtaggttctga--gtg------t
A0A2K6GE31_BCL2L11      cct------------------tccgatgtaggttctga--gtg------t
A0A2K6GE31_BCL2L11      cct------------------tccgatgtaggttctga--gtg------t
A0A2K6GE31_BCL2L11      cct------------------tccgatgtaggttctga--gtg------t
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-06       cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-15       cct------------------tctgatgtaagttctga--gtg------t
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
F7HHA9_BCL2L11-09       cct------------------tctgatgtaagttctga--gtg------t
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
F6XMC1_BCL2L11-09       cct------------------tccgatgtaagttctga--gtg------t
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
F7HHA9_BCL2L11-05       cct------------------tctgatgtaagttctga--gtg------t
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-13       cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-17       cct------------------tctgatgtaagttctga--gtg------t
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
F6XMC1_BCL2L11-02       cct------------------tccgatgtaagttctga--gtg------t
F6XMC1_BCL2L11-01       cct------------------tccgatgtaagttctga--gtg------t
F6XMC1_BCL2L11-06       cct------------------tccgatgtaagttctga--gtg------t
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
F6XMC1_BCL2L11-08       cct------------------tccgatgtaagttctga--gtg------t
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
F6XMC1_BCL2L11-03       cct------------------tccgatgtaagttctga--gtg------t
F6XMC1_BCL2L11-04       cct------------------tccgatgtaagttctga--gtg------t
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
F6XMC1_BCL2L11-05       cct------------------tccgatgtaagttctga--gtg------t
F6XMC1_BCL2L11-07       cct------------------tccgatgtaagttctga--gtg------t
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
H2P5E2_BCL2L11-01       cct------------------tctgatgtaagttctga--gtg------t
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-21       cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-02       cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-03       cct------------------tctgatgtaagttctga--gtg------t
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
F7HHA9_BCL2L11-01       cct------------------tctgatgtaagttctga--gtg------t
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-25       cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-18       cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-09       cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-16       cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-10       cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-20       cct------------------tctgatgtaagttctga--gtg------t
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-22       cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-08       cct------------------tctgatgtaagttctga--gtg------t
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
F7HHA9_BCL2L11-03       cct------------------tctgatgtaagttctga--gtg------t
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-07       cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-19       cct------------------tctgatgtaagttctga--gtg------t
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-24       cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-12       cct------------------tctgatgtaagttctga--gtg------t
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
F7HHA9_BCL2L11-06       cct------------------tctgatgtaagttctga--gtg------t
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
F7HHA9_BCL2L11-04       cct------------------tctgatgtaagttctga--gtg------t
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A0D9RWE0_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
F7HHA9_BCL2L11-02       cct------------------tctgatgtaagttctga--gtg------t
A0A2K6E226_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6KJP8_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K6QIL2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3HW02_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I2YQ13_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
O43521_BCL2L11-23       cct------------------tctgatgtaagttctga--gtg------t
A0A2R9CA99_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2J8JCT2_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2I3M6I1_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5X2I7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
F7HHA9_BCL2L11-07       cct------------------tctgatgtaagttctga--gtg------t
A0A2K5HZI7_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5NU92_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5Z8B6_BCL2L11      cct------------------tctgatgtaagttctga--gtg------t
A0A2K5CAB2_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
A0A2K6TRZ5_BCL2L11      cct------------------tccgatgtaagttctga--gtg------t
F1SU81_BCL2L11-01       cct------------------tccgatgtaagttctga--gtg------t
C1KGB8_BCL2L11-01       cct------------------tccgatgtaagttctga--gtg------t
F1SU81_BCL2L11-02       cct------------------tccgatgtaagttctga--gtg------t
F1SU81_BCL2L11-03       cct------------------tccgatgtaagttctga--gtg------t
G3SU55_BCL2L11-01       cct------------------tcagatgtaagttctga--gtg------t
M3YDI3_BCL2L11-01       cct------------------tcagatgtaagttctga--gtg------t
A0A337SW42_BCL2L11      cct------------------tcagatgtaagttctga--gtg------t
G1LDR8_BCL2L11-01       cct------------------tcagatgtaagttctga--gtg------t
J9NWV6_BCL2L11-01       cct------------------tcagatgtaagttctga--gtg------t
A0A337SW42_BCL2L11      cct------------------tcagatgtaagttctga--gtg------t
A0A337SW42_BCL2L11      cct------------------tcagatgtaagttctga--gtg------t
A0A337SW42_BCL2L11      cct------------------tcagatgtaagttctga--gtg------t
A0A337SW42_BCL2L11      cct------------------tcagatgtaagttctga--gtg------t
A0A337SW42_BCL2L11      cct------------------tcagatgtaagttctga--gtg------t
                                                                          

A0A3B3QC78_BCL2L11      cacacgaatggcggagag---------------------------tcgca
B2KKY9_BCL2L11-01       agcaccggtggcggagtg---------------------------gtgtt
B8JK68_BCL2L11-01       agcaccggtggcggagtg---------------------------gtgtt
Q4KMV9_BCL2L11-01       agtggtgaaggtggccag---------------------------ttaca
M3XHJ5_BCL2L11-01       -----------tggacat---------------------------ttgca
A0A3B1JXK6_BCL2L11      cagggggaacgcggccag---agcggcgggggcggcggaacattgtcccg
W5UEE7_BCL2L11-01       catgggggacgcggagag---agcg------------------cctcccg
A0A3B4BVX1_BCL2L11      cagggggagagtggtcag---agcagcgga------gcagcctcctcccg
A0A3B4BVX1_BCL2L11      cagggggagagtggtcag---agcagcgga------gcagcctcctcccg
A0A3B4BVX1_BCL2L11      cagggggagagtggtcag---agcagcgga------gcagcctcctcccg
A0A3B4V919_BCL2L11      gagagcgaaggggatccacca--------------------ctcgtcggt
A0A3B4XZH1_BCL2L11      gagagcgaaggggatccacca--------------------ctcgtcggt
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      gggaccggcggagacccagcatcctcagcgcgaacaccacgttcctcgaa
A0A3B5QAM1_BCL2L11      gggaccggcggagacccagcatcctcagcgcgaacaccacgttcctcgaa
A0A3B5QAM1_BCL2L11      gggaccggcggagacccagcatcctcagcgcgaacaccacgttcctcgaa
A0A3B3VNE0_BCL2L11      gggaccggcggagacccagcatcgtcagcgcgaacaccacgttcctcgaa
A0A3B3YII5_BCL2L11      gggaccggcggagacccagcatcgtcagcgcgaacaccacgttcctcgaa
A0A3B3YII5_BCL2L11      gggaccggcggagacccagcatcgtcagcgcgaacaccacgttcctcgaa
R4G9R5_BCL2L11-01       tcccaaacagctaaat----------------------------------
F7FTC8_BCL2L11-01       gacagcgaaggcggacga---------------------------ctgga
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       gacggagaaggtggacag---------------------------tttca
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       gacagagaaggtggacaa---------------------------ttgca
G3W979_BCL2L11-01       gaccgtgaaggtggacaa---------------------------ttgca
O43521_BCL2L11-11       gaccgagaaggtagacaa---------------------------ttgca
F7HHA9_BCL2L11-08       gaccgagaaggtagacaa---------------------------ttgca
G1SSY0_BCL2L11-01       gacagagaaggtggacag---------------------------ttgca
O54918_BCL2L11-03       gacagagaaggtggacaa---------------------------ttgca
O88498_BCL2L11-01       gacagagaaggtggacaa---------------------------ttgca
O88498_BCL2L11-02       gacagagaaggtggacaa---------------------------ttgca
O54918_BCL2L11-05       gacagagaaggtggacaa---------------------------ttgca
O54918_BCL2L11-01       gacagagaaggtggacaa---------------------------ttgca
O54918_BCL2L11-08       gacagagaaggtggacaa---------------------------ttgca
O54918_BCL2L11-06       gacagagaaggtggacaa---------------------------ttgca
W5PY58_BCL2L11-01       gacagagaaggtggacaa---------------------------ttgca
Q2YDF0_BCL2L11-02       gacagagaaggtggacaa---------------------------ttgca
Q2YDF0_BCL2L11-03       gacagagaaggtggacaa---------------------------ttgca
Q2YDF0_BCL2L11-01       gacagagaaggtggacaa---------------------------ttgca
A0A286XJN2_BCL2L11      gacagagaaggtggacaa---------------------------ttgca
A0A286XJN2_BCL2L11      gacagagaaggtggacaa---------------------------ttgca
A0A286XJN2_BCL2L11      gacagagaaggtggacaa---------------------------ttgca
A0A287DFJ0_BCL2L11      gacagagaaggtggacaa---------------------------ttgca
A0A287DFJ0_BCL2L11      gacagagaaggtggacaa---------------------------ttgca
H0XW23_BCL2L11-01       gaccgagaaggtggacaa---------------------------ttgca
A0A2K6GE31_BCL2L11      gaccgagaaggtggacag---------------------------ttgca
A0A2K6GE31_BCL2L11      gaccgagaaggtggacag---------------------------ttgca
A0A2K6GE31_BCL2L11      gaccgagaaggtggacag---------------------------ttgca
A0A2K6GE31_BCL2L11      gaccgagaaggtggacag---------------------------ttgca
A0A2K6GE31_BCL2L11      gaccgagaaggtggacag---------------------------ttgca
A0A2K6GE31_BCL2L11      gaccgagaaggtggacag---------------------------ttgca
A0A2I3HW02_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2R9CA99_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I2YQ13_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-06       gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-15       gaccgagaaggtagacaa---------------------------ttgca
A0A2K5X2I7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
F7HHA9_BCL2L11-09       gaccgagaaggtagacaa---------------------------ttgca
A0A2K6E226_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5NU92_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5Z8B6_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3M6I1_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5HZI7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6KJP8_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6QIL2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
F6XMC1_BCL2L11-09       gaccgagaaggtagacaa---------------------------ttgca
A0A2K5CAB2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6TRZ5_BCL2L11      gaccgagaaggtagacag---------------------------ttgca
A0A2K5NU92_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5X2I7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
F7HHA9_BCL2L11-05       gaccgagaaggtagacaa---------------------------ttgca
A0A2K5Z8B6_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5HZI7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6QIL2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6KJP8_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-13       gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-17       gaccgagaaggtagacaa---------------------------ttgca
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3HW02_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I2YQ13_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2R9CA99_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
F6XMC1_BCL2L11-02       gaccgagaaggtagacaa---------------------------ttgca
F6XMC1_BCL2L11-01       gaccgagaaggtagacaa---------------------------ttgca
F6XMC1_BCL2L11-06       gaccgagaaggtagacaa---------------------------ttgca
A0A2K5CAB2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6TRZ5_BCL2L11      gaccgagaaggtagacag---------------------------ttgca
F6XMC1_BCL2L11-08       gaccgagaaggtagacaa---------------------------ttgca
A0A2K5CAB2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6TRZ5_BCL2L11      gaccgagaaggtagacag---------------------------ttgca
F6XMC1_BCL2L11-03       gaccgagaaggtagacaa---------------------------ttgca
F6XMC1_BCL2L11-04       gaccgagaaggtagacaa---------------------------ttgca
A0A2K5CAB2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5CAB2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5CAB2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5CAB2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6TRZ5_BCL2L11      gaccgagaaggtagacag---------------------------ttgca
A0A2K6TRZ5_BCL2L11      gaccgagaaggtagacag---------------------------ttgca
A0A2K6TRZ5_BCL2L11      gaccgagaaggtagacag---------------------------ttgca
A0A2K6TRZ5_BCL2L11      gaccgagaaggtagacag---------------------------ttgca
F6XMC1_BCL2L11-05       gaccgagaaggtagacaa---------------------------ttgca
F6XMC1_BCL2L11-07       gaccgagaaggtagacaa---------------------------ttgca
A0A2K5CAB2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6TRZ5_BCL2L11      gaccgagaaggtagacag---------------------------ttgca
A0A2K5CAB2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6TRZ5_BCL2L11      gaccgagaaggtagacag---------------------------ttgca
H2P5E2_BCL2L11-01       gaccgagaaggtagacaa---------------------------ttgca
A0A2K6E226_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-21       gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-02       gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-03       gaccgagaaggtagacaa---------------------------ttgca
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3HW02_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I2YQ13_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3HW02_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2R9CA99_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I2YQ13_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2R9CA99_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I2YQ13_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2R9CA99_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3M6I1_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3M6I1_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3M6I1_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5NU92_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5X2I7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
F7HHA9_BCL2L11-01       gaccgagaaggtagacaa---------------------------ttgca
A0A2K6E226_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5Z8B6_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3M6I1_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5NU92_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5X2I7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6E226_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6E226_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5Z8B6_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5NU92_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5X2I7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6E226_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5Z8B6_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5HZI7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5HZI7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5HZI7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6QIL2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6QIL2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6QIL2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6KJP8_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6QIL2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6KJP8_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6KJP8_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6KJP8_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-25       gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-18       gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-09       gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-16       gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-10       gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-20       gaccgagaaggtagacaa---------------------------ttgca
A0A2K6KJP8_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6QIL2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5HZI7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-22       gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-08       gaccgagaaggtagacaa---------------------------ttgca
A0A2I2YQ13_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3HW02_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2R9CA99_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5NU92_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5X2I7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
F7HHA9_BCL2L11-03       gaccgagaaggtagacaa---------------------------ttgca
A0A2K6E226_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5Z8B6_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3M6I1_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-07       gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-19       gaccgagaaggtagacaa---------------------------ttgca
A0A2I2YQ13_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2R9CA99_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I2YQ13_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2R9CA99_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3HW02_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6KJP8_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6QIL2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-24       gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-12       gaccgagaaggtagacaa---------------------------ttgca
A0A2I2YQ13_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3HW02_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2R9CA99_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5NU92_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5X2I7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
F7HHA9_BCL2L11-06       gaccgagaaggtagacaa---------------------------ttgca
A0A2K6E226_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5Z8B6_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3M6I1_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5HZI7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6KJP8_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6QIL2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5HZI7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5NU92_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5X2I7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
F7HHA9_BCL2L11-04       gaccgagaaggtagacaa---------------------------ttgca
A0A2K6E226_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5Z8B6_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3M6I1_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A0D9RWE0_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5NU92_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5X2I7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
F7HHA9_BCL2L11-02       gaccgagaaggtagacaa---------------------------ttgca
A0A2K6E226_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5Z8B6_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3M6I1_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6KJP8_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6QIL2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5HZI7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3HW02_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I2YQ13_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
O43521_BCL2L11-23       gaccgagaaggtagacaa---------------------------ttgca
A0A2R9CA99_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2J8JCT2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2I3M6I1_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5X2I7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
F7HHA9_BCL2L11-07       gaccgagaaggtagacaa---------------------------ttgca
A0A2K5HZI7_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5NU92_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5Z8B6_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K5CAB2_BCL2L11      gaccgagaaggtagacaa---------------------------ttgca
A0A2K6TRZ5_BCL2L11      gaccgagaaggtagacag---------------------------ttgca
F1SU81_BCL2L11-01       gacagagaaggtggacag---------------------------ttgca
C1KGB8_BCL2L11-01       gacagagaaggtggacag---------------------------ttgca
F1SU81_BCL2L11-02       gacagagaaggtggacag---------------------------ttgca
F1SU81_BCL2L11-03       gacagagaaggtggacag---------------------------ttgca
G3SU55_BCL2L11-01       gacagagaaggtggacag---------------------------ttaca
M3YDI3_BCL2L11-01       gaccgagaaggtggacaa---------------------------ttgca
A0A337SW42_BCL2L11      gacagagaaggtggacaa---------------------------ttgca
G1LDR8_BCL2L11-01       gacagagaaggtggacaa---------------------------ctgca
J9NWV6_BCL2L11-01       gacagagaaggtggacaa---------------------------ttgca
A0A337SW42_BCL2L11      gacagagaaggtggacaa---------------------------ttgca
A0A337SW42_BCL2L11      gacagagaaggtggacaa---------------------------ttgca
A0A337SW42_BCL2L11      gacagagaaggtggacaa---------------------------ttgca
A0A337SW42_BCL2L11      gacagagaaggtggacaa---------------------------ttgca
A0A337SW42_BCL2L11      gacagagaaggtggacaa---------------------------ttgca
                                                                          

A0A3B3QC78_BCL2L11      acccagtggcggaacagactccgatccaagccggtccgagaaccgccaag
B2KKY9_BCL2L11-01       gccc----gccgggcactttga---tttccctcagccgggcgaag--ggg
B8JK68_BCL2L11-01       gccc----gccgggcactttga---tttccctcagccgggcgaag--ggg
Q4KMV9_BCL2L11-01       atca----acaagcagacaacattctcatcgccctctcagaagag---gg
M3XHJ5_BCL2L11-01       tccc----acccaaagaccagatcaaccaccgtttgtaaagcaag--agg
A0A3B1JXK6_BCL2L11      a-------gccgagcagtgcga---gcagcctgagcccggcgatg---gc
W5UEE7_BCL2L11-01       g-------gccgagccgtatga---gagccctcagcacagagaat---tg
A0A3B4BVX1_BCL2L11      ggcc----gccgagcagtgcga---gcagcctgagcccggcgagg---gg
A0A3B4BVX1_BCL2L11      ggcc----gccgagcagtgcga---gcagcctgagcccggcgagg---gg
A0A3B4BVX1_BCL2L11      ggcc----gccgagcagtgcga---gcagcctgagcccggcgagg---gg
A0A3B4V919_BCL2L11      gccg----ctggagc---------------cccagcgcaaaaccc---ca
A0A3B4XZH1_BCL2L11      gccg----ctggagc---------------cccggcgcaaaaccc---ca
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      gcac----acagagcgg--------agccgcgcgccgcaggcggg---cg
A0A3B5QAM1_BCL2L11      gcac----acagagcgg--------agccgcgcgccgcaggcggg---cg
A0A3B5QAM1_BCL2L11      gcac----acagagcgg--------agccgcgcgccgcaggcggg---cg
A0A3B3VNE0_BCL2L11      gcac----acagagcgg--------agctgcgcgccgcagacggg---cg
A0A3B3YII5_BCL2L11      gcac----acagagcgg--------agctgcgcgccgcaggcggg---cg
A0A3B3YII5_BCL2L11      gcac----acagagcgg--------agctgcgcgccgcaggcggg---cg
R4G9R5_BCL2L11-01       -------------------------gtcctctctgccaatgcttt---tg
F7FTC8_BCL2L11-01       gccc----gcagaggggccggctcagcccccgcagctccgacccg---gg
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       gtca----attgaaaggccaagtcagcctcagcatcttagacctg---gg
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       gcct----acagaaaggcctactcagcctcaacaactcagaccag---gg
G3W979_BCL2L11-01       gcct----acagaaaggcctactcaacct---caactcagaccag---gg
O43521_BCL2L11-11       gcct----gcggagag---------gcctccccagctcagacctg---gg
F7HHA9_BCL2L11-08       gcct----gcggagag---------gcctccccagctcagacctg---gg
G1SSY0_BCL2L11-01       gcct----gcggagag---------gccgccccagctcaggcctg---gg
O54918_BCL2L11-03       gcct----gctgagag---------gcctccccagctcaggcctg---gg
O88498_BCL2L11-01       gcct----gctgagag---------gcctccccagctcaggcctg---gg
O88498_BCL2L11-02       gcct----gctgagag---------gcctccccagctcaggcctg---gg
O54918_BCL2L11-05       gcct----gctgagag---------gcctccccagctcaggcctg---gg
O54918_BCL2L11-01       gcct----gctgagag---------gcctccccagctcaggcctg---gg
O54918_BCL2L11-08       gcct----gctgagag---------gcctccccagctcaggcctg---gg
O54918_BCL2L11-06       gcct----gctgagag---------gcctccccagctcaggcctg---gg
W5PY58_BCL2L11-01       gcct----gccgagag---------gcctcctcagctcagaccag---gg
Q2YDF0_BCL2L11-02       gcct----gccgagag---------gcctcctcagctcagacctg---gg
Q2YDF0_BCL2L11-03       gcct----gccgagag---------gcctcctcagctcagacctg---gg
Q2YDF0_BCL2L11-01       gcct----gccgagag---------gcctcctcagctcagacctg---gg
A0A286XJN2_BCL2L11      gcct----gctgagag---------gccatcccagctcagggctg---gg
A0A286XJN2_BCL2L11      gcct----gctgagag---------gccatcccagctcagggctg---gg
A0A286XJN2_BCL2L11      gcct----gctgagag---------gccatcccagctcagggctg---gg
A0A287DFJ0_BCL2L11      gcct----gcagagag---------gcctccccagctcaggccgg---gg
A0A287DFJ0_BCL2L11      gcct----gcagagag---------gcctccccagctcaggccgg---gg
H0XW23_BCL2L11-01       acct----gcggagag---------acctccccagctcaggcctg---gg
A0A2K6GE31_BCL2L11      atct----gtggagag---------acctccccagctcaggcctg---gg
A0A2K6GE31_BCL2L11      atct----gtggagag---------acctccccagctcaggcctg---gg
A0A2K6GE31_BCL2L11      atct----gtggagag---------acctccccagctcaggcctg---gg
A0A2K6GE31_BCL2L11      atct----gtggagag---------acctccccagctcaggcctg---gg
A0A2K6GE31_BCL2L11      atct----gtggagag---------acctccccagctcaggcctg---gg
A0A2K6GE31_BCL2L11      atct----gtggagag---------acctccccagctcaggcctg---gg
A0A2I3HW02_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2R9CA99_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2J8JCT2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I2YQ13_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-06       gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-15       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5X2I7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
F7HHA9_BCL2L11-09       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6E226_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5NU92_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5Z8B6_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3M6I1_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5HZI7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6KJP8_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6QIL2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
F6XMC1_BCL2L11-09       gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K5CAB2_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K6TRZ5_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K5NU92_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5X2I7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
F7HHA9_BCL2L11-05       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5Z8B6_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5HZI7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6QIL2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6KJP8_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-13       gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-17       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2J8JCT2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3HW02_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I2YQ13_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2R9CA99_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
F6XMC1_BCL2L11-02       gcct----gcggagag---------acctccccagctcagacctg---gg
F6XMC1_BCL2L11-01       gcct----gcggagag---------acctccccagctcagacctg---gg
F6XMC1_BCL2L11-06       gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K5CAB2_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K6TRZ5_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
F6XMC1_BCL2L11-08       gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K5CAB2_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K6TRZ5_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
F6XMC1_BCL2L11-03       gcct----gcggagag---------acctccccagctcagacctg---gg
F6XMC1_BCL2L11-04       gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K5CAB2_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K5CAB2_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K5CAB2_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K5CAB2_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K6TRZ5_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K6TRZ5_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K6TRZ5_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K6TRZ5_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
F6XMC1_BCL2L11-05       gcct----gcggagag---------acctccccagctcagacctg---gg
F6XMC1_BCL2L11-07       gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K5CAB2_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K6TRZ5_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K5CAB2_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K6TRZ5_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
H2P5E2_BCL2L11-01       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6E226_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-21       gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-02       gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-03       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2J8JCT2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2J8JCT2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3HW02_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I2YQ13_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3HW02_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2R9CA99_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2J8JCT2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I2YQ13_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2R9CA99_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I2YQ13_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2R9CA99_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3M6I1_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3M6I1_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3M6I1_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5NU92_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5X2I7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
F7HHA9_BCL2L11-01       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6E226_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5Z8B6_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3M6I1_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5NU92_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5X2I7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6E226_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6E226_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5Z8B6_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5NU92_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5X2I7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6E226_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5Z8B6_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5HZI7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5HZI7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5HZI7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6QIL2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6QIL2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6QIL2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6KJP8_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6QIL2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6KJP8_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6KJP8_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6KJP8_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-25       gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-18       gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-09       gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-16       gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-10       gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-20       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6KJP8_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6QIL2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5HZI7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-22       gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-08       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I2YQ13_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3HW02_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2R9CA99_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2J8JCT2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5NU92_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5X2I7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
F7HHA9_BCL2L11-03       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6E226_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5Z8B6_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3M6I1_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-07       gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-19       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I2YQ13_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2R9CA99_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2J8JCT2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2J8JCT2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I2YQ13_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2R9CA99_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3HW02_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6KJP8_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6QIL2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-24       gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-12       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I2YQ13_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3HW02_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2R9CA99_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2J8JCT2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5NU92_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5X2I7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
F7HHA9_BCL2L11-06       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6E226_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5Z8B6_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3M6I1_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5HZI7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6KJP8_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6QIL2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5HZI7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5NU92_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5X2I7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
F7HHA9_BCL2L11-04       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6E226_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5Z8B6_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3M6I1_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A0D9RWE0_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5NU92_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5X2I7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
F7HHA9_BCL2L11-02       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6E226_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5Z8B6_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3M6I1_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6KJP8_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K6QIL2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5HZI7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3HW02_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I2YQ13_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
O43521_BCL2L11-23       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2R9CA99_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2J8JCT2_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2I3M6I1_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5X2I7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
F7HHA9_BCL2L11-07       gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5HZI7_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5NU92_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5Z8B6_BCL2L11      gcct----gcggagag---------gcctccccagctcagacctg---gg
A0A2K5CAB2_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
A0A2K6TRZ5_BCL2L11      gcct----gcggagag---------acctccccagctcagacctg---gg
F1SU81_BCL2L11-01       gcct----gcggaaag---------gcctcctcagctcaggcctg---gg
C1KGB8_BCL2L11-01       gcct----gcggaaag---------gcctcctcagctcaggcctg---gg
F1SU81_BCL2L11-02       gcct----gcggaaag---------gcctcctcagctcaggcctg---gg
F1SU81_BCL2L11-03       gcct----gcggaaag---------gcctcctcagctcaggcctg---gg
G3SU55_BCL2L11-01       gcct----gcggagaggcccccgcagcctcctcagctcaggcctg---gg
M3YDI3_BCL2L11-01       gcct----gttgagag---------gcctcctcagctcaggcctg---gg
A0A337SW42_BCL2L11      gcct----gctgagag---------gcctcctcagctcaggcctg---gg
G1LDR8_BCL2L11-01       gcct----gctgagag---------gcctcctcagctcaggcctg---gg
J9NWV6_BCL2L11-01       gcct----gctgagag---------gcctcctcagctcaggcctg---gg
A0A337SW42_BCL2L11      gcct----gctgagag---------gcctcctcagctcaggcctg---gg
A0A337SW42_BCL2L11      gcct----gctgagag---------gcctcctcagctcaggcctg---gg
A0A337SW42_BCL2L11      gcct----gctgagag---------gcctcctcagctcaggcctg---gg
A0A337SW42_BCL2L11      gcct----gctgagag---------gcctcctcagctcaggcctg---gg
A0A337SW42_BCL2L11      gcct----gctgagag---------gcctcctcagctcaggcctg---gg
                                                                          

A0A3B3QC78_BCL2L11      gtccct-----------ggtcaactg-caagcgaccccgcgatttagtac
B2KKY9_BCL2L11-01       acccgttaaggggagggatatccatgtcgaata-----------------
B8JK68_BCL2L11-01       acccgttaaggggagggatatccatgtcgaata-----------------
Q4KMV9_BCL2L11-01       gccccc-----------acctctctt-agcagtccttttcaaggtaatca
M3XHJ5_BCL2L11-01       gctgct-----------actgcattatcagcccactttcaaaagtgatcg
A0A3B1JXK6_BCL2L11      gacccg-----------gttagggga-ccccctgcgctgcacaatagcct
W5UEE7_BCL2L11-01       gaagtg-----------attagggga-gggatcgcgctgccgaatagccg
A0A3B4BVX1_BCL2L11      gacccg-----------gttagggga-gggattacaatgcctaatagcct
A0A3B4BVX1_BCL2L11      gacccg-----------gttagggga-gggattacaatgcctaatagcct
A0A3B4BVX1_BCL2L11      gacccg-----------gttagggga-gggattacaatgcctaatagcct
A0A3B4V919_BCL2L11      gttcg--------------------a-aagacagcggcgagcggagcctt
A0A3B4XZH1_BCL2L11      gttcg--------------------a-aagacagcggcgagcgga-----
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      cctcc--------------------a-cagccgggggaggaggaggagga
A0A3B5QAM1_BCL2L11      cctcc--------------------a-cagccgggggaggaggaggagga
A0A3B5QAM1_BCL2L11      cctcc--------------------a-cagccgggggaggaggaggagga
A0A3B3VNE0_BCL2L11      cctcc--------------------a-cagccgggggaggaggaggagg-
A0A3B3YII5_BCL2L11      cctcc--------------------a-cagccgggggaggaggaggagg-
A0A3B3YII5_BCL2L11      cctcc--------------------a-cagccgggggaggaggaggagg-
R4G9R5_BCL2L11-01       ctattt-----------cttgctttt-tataccgtg--------------
F7FTC8_BCL2L11-01       gcacct-----------acctctatc-cgaacccagtatca---------
G1MV54_BCL2L11-01       -------------------ctctgtg-ca---------------------
K7GA86_BCL2L11-01       gcccct-----------acctctata-caaacacagtacca---------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       gcccct-----------acctctata-caaacacagtatcaaggtaattc
G3W979_BCL2L11-01       gcccct-----------acctctata-caaacacaatatcaaggtaattc
O43521_BCL2L11-11       gcccct-----------acctcccta-cagacagagccacaag-------
F7HHA9_BCL2L11-08       gcccct-----------acctcccta-cagacagagccacaag-------
G1SSY0_BCL2L11-01       gccccc-----------acctccctg-cagtcggagccgcaaggtaatcc
O54918_BCL2L11-03       gcccct-----------acctcccta-cagacagaaccgca---------
O88498_BCL2L11-01       gcccct-----------acctcccta-cagacagaatcgcaaggtaatcc
O88498_BCL2L11-02       gcccct-----------acctcccta-cagacagaatcgca---------
O54918_BCL2L11-05       gcccct-----------acctcccta-cagacagaaccgca---------
O54918_BCL2L11-01       gcccct-----------acctcccta-cagacagaaccgcaaggtaatcc
O54918_BCL2L11-08       gcccct-----------acctcccta-cagacagaaccgca---------
O54918_BCL2L11-06       gcccct-----------acctcccta-cagacagaaccgca---------
W5PY58_BCL2L11-01       gccccc-----------acctcttta-cagacagagcggcaaggtaatcc
Q2YDF0_BCL2L11-02       gccccc-----------acctcttta-cagacagagcggcaaggtaatcc
Q2YDF0_BCL2L11-03       gccccc-----------acctcttta-cagacagagcggca---------
Q2YDF0_BCL2L11-01       gccccc-----------acctcttta-cagacagagcggca---------
A0A286XJN2_BCL2L11      gcccca-----------acctcccta-cagacggagccccaaggtaatcc
A0A286XJN2_BCL2L11      gcccca-----------acctcccta-cagacggagccccaaggtaatcc
A0A286XJN2_BCL2L11      gcccca-----------acctcccta-cagacggagcccca---------
A0A287DFJ0_BCL2L11      gcccct-----------acctccctt-cagacagagcctcaaggtaatcc
A0A287DFJ0_BCL2L11      gcccct-----------acctccctt-cagacagagcctca---------
H0XW23_BCL2L11-01       gcccct-----------acctctcta-catacagagccccaaggtaatcc
A0A2K6GE31_BCL2L11      gcccct-----------acctcccta-cagacagagccccaag-------
A0A2K6GE31_BCL2L11      gcccct-----------acctcccta-cagacagagccccaaggtaatcc
A0A2K6GE31_BCL2L11      gcccct-----------acctcccta-cagacagagccccaaggtaatcc
A0A2K6GE31_BCL2L11      gcccct-----------acctcccta-cagacagagccccaaggtaatcc
A0A2K6GE31_BCL2L11      gcccct-----------acctcccta-cagacagagccccaaggtaatcc
A0A2K6GE31_BCL2L11      gcccct-----------acctcccta-cagacagagcccca---------
A0A2I3HW02_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2R9CA99_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2J8JCT2_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2I2YQ13_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
O43521_BCL2L11-06       gcccct-----------acctcccta-cagacagagccaca---------
O43521_BCL2L11-15       gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5X2I7_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
F7HHA9_BCL2L11-09       gcccct-----------acctcccta-cagacagagccaca---------
A0A2K6E226_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5NU92_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5Z8B6_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2I3M6I1_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5HZI7_BCL2L11      gcccct-----------acctcccta-cagacagaaccaca---------
A0A2K6KJP8_BCL2L11      gcccct-----------acctcccta-cagacagaaccaca---------
A0A2K6QIL2_BCL2L11      gcccct-----------acctcccta-cagacagaaccaca---------
F6XMC1_BCL2L11-09       gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5CAB2_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K6TRZ5_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5NU92_BCL2L11      gcccct-----------acctcccta-cagacagagccacaa--------
A0A2K5X2I7_BCL2L11      gcccct-----------acctcccta-cagacagagccacaa--------
F7HHA9_BCL2L11-05       gcccct-----------acctcccta-cagacagagccacaa--------
A0A2K5Z8B6_BCL2L11      gcccct-----------acctcccta-cagacagagccacaa--------
A0A2K5HZI7_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaa--------
A0A2K6QIL2_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaa--------
A0A2K6KJP8_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaa--------
O43521_BCL2L11-13       gcccct-----------acctcccta-cagacagagccacaa--------
O43521_BCL2L11-17       gcccct-----------acctcccta-cagacagagccacaa--------
A0A2J8JCT2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaa--------
A0A2I3HW02_BCL2L11      gcccct-----------acctcccta-cagacagagccacaa--------
A0A2I2YQ13_BCL2L11      gcccct-----------acctcccta-cagacagagccacaa--------
A0A2R9CA99_BCL2L11      gcccct-----------acctcccta-cagacagagccacaa--------
F6XMC1_BCL2L11-02       gcccct-----------acctcccta-cagacagagccaca---------
F6XMC1_BCL2L11-01       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
F6XMC1_BCL2L11-06       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5CAB2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6TRZ5_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
F6XMC1_BCL2L11-08       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5CAB2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6TRZ5_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
F6XMC1_BCL2L11-03       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
F6XMC1_BCL2L11-04       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5CAB2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5CAB2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5CAB2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5CAB2_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K6TRZ5_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6TRZ5_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6TRZ5_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6TRZ5_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
F6XMC1_BCL2L11-05       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
F6XMC1_BCL2L11-07       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5CAB2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6TRZ5_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5CAB2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6TRZ5_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
H2P5E2_BCL2L11-01       gcccct-----------acctcccta-cagacagagccaca---------
A0A2K6E226_BCL2L11      gcccct-----------acctcccta-cagacaga---------------
O43521_BCL2L11-21       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
O43521_BCL2L11-02       gcccct-----------acctcccta-cagacagagccaca---------
O43521_BCL2L11-03       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2J8JCT2_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2J8JCT2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I3HW02_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I2YQ13_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I3HW02_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2R9CA99_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2J8JCT2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I2YQ13_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2R9CA99_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I2YQ13_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2R9CA99_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2I3M6I1_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2I3M6I1_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2I3M6I1_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5NU92_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5X2I7_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
F7HHA9_BCL2L11-01       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6E226_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5Z8B6_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I3M6I1_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5NU92_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5X2I7_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6E226_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6E226_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5Z8B6_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5NU92_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5X2I7_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K6E226_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5Z8B6_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5HZI7_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K5HZI7_BCL2L11      gcccct-----------acctcccta-cagacagaaccaca---------
A0A2K5HZI7_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K6QIL2_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K6QIL2_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K6QIL2_BCL2L11      gcccct-----------acctcccta-cagacagaaccaca---------
A0A2K6KJP8_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K6QIL2_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K6KJP8_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K6KJP8_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K6KJP8_BCL2L11      gcccct-----------acctcccta-cagacagaaccaca---------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       gcccct-----------acctcccta-cagacagagccaca---------
O43521_BCL2L11-25       gcccct-----------acctcccta-cagacagagccaca---------
O43521_BCL2L11-18       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
O43521_BCL2L11-09       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
O43521_BCL2L11-16       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
O43521_BCL2L11-10       gcccct-----------acctcccta-cagacagagccacaa--------
O43521_BCL2L11-20       gcccct-----------acctcccta-cagacagagccacaa--------
A0A2K6KJP8_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K6QIL2_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K5HZI7_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
O43521_BCL2L11-22       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
O43521_BCL2L11-08       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I2YQ13_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I3HW02_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2R9CA99_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2J8JCT2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5NU92_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5X2I7_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
F7HHA9_BCL2L11-03       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6E226_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5Z8B6_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I3M6I1_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
O43521_BCL2L11-07       gcccct-----------acctcccta-cagacagagccaca---------
O43521_BCL2L11-19       gcccct-----------acctcccta-cagacagagccaca---------
A0A2I2YQ13_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2R9CA99_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2J8JCT2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2J8JCT2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I2YQ13_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2R9CA99_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I3HW02_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6KJP8_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K6QIL2_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
O43521_BCL2L11-24       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
O43521_BCL2L11-12       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I2YQ13_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I3HW02_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2R9CA99_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2J8JCT2_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5NU92_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5X2I7_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
F7HHA9_BCL2L11-06       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6E226_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5Z8B6_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I3M6I1_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5HZI7_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K6KJP8_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K6QIL2_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K5HZI7_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K5NU92_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5X2I7_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
F7HHA9_BCL2L11-04       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6E226_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5Z8B6_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I3M6I1_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A0D9RWE0_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5NU92_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5X2I7_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
F7HHA9_BCL2L11-02       gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6E226_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K5Z8B6_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2I3M6I1_BCL2L11      gcccct-----------acctcccta-cagacagagccacaaggtaatcc
A0A2K6KJP8_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K6QIL2_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2K5HZI7_BCL2L11      gcccct-----------acctcccta-cagacagaaccacaaggtaatcc
A0A2I3HW02_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2I2YQ13_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
O43521_BCL2L11-23       gcccct-----------acctcccta-cagacagagccaca---------
A0A2R9CA99_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2J8JCT2_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2I3M6I1_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5X2I7_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
F7HHA9_BCL2L11-07       gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5HZI7_BCL2L11      gcccct-----------acctcccta-cagacagaaccaca---------
A0A2K5NU92_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5Z8B6_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K5CAB2_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
A0A2K6TRZ5_BCL2L11      gcccct-----------acctcccta-cagacagagccaca---------
F1SU81_BCL2L11-01       gccccc-----------acctctcta-caaacagagcggcaaggtaatcc
C1KGB8_BCL2L11-01       gccccc-----------acctctcta-cagacagagcggca---------
F1SU81_BCL2L11-02       gccccc-----------acctctcta-caaacagagcggcaaggtaatcc
F1SU81_BCL2L11-03       gccccc-----------acctctcta-caaacagagcggca---------
G3SU55_BCL2L11-01       gcccct-----------acctctctg-ctcacggagcctcaaggtaatcc
M3YDI3_BCL2L11-01       gcccct-----------acctctcta-cagacagagcagcaag-------
A0A337SW42_BCL2L11      gcccct-----------acctctcta-cagacagagcagcaag-------
G1LDR8_BCL2L11-01       gcccct-----------acctctcta-cagacagagcagcaaggtaatcc
J9NWV6_BCL2L11-01       gcccct-----------acctctcta-cagacagaacagcaaggtaatcc
A0A337SW42_BCL2L11      gcccct-----------acctctcta-cagacagagcagcaaggtaatcc
A0A337SW42_BCL2L11      gcccct-----------acctctcta-cagacagagcagcaaggtaatcc
A0A337SW42_BCL2L11      gcccct-----------acctctcta-cagacagagcagcaaggtaatcc
A0A337SW42_BCL2L11      gcccct-----------acctctcta-cagacagagcagcaaggtaatcc
A0A337SW42_BCL2L11      gcccct-----------acctctcta-cagacagagcagca---------
                                                                          

A0A3B3QC78_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       atcagat------------gagggtgggagctcctcagccagcactccat
M3XHJ5_BCL2L11-01       cactggt--------gaggtggagagacagatctttactcagcaccctga
A0A3B1JXK6_BCL2L11      tctcggt-------------------------------------------
W5UEE7_BCL2L11-01       cgtggct-------------------------------------------
A0A3B4BVX1_BCL2L11      tctgggt-------------------------------------------
A0A3B4BVX1_BCL2L11      tctgggt-------------------------------------------
A0A3B4BVX1_BCL2L11      tctgggt-------------------------------------------
A0A3B4V919_BCL2L11      ggccacctcggctccaccggagaaggagagccagactcgccgccccggtg
A0A3B4XZH1_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      gaaggagaaggacgaagaggggagccggactcggactcgccgccttgctc
A0A3B5QAM1_BCL2L11      gagggaggaggacgaagaggggagccggactcggactcgccgccttgctc
A0A3B5QAM1_BCL2L11      gagggaggaggacgaagaggggagccggactcggactcgccgccttgctc
A0A3B3VNE0_BCL2L11      --aggagggggaggaggaggggagccggacgcggattcgccgccgtgctc
A0A3B3YII5_BCL2L11      --gggaggaggaggaagaggggagccggattcggactcgccgccgtgctc
A0A3B3YII5_BCL2L11      --gggaggaggaggaagaggggagccggattcggactcgccgccgtgctc
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       ---------------aggtgaaggggacagctgctcacccagcagtcctc
G3W979_BCL2L11-01       ---------------aggtgaaggggacagctgctcacctagcagccctc
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       ggaaggc------------------gaccgctgtgcgcacggcagccctc
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       cgacggc------------gaaggggaccgctgcccccacggcagccctc
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-01       cgacggc------------gaaggggaccgctgcccccacggcagccctc
O54918_BCL2L11-08       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
W5PY58_BCL2L11-01       tgaagga------------gaaggggaccgctgcccccaaggcagcccgc
Q2YDF0_BCL2L11-02       tgaagga------------gaaggggaccgctgcccccaaggcagcccac
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      tgaaggc------------gcaggggaccgctccccccacggcagccctc
A0A286XJN2_BCL2L11      tgaaggc------------gcaggggaccgctccccccacggcagccctc
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      cgaaggc------------gaaggggaccgctgcccccacggcagcccac
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       cgaaggcaatccggaagtcgaaggggaccgctgcccccaaggcagccctc
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      cgaaggcagtcgggaaggcgaaggggaccgctgctcccacggcagccctc
A0A2K6GE31_BCL2L11      cgaaggcagtcgggaaggcgaaggggaccgctgctcccacggcagccctc
A0A2K6GE31_BCL2L11      cgaaggcagtcgggaaggcgaaggggaccgctgctcccacggcagccctc
A0A2K6GE31_BCL2L11      cgaaggcagtcgggaaggcgaaggggaccgctgctcccacggcagccctc
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-01       cgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccctc
F6XMC1_BCL2L11-06       cgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccctc
A0A2K5CAB2_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6TRZ5_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
F6XMC1_BCL2L11-08       cgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccctc
A0A2K5CAB2_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6TRZ5_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
F6XMC1_BCL2L11-03       cgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccctc
F6XMC1_BCL2L11-04       cgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccctc
A0A2K5CAB2_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5CAB2_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5CAB2_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6TRZ5_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6TRZ5_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       cgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccctc
F6XMC1_BCL2L11-07       cgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccctc
A0A2K5CAB2_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6TRZ5_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5CAB2_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6TRZ5_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I3HW02_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I2YQ13_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I3HW02_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2R9CA99_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2J8JCT2_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I2YQ13_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2R9CA99_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5NU92_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5X2I7_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
F7HHA9_BCL2L11-01       cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6E226_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5Z8B6_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I3M6I1_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5NU92_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5X2I7_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6E226_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6E226_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5Z8B6_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6QIL2_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6QIL2_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6QIL2_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6KJP8_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6KJP8_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-18       tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
O43521_BCL2L11-09       tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
O43521_BCL2L11-16       tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6QIL2_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5HZI7_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
O43521_BCL2L11-22       tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
O43521_BCL2L11-08       tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I2YQ13_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I3HW02_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2R9CA99_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2J8JCT2_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5NU92_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5X2I7_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
F7HHA9_BCL2L11-03       cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6E226_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5Z8B6_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I3M6I1_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2R9CA99_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2J8JCT2_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2J8JCT2_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I2YQ13_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2R9CA99_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I3HW02_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6KJP8_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6QIL2_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
O43521_BCL2L11-24       tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
O43521_BCL2L11-12       tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I2YQ13_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I3HW02_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2R9CA99_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2J8JCT2_BCL2L11      tgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5NU92_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5X2I7_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
F7HHA9_BCL2L11-06       cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6E226_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5Z8B6_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I3M6I1_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5HZI7_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6KJP8_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6QIL2_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5HZI7_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5NU92_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5X2I7_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
F7HHA9_BCL2L11-04       cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6E226_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5Z8B6_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I3M6I1_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5X2I7_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
F7HHA9_BCL2L11-02       cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6E226_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5Z8B6_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I3M6I1_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6KJP8_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K6QIL2_BCL2L11      cgaagacaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2K5HZI7_BCL2L11      cgaaggcaatcacggaggtgaaggggacagctgcccccacggcagccctc
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F1SU81_BCL2L11-01       ggaagga------------gaaggggaccgctgcccccaaggcagccccc
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       ggaagga------------gaaggggaccgctgcccccaaggcagccccc
F1SU81_BCL2L11-03       --------------------------------------------------
G3SU55_BCL2L11-01       tgacggt------------gaaggggacagctgcccccagggcagcccac
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       tgaaggc------------gaaggggaccgctgcccccaaggcagccctc
J9NWV6_BCL2L11-01       tgaaggc------------gaaggggaccgctgcccccaaggcagccctc
A0A337SW42_BCL2L11      tgaaggc------------gaaggggaccgctgcccccaaggcagccctc
A0A337SW42_BCL2L11      tgaaggc------------gaaggggaccgctgcccccaaggcagccctc
A0A337SW42_BCL2L11      tgaaggc------------gaaggggaccgctgcccccaaggcagccctc
A0A337SW42_BCL2L11      tgaaggc------------gaaggggaccgctgcccccaaggcagccctc
A0A337SW42_BCL2L11      --------------------------------------------------
                                                                          

A0A3B3QC78_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------accagtcgaggtcaccgatgaaccggact-
B8JK68_BCL2L11-01       --------------------accagtcgaggtcaccgatgaaccggact-
Q4KMV9_BCL2L11-01       ggggtcctactatatcgccttatagtcccagttcctttgtcaacagatca
M3XHJ5_BCL2L11-01       tgggaggacttctgttgccccccagcccctgtccttttgtcactaggtcc
A0A3B1JXK6_BCL2L11      -------------------taccagacccggtcgccgctgttccgaact-
W5UEE7_BCL2L11-01       -------------------taccagtcgaggtcgcctgtgttccgaacc-
A0A3B4BVX1_BCL2L11      -------------------taccagtcgcgttcgcctctcttccgaaca-
A0A3B4BVX1_BCL2L11      -------------------taccagtcgcgttcgcctctcttccgaaca-
A0A3B4BVX1_BCL2L11      -------------------taccagtcgcgttcgcctctcttccgaaca-
A0A3B4V919_BCL2L11      cagaaccatag----------------ccacctctcctgtcaaca-----
A0A3B4XZH1_BCL2L11      ---aaccatag----------------ccacctctcctggcaacagccta
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      cgtgagcccgg----------------ccagtt---------------ta
A0A3B5QAM1_BCL2L11      cgtgagcccgg----------------ccagtt---------------ta
A0A3B5QAM1_BCL2L11      cgtgagcccgg----------------ccagtt---------------ta
A0A3B3VNE0_BCL2L11      cgtgagcccgg----------------ccagtt---------------ta
A0A3B3YII5_BCL2L11      cgtgagcccgg----------------ccagtt---------------ta
A0A3B3YII5_BCL2L11      cgtgagcccgg----------------ccagtt---------------ta
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       agggaccgtttgcaccacccactagccctagtccatttgctaccagatcc
G3W979_BCL2L11-01       agggaccgtttgcaccacccactagccctagcccgtttgctaccagatcc
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       agggcccgctggccccatcggccagccctggccctttcgctaccaggtcc
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       agggcccgctggccccaccggccagccctggtccttttgctaccagatcc
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-01       agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
O54918_BCL2L11-08       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
W5PY58_BCL2L11-01       agggcccgctggccccaccggccagccccggccctttcgctaccagatcc
Q2YDF0_BCL2L11-02       agggcccgctggccccaccggccagccctggccctttcgctaccagatcc
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      agggcccgctggccccaccggccagtcctggcccttttgctaccagatcc
A0A286XJN2_BCL2L11      agggcccgctggccccaccggccagtcctggcccttttgctaccagatcc
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       agggcccactggccccaccggccagccctggtccttttgctaccagatcc
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6GE31_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6GE31_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6GE31_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-01       agggcccgctggccccaccggccagccccggcccttttgctaccagatcc
F6XMC1_BCL2L11-06       agggcccgctggccccaccggccagccccggcccttttgctaccagatcc
A0A2K5CAB2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6TRZ5_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
F6XMC1_BCL2L11-08       agggcccgctggccccaccggccagccccggcccttttgctaccagatcc
A0A2K5CAB2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6TRZ5_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
F6XMC1_BCL2L11-03       agggcccgctggccccaccggccagccccggcccttttgctaccagatcc
F6XMC1_BCL2L11-04       agggcccgctggccccaccggccagccccggcccttttgctaccagatcc
A0A2K5CAB2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5CAB2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5CAB2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6TRZ5_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6TRZ5_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       agggcccgctggccccaccggccagccccggcccttttgctaccagatcc
F6XMC1_BCL2L11-07       agggcccgctggccccaccggccagccccggcccttttgctaccagatcc
A0A2K5CAB2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6TRZ5_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5CAB2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6TRZ5_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      -------------------------ccctggcccttttgctaccagatcc
O43521_BCL2L11-21       agggcccgctggccccacctgccagccctggcccttttgctaccagatcc
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       agggcccgctggccccacctgccagccctggcccttttgctaccagatcc
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I3HW02_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I2YQ13_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I3HW02_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2R9CA99_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2J8JCT2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I2YQ13_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2R9CA99_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5NU92_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5X2I7_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
F7HHA9_BCL2L11-01       agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6E226_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5Z8B6_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I3M6I1_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5NU92_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5X2I7_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6E226_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6E226_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5Z8B6_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6QIL2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6QIL2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6QIL2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6KJP8_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6KJP8_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-18       agggcccgctggccccacctgccagccctggcccttttgctaccagatcc
O43521_BCL2L11-09       agggcccgctggccccacctgccagccctggcccttttgctaccagatcc
O43521_BCL2L11-16       agggcccgctggccccacctgccagccctggcccttttgctaccagatcc
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6QIL2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5HZI7_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
O43521_BCL2L11-22       agggcccgctggccccacctgccagccctggcccttttgctaccagatcc
O43521_BCL2L11-08       agggcccgctggccccacctgccagccctggcccttttgctaccagatcc
A0A2I2YQ13_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I3HW02_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2R9CA99_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2J8JCT2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5NU92_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5X2I7_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
F7HHA9_BCL2L11-03       agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6E226_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5Z8B6_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I3M6I1_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2R9CA99_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2J8JCT2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2J8JCT2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I2YQ13_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2R9CA99_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I3HW02_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6KJP8_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6QIL2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
O43521_BCL2L11-24       agggcccgctggccccacctgccagccctggcccttttgctaccagatcc
O43521_BCL2L11-12       agggcccgctggccccacctgccagccctggcccttttgctaccagatcc
A0A2I2YQ13_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I3HW02_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2R9CA99_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2J8JCT2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5NU92_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5X2I7_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
F7HHA9_BCL2L11-06       agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6E226_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5Z8B6_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I3M6I1_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5HZI7_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6KJP8_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6QIL2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5HZI7_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5NU92_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5X2I7_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
F7HHA9_BCL2L11-04       agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6E226_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5Z8B6_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I3M6I1_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5X2I7_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
F7HHA9_BCL2L11-02       agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6E226_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5Z8B6_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I3M6I1_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6KJP8_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K6QIL2_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2K5HZI7_BCL2L11      agggcccgctggccccaccggccagccctggcccttttgctaccagatcc
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F1SU81_BCL2L11-01       agggcccactggccccaccgaccagccctggcccctttgctaccagatcc
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       agggcccactggccccaccgaccagccctggcccctttgctaccagatcc
F1SU81_BCL2L11-03       --------------------------------------------------
G3SU55_BCL2L11-01       agggcccgcaggccccaccagccagccccggcccttttgctaccagatcc
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       agggcccgctggccccaccagccagcccaggcccttttgctaccagatcc
J9NWV6_BCL2L11-01       agggcccgctggccccaccagccagccccggcccttttgctaccagatcc
A0A337SW42_BCL2L11      agggcccgctggccccaccagccagccccgggccttttgctaccagatcc
A0A337SW42_BCL2L11      agggcccgctggccccaccagccagccccgggccttttgctaccagatcc
A0A337SW42_BCL2L11      agggcccgctggccccaccagccagccccgggccttttgctaccagatcc
A0A337SW42_BCL2L11      agggcccgctggccccaccagccagccccgggccttttgctaccagatcc
A0A337SW42_BCL2L11      --------------------------------------------------
                                                                          

A0A3B3QC78_BCL2L11      --------------------------------gctgtccgcatcgtcaag
B2KKY9_BCL2L11-01       ---------------------------------ttctccaggtcctctag
B8JK68_BCL2L11-01       ---------------------------------ttctccaggtcctctag
Q4KMV9_BCL2L11-01       ccccattgcatgctggtaagaggatcatcacttgtctccaaaacctcaag
M3XHJ5_BCL2L11-01       ccgtttttcatcttcatgaggcggtccttagttttatccacatcttccag
A0A3B1JXK6_BCL2L11      ---------------------------------ctctccaggtcctcgag
W5UEE7_BCL2L11-01       ---------------------------------ctctccaggtcgtcgag
A0A3B4BVX1_BCL2L11      ---------------------------------ctatccaggtcctcaag
A0A3B4BVX1_BCL2L11      ---------------------------------ctatccaggtcctcaag
A0A3B4BVX1_BCL2L11      ---------------------------------ctatccaggtcctcaag
A0A3B4V919_BCL2L11      -----------------------------cttctctcgtcgctcgtccag
A0A3B4XZH1_BCL2L11      ggcgtgtttcaaaagaggtctatattcagctaccctcgtcgctcgtccag
U3IW89_BCL2L11-01       ------------------------------------------tcctccag
A0A3B5M375_BCL2L11      gacgtctttcgaagcaggtcgatatttcgccctacccgccgctcatccag
A0A3B5QAM1_BCL2L11      gacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccag
A0A3B5QAM1_BCL2L11      gacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccag
A0A3B3VNE0_BCL2L11      gacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccag
A0A3B3YII5_BCL2L11      gacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccag
A0A3B3YII5_BCL2L11      gacgtctttcgaagcaggtcgatatttcgccctccccgccgctcgtccag
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       ccacttttcatctttttaagaagatctccactgctgcctcgatcttccag
G3W979_BCL2L11-01       ccacttttcatctttgtaagaagatccccactgctgcctcgatcttctag
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       ccgctcttcatctttgtccgaagatcctccctgctgtctcgatcgtccag
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       ccacttttcatctttgtgagaagatcttctctgctgtcccggtcctccag
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-01       ccacttttcatctttgtgagaagatcttctctgctgtcccggtcctccag
O54918_BCL2L11-08       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
W5PY58_BCL2L11-01       ccgctcttcatcttcgtgagaagatcctccttgctgtctcggtcctccag
Q2YDF0_BCL2L11-02       ccgctcttcatcttcgtgagaagatcctccttgctgtctcgatcctccag
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      ccgctattcatctttgtgagaagatcttccctgctgtctcgatcctccag
A0A286XJN2_BCL2L11      ccgctattcatctttgtgagaagatcttccctgctgtctcgatcctccag
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      ccgcttttcatctttgtgagaagatcttccctgctgtctcgatcctccag
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       ccgcttttcatctttgtaagaagatcctccctgctgtctcgatcctccag
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctccag
A0A2K6GE31_BCL2L11      ccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctccag
A0A2K6GE31_BCL2L11      ccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctccag
A0A2K6GE31_BCL2L11      ccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctccag
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       --------------------------------------------------
F6XMC1_BCL2L11-01       ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
F6XMC1_BCL2L11-06       ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K5CAB2_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K6TRZ5_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
F6XMC1_BCL2L11-08       ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K5CAB2_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K6TRZ5_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
F6XMC1_BCL2L11-03       ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
F6XMC1_BCL2L11-04       ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K5CAB2_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K5CAB2_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K5CAB2_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K6TRZ5_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K6TRZ5_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
F6XMC1_BCL2L11-07       ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K5CAB2_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K6TRZ5_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K5CAB2_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
A0A2K6TRZ5_BCL2L11      ccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctccag
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      cc------------------------------------------------
O43521_BCL2L11-21       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I3HW02_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I2YQ13_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I3HW02_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2R9CA99_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2J8JCT2_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I2YQ13_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2R9CA99_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5NU92_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5X2I7_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
F7HHA9_BCL2L11-01       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6E226_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5Z8B6_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I3M6I1_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5NU92_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5X2I7_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6E226_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6E226_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5Z8B6_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6QIL2_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6QIL2_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6QIL2_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6KJP8_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6KJP8_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-18       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
O43521_BCL2L11-09       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
O43521_BCL2L11-16       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6QIL2_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5HZI7_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
O43521_BCL2L11-22       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
O43521_BCL2L11-08       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I2YQ13_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I3HW02_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2R9CA99_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2J8JCT2_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5NU92_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5X2I7_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
F7HHA9_BCL2L11-03       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6E226_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5Z8B6_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I3M6I1_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2R9CA99_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2J8JCT2_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2J8JCT2_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I2YQ13_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2R9CA99_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I3HW02_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6KJP8_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6QIL2_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
O43521_BCL2L11-24       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
O43521_BCL2L11-12       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I2YQ13_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I3HW02_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2R9CA99_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2J8JCT2_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5NU92_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5X2I7_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
F7HHA9_BCL2L11-06       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6E226_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5Z8B6_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I3M6I1_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5HZI7_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6KJP8_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6QIL2_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5HZI7_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5NU92_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5X2I7_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
F7HHA9_BCL2L11-04       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6E226_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5Z8B6_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I3M6I1_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5X2I7_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
F7HHA9_BCL2L11-02       ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6E226_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5Z8B6_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I3M6I1_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6KJP8_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K6QIL2_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2K5HZI7_BCL2L11      ccgcttttcatctttatgagaagatcctccctgctgtctcgatcctccag
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F1SU81_BCL2L11-01       ccgcttttcatcttcgtgagaagatcctccctgctgtctcgatcctccag
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       ccgcttttcatcttcgtgagaagatcctccctgctgtctcgatcctccag
F1SU81_BCL2L11-03       --------------------------------------------------
G3SU55_BCL2L11-01       ccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctccag
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       ccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctccag
J9NWV6_BCL2L11-01       ccgcttttcatctttgtgagaagatcctccctgctgtctcgatcctccag
A0A337SW42_BCL2L11      ccgtttttcatctttgtcagaagatcctccctgctgtctcgatcctccag
A0A337SW42_BCL2L11      ccgtttttcatctttgtcagaagatcctccctgctgtctcgatcctccag
A0A337SW42_BCL2L11      ccgtttttcatctttgtcagaagatcctccctgctgtctcgatcctccag
A0A337SW42_BCL2L11      ccgtttttcatctttgtcagaagatcctccctgctgtctcgatcctccag
A0A337SW42_BCL2L11      --------------------------------------------------
                                                                          

A0A3B3QC78_BCL2L11      cggatatcattcactcgacatttcccttcca--------------a--ac
B2KKY9_BCL2L11-01       tggctatttttccgtcgacagcgattctgtgccaggttcccctctaatgc
B8JK68_BCL2L11-01       tggctatttttccgtcgacagcgattctgtgccaggttcccctctaatgc
Q4KMV9_BCL2L11-01       tggctatttttcattcgaagtg-----------------------a--gt
M3XHJ5_BCL2L11-01       tggatattttacttttgactctgatatagttcat-----------a--gc
A0A3B1JXK6_BCL2L11      tggatatttctcgttcgacagcgagccc-----------------a--gc
W5UEE7_BCL2L11-01       tggatatttttcgttcgacagtgagccg-----------------a--gc
A0A3B4BVX1_BCL2L11      cggatacttttcgtttgagagcgagccc-----------------a--gc
A0A3B4BVX1_BCL2L11      cggatacttttcgtttgagagcgagccc-----------------a--gc
A0A3B4BVX1_BCL2L11      cggatacttttcgtttgagagcgagccc-----------------a--gc
A0A3B4V919_BCL2L11      tggatatttctccttcgacagcgactcgctaccgagctccccgctc--tc
A0A3B4XZH1_BCL2L11      tggatatttctccttcgacagcgactcgctaccgacctccccgctc--tc
U3IW89_BCL2L11-01       cggctacttctccttcga-----------ggccgagcgc------a--gc
A0A3B5M375_BCL2L11      cggatacttctcctttgactgcgactcgctgccgagctccccgctc--tc
A0A3B5QAM1_BCL2L11      cggatacttctcctttgactgcgactcgctgccgagctccccgctc--tc
A0A3B5QAM1_BCL2L11      cggatacttctcctttgactgcgactcgctgccgagctccccgctc--tc
A0A3B3VNE0_BCL2L11      cggatacttctcctttgactgcgactcgctgccgagctccccgctc--tc
A0A3B3YII5_BCL2L11      cggatacttctcctttgactgcgactcgctgccgagctccccgctc--tc
A0A3B3YII5_BCL2L11      cggatacttctcctttgactgcgactcgctgccgagctccccgctc--tc
R4G9R5_BCL2L11-01       ------------atgtgccgtggagaag-----------------a--ac
F7FTC8_BCL2L11-01       ---------------------agacagg-----------------a--gc
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       ---------------------agacagg-----------------a--gc
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       tgggtatttctcttttgacacagacagg-----------------a--gt
G3W979_BCL2L11-01       tgggtatttctcttttgacacagacagg-----------------a--gt
O43521_BCL2L11-11       -----tctcactctgtcacccaggctgg-----------------a--gt
F7HHA9_BCL2L11-08       -----tctcactctgttgcccaagctgg-----------------a--gt
G1SSY0_BCL2L11-01       tgggtatttctcttttgacacagacagg-----------------a--gc
O54918_BCL2L11-03       ---------------------agacagg-----------------a--gc
O88498_BCL2L11-01       tgggtatttctcttttgacacagacagg-----------------a--gc
O88498_BCL2L11-02       ---------------------agacagg-----------------a--gc
O54918_BCL2L11-05       ---------------------agacagg-----------------a--gc
O54918_BCL2L11-01       tgggtatttctcttttgacacagacagg-----------------a--gc
O54918_BCL2L11-08       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
W5PY58_BCL2L11-01       cgggtatttctcttttgacacagacagg-----------------a--gc
Q2YDF0_BCL2L11-02       tgggtatttctcttttgacacagacagg-----------------a--gc
Q2YDF0_BCL2L11-03       ---------------------agacagg-----------------a--gc
Q2YDF0_BCL2L11-01       ---------------------agacagg-----------------a--gc
A0A286XJN2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A286XJN2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A286XJN2_BCL2L11      ---------------------agacagg-----------------a--gc
A0A287DFJ0_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A287DFJ0_BCL2L11      ---------------------agacagg-----------------a--gc
H0XW23_BCL2L11-01       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6GE31_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6GE31_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6GE31_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6GE31_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2I3HW02_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2R9CA99_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2J8JCT2_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2I2YQ13_BCL2L11      ---------------------agacagg-----------------a--gc
O43521_BCL2L11-06       ---------------------agacagg-----------------a--gc
O43521_BCL2L11-15       ---------------------agacagg-----------------a--gc
A0A2K5X2I7_BCL2L11      ---------------------agacagg-----------------a--gc
F7HHA9_BCL2L11-09       ---------------------agacagg-----------------a--gc
A0A2K6E226_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K5NU92_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K5Z8B6_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2I3M6I1_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K5HZI7_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K6KJP8_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K6QIL2_BCL2L11      ---------------------agacagg-----------------a--gc
F6XMC1_BCL2L11-09       ---------------------agacagg-----------------a--gc
A0A2K5CAB2_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K6TRZ5_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       ---------------------agacagg-----------------a--gc
F6XMC1_BCL2L11-01       tgggtatttctcttttgacacagacagg-----------------a--gc
F6XMC1_BCL2L11-06       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5CAB2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6TRZ5_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
F6XMC1_BCL2L11-08       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5CAB2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6TRZ5_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
F6XMC1_BCL2L11-03       tgggtatttctcttttgacacagacagg-----------------a--gc
F6XMC1_BCL2L11-04       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5CAB2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5CAB2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5CAB2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5CAB2_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K6TRZ5_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6TRZ5_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6TRZ5_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6TRZ5_BCL2L11      ---------------------agacagg-----------------a--gc
F6XMC1_BCL2L11-05       tgggtatttctcttttgacacagacagg-----------------a--gc
F6XMC1_BCL2L11-07       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5CAB2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6TRZ5_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5CAB2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6TRZ5_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
H2P5E2_BCL2L11-01       ---------------------agacagg-----------------a--gc
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       tgggtatttctcttttgacacagacagg-----------------a--gc
O43521_BCL2L11-02       ---------------------agacagg-----------------a--gc
O43521_BCL2L11-03       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2J8JCT2_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2J8JCT2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I3HW02_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I2YQ13_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I3HW02_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2R9CA99_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2J8JCT2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I2YQ13_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2R9CA99_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I2YQ13_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2R9CA99_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2I3M6I1_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2I3M6I1_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2I3M6I1_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5NU92_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5X2I7_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
F7HHA9_BCL2L11-01       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6E226_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5Z8B6_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I3M6I1_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5NU92_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5X2I7_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6E226_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6E226_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5Z8B6_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5NU92_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K5X2I7_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K6E226_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K5Z8B6_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K5HZI7_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5HZI7_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K5HZI7_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6QIL2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6QIL2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6QIL2_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K6KJP8_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6QIL2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6KJP8_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6KJP8_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6KJP8_BCL2L11      ---------------------agacagg-----------------a--gc
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       ---------------------agacagg-----------------a--gc
O43521_BCL2L11-25       ---------------------agacagg-----------------a--gc
O43521_BCL2L11-18       tgggtatttctcttttgacacagacagg-----------------a--gc
O43521_BCL2L11-09       tgggtatttctcttttgacacagacagg-----------------a--gc
O43521_BCL2L11-16       tgggtatttctcttttgacacagacagg-----------------a--gc
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6QIL2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5HZI7_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
O43521_BCL2L11-22       tgggtatttctcttttgacacagacagg-----------------a--gc
O43521_BCL2L11-08       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I2YQ13_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I3HW02_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2R9CA99_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2J8JCT2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5NU92_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5X2I7_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
F7HHA9_BCL2L11-03       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6E226_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5Z8B6_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I3M6I1_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
O43521_BCL2L11-07       ---------------------agacagg-----------------a--gc
O43521_BCL2L11-19       ---------------------agacagg-----------------a--gc
A0A2I2YQ13_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2R9CA99_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2J8JCT2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2J8JCT2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I2YQ13_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2R9CA99_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I3HW02_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6KJP8_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6QIL2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
O43521_BCL2L11-24       tgggtatttctcttttgacacagacagg-----------------a--gc
O43521_BCL2L11-12       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I2YQ13_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I3HW02_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2R9CA99_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2J8JCT2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5NU92_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5X2I7_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
F7HHA9_BCL2L11-06       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6E226_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5Z8B6_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I3M6I1_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5HZI7_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6KJP8_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6QIL2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5HZI7_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5NU92_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5X2I7_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
F7HHA9_BCL2L11-04       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6E226_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5Z8B6_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I3M6I1_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A0D9RWE0_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K5NU92_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5X2I7_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
F7HHA9_BCL2L11-02       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6E226_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5Z8B6_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I3M6I1_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6KJP8_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K6QIL2_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2K5HZI7_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A2I3HW02_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2I2YQ13_BCL2L11      ---------------------agacagg-----------------a--gc
O43521_BCL2L11-23       ---------------------agacagg-----------------a--gc
A0A2R9CA99_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2J8JCT2_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2I3M6I1_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K5X2I7_BCL2L11      ---------------------agacagg-----------------a--gc
F7HHA9_BCL2L11-07       ---------------------agacagg-----------------a--gc
A0A2K5HZI7_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K5NU92_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K5Z8B6_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K5CAB2_BCL2L11      ---------------------agacagg-----------------a--gc
A0A2K6TRZ5_BCL2L11      ---------------------agacagg-----------------a--gc
F1SU81_BCL2L11-01       tgggtatttctcttttgacacagacagg-----------------a--gc
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       tgggtatttctcttttgacacagacagg-----------------a--gc
F1SU81_BCL2L11-03       ---------------------agacagg-----------------a--gc
G3SU55_BCL2L11-01       cgggtatttctcttttgacacagacagg-----------------a--gc
M3YDI3_BCL2L11-01       -----------------------acagg-----------------a--gc
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       tgggtatttctcttttgacacagacagg-----------------a--gc
J9NWV6_BCL2L11-01       tgggtatttctcttttgacacagacagg-----------------a--gc
A0A337SW42_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A337SW42_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A337SW42_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A337SW42_BCL2L11      tgggtatttctcttttgacacagacagg-----------------a--gc
A0A337SW42_BCL2L11      ---------------------agacagg-----------------a--gc
                                                                          

A0A3B3QC78_BCL2L11      tctccctttatgactcat-aacaagtcgacacagacccccagtccgtcta
B2KKY9_BCL2L11-01       ccaatatttccgaagcgc----aagacggacaaaatgatgaggtatggtt
B8JK68_BCL2L11-01       ccaatatttccgaagcgc----aagacggacaaaatgatgaggtatggtt
Q4KMV9_BCL2L11-01       cctgggcctgtgagctgt-gataaatcaactcaaacaccaagccctcctt
M3XHJ5_BCL2L11-01       cctgcacctgtaagtgtc-cacaaggctacacagactccaagcccatcaa
A0A3B1JXK6_BCL2L11      tccccgctcctgatgcac-agcgcgtccactcagaccccgagtccatcta
W5UEE7_BCL2L11-01       tctccgctaatcacccat-agcacagccactcagaccccgagtccgtcta
A0A3B4BVX1_BCL2L11      tctccgctcctgacct-------------------ctccttctctgtctg
A0A3B4BVX1_BCL2L11      tctccgctcgtgacgcac-agcgcgtccacgcagacccccagcccgtcta
A0A3B4BVX1_BCL2L11      tctccgctcgtgacgcac-agcgcgtccacgcagacccccagcccgtcta
A0A3B4V919_BCL2L11      cccgaggccagccacggttgaacgaaccacgcagaccccgagccccacca
A0A3B4XZH1_BCL2L11      cccgaggccagccacggctgaacgaaccacgcagaccccgagccccacca
U3IW89_BCL2L11-01       cccgcgcccatgagctgc-gacaaggccacgcagacccccagcccgccct
A0A3B5M375_BCL2L11      tccgcacccagtgacggctgacaaagccacgcagacccccagcctcaccg
A0A3B5QAM1_BCL2L11      tccgcacccagtgacggctgacaaagccacgcagacccccagcctcaccg
A0A3B5QAM1_BCL2L11      tccgcacccagtgacggctgacaaagccacgcagacccccagcctcaccg
A0A3B3VNE0_BCL2L11      tccgcacccagtgacggctgataaagccacgcagacccccagccccaccg
A0A3B3YII5_BCL2L11      tccgcacccagtgacggctgacaaagccacgcagacccccagccccaccg
A0A3B3YII5_BCL2L11      tccgcacccagtgacggctgacaaagccacgcagacccccagccccaccg
R4G9R5_BCL2L11-01       agggaggagatggtgtga-ggcagaa------------------------
F7FTC8_BCL2L11-01       cctccgcctgtgagttgc-gataaatcgacccagacccccagtccccact
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       cctgtgcctatgagttgc-gacaagtcgacgcagactccaagtccccctt
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       ccagcgcctatgagttgt-gataaatctacacaaactccaagccctcctt
G3W979_BCL2L11-01       ccagcgcctatgagttgt-gataaatctacacaaactccaagccctcctt
O43521_BCL2L11-11       ---gcactggtgcgatct---tggctcactgcaacctccaactc------
F7HHA9_BCL2L11-08       ---gcactggtactatct---tggctcactgcaacctccaactc------
G1SSY0_BCL2L11-01       ccggcacccatgagctgt-gacaaatcaacacaaaccccaagtcctcctt
O54918_BCL2L11-03       ccggcacccatgagttgt-gacaagtcaacacaaaccccaagtcctcctt
O88498_BCL2L11-01       ccggcacccatgagttgt-gacaagtcaacacaaaccccaagtcctcctt
O88498_BCL2L11-02       ccggcacccatgagttgt-gacaagtcaacacaaaccccaagtcctcctt
O54918_BCL2L11-05       ccggcacccatgagttgt-gacaagtcaacacaaaccccaagtcctcctt
O54918_BCL2L11-01       ccggcacccatgagttgt-gacaagtcaacacaaaccccaagtcctcctt
O54918_BCL2L11-08       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
W5PY58_BCL2L11-01       ccggcacccatgagttgt-gacaaatccacacagaccccaagccctcctt
Q2YDF0_BCL2L11-02       ccggcacccatgagttgt-gacaaatccacacagaccccaagccctcctt
Q2YDF0_BCL2L11-03       ccggcacccatgagttgt-gacaaatccacacagaccccaagccctcctt
Q2YDF0_BCL2L11-01       ccggcacccatgagttgt-gacaaatccacacagaccccaagccctcctt
A0A286XJN2_BCL2L11      ccggcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A286XJN2_BCL2L11      ccggcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A286XJN2_BCL2L11      ccggcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A287DFJ0_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A287DFJ0_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
H0XW23_BCL2L11-01       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6GE31_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6GE31_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6GE31_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6GE31_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3HW02_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2R9CA99_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2J8JCT2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I2YQ13_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-06       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-15       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5X2I7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F7HHA9_BCL2L11-09       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6E226_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5NU92_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5Z8B6_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3M6I1_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5HZI7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6KJP8_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6QIL2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F6XMC1_BCL2L11-09       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5CAB2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6TRZ5_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F6XMC1_BCL2L11-01       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F6XMC1_BCL2L11-06       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5CAB2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6TRZ5_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F6XMC1_BCL2L11-08       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5CAB2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6TRZ5_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F6XMC1_BCL2L11-03       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F6XMC1_BCL2L11-04       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5CAB2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5CAB2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5CAB2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5CAB2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6TRZ5_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6TRZ5_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6TRZ5_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6TRZ5_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F6XMC1_BCL2L11-05       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F6XMC1_BCL2L11-07       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5CAB2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6TRZ5_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5CAB2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6TRZ5_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
H2P5E2_BCL2L11-01       ccggcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6E226_BCL2L11      --------------ttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-21       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-02       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-03       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2J8JCT2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2J8JCT2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3HW02_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I2YQ13_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3HW02_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2R9CA99_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2J8JCT2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I2YQ13_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2R9CA99_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I2YQ13_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2R9CA99_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3M6I1_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3M6I1_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3M6I1_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5NU92_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5X2I7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F7HHA9_BCL2L11-01       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6E226_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5Z8B6_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3M6I1_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5NU92_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5X2I7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6E226_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6E226_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5Z8B6_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5NU92_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5X2I7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6E226_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5Z8B6_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5HZI7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5HZI7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5HZI7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6QIL2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6QIL2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6QIL2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6KJP8_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6QIL2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6KJP8_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6KJP8_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6KJP8_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-25       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-18       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-09       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-16       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6QIL2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5HZI7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-22       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-08       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I2YQ13_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3HW02_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2R9CA99_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2J8JCT2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5NU92_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5X2I7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F7HHA9_BCL2L11-03       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6E226_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5Z8B6_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3M6I1_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-07       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-19       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I2YQ13_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2R9CA99_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2J8JCT2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2J8JCT2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I2YQ13_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2R9CA99_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3HW02_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6KJP8_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6QIL2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-24       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-12       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I2YQ13_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3HW02_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2R9CA99_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2J8JCT2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5NU92_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5X2I7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F7HHA9_BCL2L11-06       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6E226_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5Z8B6_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3M6I1_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5HZI7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6KJP8_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6QIL2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5HZI7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5NU92_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5X2I7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F7HHA9_BCL2L11-04       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6E226_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5Z8B6_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3M6I1_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A0D9RWE0_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5NU92_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5X2I7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F7HHA9_BCL2L11-02       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6E226_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5Z8B6_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3M6I1_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6KJP8_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6QIL2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5HZI7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3HW02_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I2YQ13_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
O43521_BCL2L11-23       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2R9CA99_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2J8JCT2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2I3M6I1_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5X2I7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F7HHA9_BCL2L11-07       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5HZI7_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5NU92_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5Z8B6_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K5CAB2_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A2K6TRZ5_BCL2L11      ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F1SU81_BCL2L11-01       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
F1SU81_BCL2L11-03       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
G3SU55_BCL2L11-01       ccagcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
M3YDI3_BCL2L11-01       ccggcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       ccggcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
J9NWV6_BCL2L11-01       ccggcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A337SW42_BCL2L11      ccggcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A337SW42_BCL2L11      ccggcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A337SW42_BCL2L11      ccggcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A337SW42_BCL2L11      ccggcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
A0A337SW42_BCL2L11      ccggcacccatgagttgt-gacaaatcaacacaaaccccaagtcctcctt
                                                                          

A0A3B3QC78_BCL2L11      atcatcttgtttgcatt------tat--ttgagctcagta----------
B2KKY9_BCL2L11-01       atcagaacat-agccac------cag------------------------
B8JK68_BCL2L11-01       atcagaacat-agccac------cag------------------------
Q4KMV9_BCL2L11-01       gtcaggcatttaatcatctc--------ctttccgcaatg----------
M3XHJ5_BCL2L11-01       gccaactcatcgtacacgtacagcattgcttagcgcaaaga---------
A0A3B1JXK6_BCL2L11      gccaagtcataattcacgcccttcag--cgcatttccgaggcgcgaggcg
W5UEE7_BCL2L11-01       gtcaagtgataactcacgccctgcag--cgcatttccaaagcgcgaggcg
A0A3B4BVX1_BCL2L11      --------------tgtgttccaca-------------------------
A0A3B4BVX1_BCL2L11      gtcaagtaatcactcacgccctgcag--cgcattgctgaggcgcgaggga
A0A3B4BVX1_BCL2L11      gtcaagtaatcactcacgccctgcag--cgcattgctgaggcgcgaggga
A0A3B4V919_BCL2L11      gccaggtgatgaaacacgccttgcag--cgcatggcggaggcgcac----
A0A3B4XZH1_BCL2L11      gccaggtgatgaaacacgccttgcag--cgcatggcggaggcgcac----
U3IW89_BCL2L11-01       gccaggccgtcagccac---------------------------------
A0A3B5M375_BCL2L11      gccaggtgatgaaccacgccctgcag--cgaatggctgtggagcac----
A0A3B5QAM1_BCL2L11      gccaggtgatgaaccacgccctgcag--cgaatggctgtggagcac----
A0A3B5QAM1_BCL2L11      gccaggtgatgaaccacgccctgcag--cgaatggctgtggagcac----
A0A3B3VNE0_BCL2L11      gccaggtgatgaaccacgccctgcag--cgaatggctgtggagcac----
A0A3B3YII5_BCL2L11      gccaggtgatgaaccacgccctgcag--cgaatggctgtggagcac----
A0A3B3YII5_BCL2L11      gccaggtgatgaaccacgccctgcag--cgaatggctgtggagcac----
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       gtcaagccttcaatcat------tat--ctaagtgcaatg----------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       gtcaagcctttaatcat------tat--ctaagtgcaatgggtaag----
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       gtcaagccttcaatcat------tat--ctaagtgcaatg----------
G3W979_BCL2L11-01       gtcaagccttcaatcat------tat--ctaagtgcaatggataca----
O43521_BCL2L11-11       -ccaag--ttcaagc------------------------g----------
F7HHA9_BCL2L11-08       -ccaag--ttcaagc------------------------g----------
G1SSY0_BCL2L11-01       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O54918_BCL2L11-03       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O88498_BCL2L11-01       gccaggccttcaaccat------tat--ctcagtgcaatg----------
O88498_BCL2L11-02       gccaggccttcaaccat------tat--ctcagtgcaatg----------
O54918_BCL2L11-05       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O54918_BCL2L11-01       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O54918_BCL2L11-08       ---------------------------------------a----------
O54918_BCL2L11-06       ---------------------------------------a----------
W5PY58_BCL2L11-01       gccaggccttcaaccat------tat--ctcagtgcaatg----------
Q2YDF0_BCL2L11-02       gccaggccttcaaccat------tat--ctcagtgcaatg----------
Q2YDF0_BCL2L11-03       gccaggccttcaaccat------tat--ctcagtgcaatg----------
Q2YDF0_BCL2L11-01       gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A286XJN2_BCL2L11      gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A286XJN2_BCL2L11      gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A286XJN2_BCL2L11      gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A287DFJ0_BCL2L11      gccaggccttcaaccat------tat--ctgagtgcaatg----------
A0A287DFJ0_BCL2L11      gccaggccttcaaccat------tat--ctgagtgcaatg----------
H0XW23_BCL2L11-01       gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A2K6GE31_BCL2L11      gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A2K6GE31_BCL2L11      gccaggccttcaaccat------tat--ctcagtgcaat-----------
A0A2K6GE31_BCL2L11      gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A2K6GE31_BCL2L11      gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A2I3HW02_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2R9CA99_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2J8JCT2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I2YQ13_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-06       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-15       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5X2I7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
F7HHA9_BCL2L11-09       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6E226_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5NU92_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5Z8B6_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3M6I1_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5HZI7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6KJP8_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6QIL2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
F6XMC1_BCL2L11-09       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5CAB2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6TRZ5_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       gccaggccttcaaccac------tat--ctcagtgcaatg----------
F6XMC1_BCL2L11-01       gccaggccttcaaccac------tat--ctcagtgcaatg----------
F6XMC1_BCL2L11-06       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5CAB2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6TRZ5_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
F6XMC1_BCL2L11-08       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5CAB2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6TRZ5_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
F6XMC1_BCL2L11-03       gccaggccttcaaccac------tat--ctcagtgcaatg----------
F6XMC1_BCL2L11-04       gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2K5CAB2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2K5CAB2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5CAB2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5CAB2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6TRZ5_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2K6TRZ5_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6TRZ5_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6TRZ5_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
F6XMC1_BCL2L11-05       gccaggccttcaaccac------tat--ctcagtgcaatg----------
F6XMC1_BCL2L11-07       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5CAB2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6TRZ5_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5CAB2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6TRZ5_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
H2P5E2_BCL2L11-01       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6E226_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-21       gccaggccttcaaccac------tat--ctcagtgcaat-----------
O43521_BCL2L11-02       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-03       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2J8JCT2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2J8JCT2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3HW02_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I2YQ13_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2I3HW02_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2R9CA99_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2J8JCT2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2I2YQ13_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2R9CA99_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I2YQ13_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2R9CA99_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3M6I1_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3M6I1_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3M6I1_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5NU92_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2K5X2I7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
F7HHA9_BCL2L11-01       gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2K6E226_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2K5Z8B6_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2I3M6I1_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2K5NU92_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5X2I7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6E226_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6E226_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5Z8B6_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5NU92_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5X2I7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6E226_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5Z8B6_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5HZI7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2K5HZI7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5HZI7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6QIL2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6QIL2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6QIL2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6KJP8_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2K6QIL2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaat-----------
A0A2K6KJP8_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6KJP8_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6KJP8_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-25       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-18       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-09       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-16       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6QIL2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5HZI7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-22       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-08       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I2YQ13_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3HW02_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2R9CA99_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2J8JCT2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5NU92_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5X2I7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
F7HHA9_BCL2L11-03       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6E226_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5Z8B6_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3M6I1_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-07       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-19       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I2YQ13_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2R9CA99_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2J8JCT2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2J8JCT2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I2YQ13_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2R9CA99_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3HW02_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6KJP8_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6QIL2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-24       gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-12       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I2YQ13_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3HW02_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2R9CA99_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2J8JCT2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5NU92_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5X2I7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
F7HHA9_BCL2L11-06       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6E226_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5Z8B6_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3M6I1_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5HZI7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6KJP8_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6QIL2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5HZI7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5NU92_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5X2I7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
F7HHA9_BCL2L11-04       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6E226_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5Z8B6_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3M6I1_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A0D9RWE0_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5NU92_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5X2I7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
F7HHA9_BCL2L11-02       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6E226_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5Z8B6_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3M6I1_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6KJP8_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6QIL2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5HZI7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3HW02_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I2YQ13_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
O43521_BCL2L11-23       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2R9CA99_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2J8JCT2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2I3M6I1_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5X2I7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
F7HHA9_BCL2L11-07       gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5HZI7_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5NU92_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5Z8B6_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K5CAB2_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
A0A2K6TRZ5_BCL2L11      gccaggccttcaaccac------tat--ctcagtgcaatg----------
F1SU81_BCL2L11-01       gccaagccttcaaccat------tat--ctcagtgcgatg----------
C1KGB8_BCL2L11-01       ---------------------------------------a----------
F1SU81_BCL2L11-02       gccaagccttcaaccat------tat--ctcagtgcgatg----------
F1SU81_BCL2L11-03       gccaagccttcaaccat------tat--ctcagtgcgatg----------
G3SU55_BCL2L11-01       gccaggccatcaaccat------tac--ctcagtgcaatg----------
M3YDI3_BCL2L11-01       gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       gccaggccttcaaccat------tat--ctcagtgcaatg----------
J9NWV6_BCL2L11-01       gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A337SW42_BCL2L11      gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A337SW42_BCL2L11      gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A337SW42_BCL2L11      gccaggccttcaaccat------tat--ctcagtgcaat-----------
A0A337SW42_BCL2L11      gccaggccttcaaccat------tat--ctcagtgcaatg----------
A0A337SW42_BCL2L11      gccaggccttcaaccat------tat--ctcagtgcaatg----------
                                                                          

A0A3B3QC78_BCL2L11      ---------------------------------------------acgcg
B2KKY9_BCL2L11-01       -----------------------------------cacttgcagatggca
B8JK68_BCL2L11-01       -----------------------------------cacttgcagatggca
Q4KMV9_BCL2L11-01       ------------------------------------gctgacagaaatc-
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      acgctcagagtttcgagttatgtc---caggacctaaccactgtccacc-
W5UEE7_BCL2L11-01       acgcgcagaatcatgaattatggcctgctctccttaaccactatccacc-
A0A3B4BVX1_BCL2L11      --------------gaattatggc---ccctctataaccaccatccgcc-
A0A3B4BVX1_BCL2L11      acgctcagactttcgaattatggc---ccctctataaccaccatccgcc-
A0A3B4BVX1_BCL2L11      acgctcagactttcgaattatggc---ccctctataaccaccatccgcc-
A0A3B4V919_BCL2L11      ---------------------------ggcggaggagcgaggat---gca
A0A3B4XZH1_BCL2L11      ---------------------------ggcggaggagcgaggatgcagca
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      ---------------------------ggtggactcgggctgcagg----
A0A3B5QAM1_BCL2L11      ---------------------------ggtggactcggcctgcacgggca
A0A3B5QAM1_BCL2L11      ---------------------------ggtggactcggcctgcacgggca
A0A3B3VNE0_BCL2L11      ---------------------------ggtggactcgggctgcacgggca
A0A3B3YII5_BCL2L11      ---------------------------ggtggactcgggctgcacgggca
A0A3B3YII5_BCL2L11      ---------------------------ggtggactcgggctgcacgggca
R4G9R5_BCL2L11-01       ------------------------------------acttccagatggca
F7FTC8_BCL2L11-01       ------------------------------------gcttccattagaca
G1MV54_BCL2L11-01       ------------------------------------gcttccaggtggcg
K7GA86_BCL2L11-01       ---------------------------caagatcatgcttccaggtggga
G1PDJ5_BCL2L11-01       ---------------------------------------tccatgcagca
F7CXT2_BCL2L11-01       ------------------------------------gcttccatgaggca
G3W979_BCL2L11-01       ------------------------------------gcttccatgaggca
O43521_BCL2L11-11       ------------------------------------gttctcctgcctca
F7HHA9_BCL2L11-08       ------------------------------------gttctcctgcctca
G1SSY0_BCL2L11-01       ------------------------------------gcttccatgaggca
O54918_BCL2L11-03       ------------------------------------gat---------ca
O88498_BCL2L11-01       ------------------------------------gcttccataaggca
O88498_BCL2L11-02       ------------------------------------gcttccataaggca
O54918_BCL2L11-05       ------------------------------------gcttccatacgaca
O54918_BCL2L11-01       ------------------------------------gcttccatacgaca
O54918_BCL2L11-08       ------------------------------------gcttccatacgaca
O54918_BCL2L11-06       ------------------------------------gcttccatacgaca
W5PY58_BCL2L11-01       ------------------------------------gcttccatgaggca
Q2YDF0_BCL2L11-02       ------------------------------------gcttccatgaggca
Q2YDF0_BCL2L11-03       ------------------------------------gcttccatgaggca
Q2YDF0_BCL2L11-01       ------------------------------------gcttccatgaggca
A0A286XJN2_BCL2L11      ------------------------------------gcttccatgaggca
A0A286XJN2_BCL2L11      ------------------------------------gcttccatgaggca
A0A286XJN2_BCL2L11      ------------------------------------gcttccatgaggca
A0A287DFJ0_BCL2L11      ------------------------------------gcttccatgcggga
A0A287DFJ0_BCL2L11      ------------------------------------gcttccatgcggga
H0XW23_BCL2L11-01       ------------------------------------gcttccatgaggca
A0A2K6GE31_BCL2L11      -------------------------------------cttccatgaggca
A0A2K6GE31_BCL2L11      ------------------------------------gtt-----------
A0A2K6GE31_BCL2L11      ------------------------------------gcttccatgaggca
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ------------------------------------gcttccatgaggca
A0A2K6GE31_BCL2L11      ------------------------------------gcttccatgaggca
A0A2I3HW02_BCL2L11      ------------------------------------gtagtcatcctaga
A0A2R9CA99_BCL2L11      ------------------------------------gtagtcatcctaga
A0A2J8JCT2_BCL2L11      ------------------------------------gtagtcatcctaga
A0A2I2YQ13_BCL2L11      ------------------------------------gtagtcatcctaga
O43521_BCL2L11-06       ------------------------------------gtagtcatcctaga
O43521_BCL2L11-15       ------------------------------------gtagtcatcctaga
A0A2K5X2I7_BCL2L11      ------------------------------------gtagtcatcctaga
F7HHA9_BCL2L11-09       ------------------------------------gtagtcatcctaga
A0A2K6E226_BCL2L11      ------------------------------------gtagtcatcctaga
A0A2K5NU92_BCL2L11      ------------------------------------gtagtcattctgga
A0A2K5Z8B6_BCL2L11      ------------------------------------gtagtcattctaga
A0A2I3M6I1_BCL2L11      ------------------------------------gtagtcattctaga
A0A2K5HZI7_BCL2L11      ------------------------------------gtagtcatcctaga
A0A2K6KJP8_BCL2L11      ------------------------------------gtagtcatcctaga
A0A2K6QIL2_BCL2L11      ------------------------------------gtagtcatcctaga
F6XMC1_BCL2L11-09       ------------------------------------gtagtcatccgaat
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ------------------------------------gtagtcatccgaat
A0A2K5NU92_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5X2I7_BCL2L11      ------------------------------------gcttccaggaggca
F7HHA9_BCL2L11-05       ------------------------------------gcttccaggaggca
A0A2K5Z8B6_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5HZI7_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6QIL2_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6KJP8_BCL2L11      ------------------------------------gcttccaggaggca
O43521_BCL2L11-13       ------------------------------------gcttccatgaggca
O43521_BCL2L11-17       ------------------------------------gcttccatgaggca
A0A2J8JCT2_BCL2L11      ------------------------------------gcttccatgaggca
A0A2I3HW02_BCL2L11      ------------------------------------gcttccatgaggca
A0A2I2YQ13_BCL2L11      ------------------------------------gcttccatgaggca
A0A2R9CA99_BCL2L11      ------------------------------------gcttccatgaggca
F6XMC1_BCL2L11-02       ------------------------------------gcttccatgaggca
F6XMC1_BCL2L11-01       ------------------------------------gcttccatgaggca
F6XMC1_BCL2L11-06       ------------------------------------gtt-----------
A0A2K5CAB2_BCL2L11      ------------------------------------gtt-----------
A0A2K6TRZ5_BCL2L11      ------------------------------------gtt-----------
F6XMC1_BCL2L11-08       ------------------------------------g-------gataca
A0A2K5CAB2_BCL2L11      ------------------------------------gct-----------
A0A2K6TRZ5_BCL2L11      ------------------------------------gct-----------
F6XMC1_BCL2L11-03       ------------------------------------gcttccatgaggca
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      ------------------------------------gcttccatgaggca
A0A2K5CAB2_BCL2L11      ------------------------------------gcttccatgaggca
A0A2K5CAB2_BCL2L11      ------------------------------------gcttccatgaggca
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ------------------------------------gcttccatgaggca
A0A2K6TRZ5_BCL2L11      ------------------------------------gcttccatgaggca
A0A2K6TRZ5_BCL2L11      ------------------------------------gcttccatgaggca
F6XMC1_BCL2L11-05       ------------------------------------gcttccatgaggca
F6XMC1_BCL2L11-07       ------------------------------------gcttccatgaggca
A0A2K5CAB2_BCL2L11      ------------------------------------gcttccatgaggca
A0A2K6TRZ5_BCL2L11      ------------------------------------gcttccatgaggca
A0A2K5CAB2_BCL2L11      ------------------------------------gcttccatgaggca
A0A2K6TRZ5_BCL2L11      ------------------------------------gcttccatgaggca
H2P5E2_BCL2L11-01       ------------------------------------gcttccatgaggca
A0A2K6E226_BCL2L11      ------------------------------------gcttccaggaggca
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       ------------------------------------gcttccatgaggca
O43521_BCL2L11-03       ------------------------------------gcttccatgaggca
A0A2J8JCT2_BCL2L11      ------------------------------------gcttccatgaggca
A0A2J8JCT2_BCL2L11      ------------------------------------gcttccatgaggca
A0A2I3HW02_BCL2L11      ------------------------------------gcttccatgaggca
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      ------------------------------------gcttccatgaggca
A0A2R9CA99_BCL2L11      ------------------------------------gcttccatgaggca
A0A2I2YQ13_BCL2L11      ------------------------------------gcttccatgaggca
A0A2R9CA99_BCL2L11      ------------------------------------gcttccatgaggca
A0A2I3M6I1_BCL2L11      ------------------------------------gcttccaggaggca
A0A2I3M6I1_BCL2L11      ------------------------------------gcttccaggaggca
A0A2I3M6I1_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5X2I7_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6E226_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6E226_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5Z8B6_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5NU92_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5X2I7_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6E226_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5Z8B6_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5HZI7_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6QIL2_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6QIL2_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6QIL2_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6KJP8_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6KJP8_BCL2L11      ------------------------------------gcttccaggaggca
Q6JTU4_BCL2L11-01       ---------------------------------------------aggca
O43521_BCL2L11-05       ------------------------------------gcttccatgaggca
O43521_BCL2L11-25       ------------------------------------gcttccatgaggca
O43521_BCL2L11-18       ------------------------------------gcttccatgaggca
O43521_BCL2L11-09       ------------------------------------gcttccatgaggca
O43521_BCL2L11-16       ------------------------------------gcttccatgaggca
O43521_BCL2L11-10       ------------------------------------gcttccatgaggca
O43521_BCL2L11-20       ------------------------------------gcttccatgaggca
A0A2K6KJP8_BCL2L11      ------------------------------------gtt-----------
A0A2K6QIL2_BCL2L11      ------------------------------------gtt-----------
A0A2K5HZI7_BCL2L11      ------------------------------------gtt-----------
O43521_BCL2L11-22       ------------------------------------gtt-----------
O43521_BCL2L11-08       ------------------------------------gtt-----------
A0A2I2YQ13_BCL2L11      ------------------------------------gtt-----------
A0A2I3HW02_BCL2L11      ------------------------------------gtt-----------
A0A2R9CA99_BCL2L11      ------------------------------------gtt-----------
A0A2J8JCT2_BCL2L11      ------------------------------------gtt-----------
A0A2K5NU92_BCL2L11      ------------------------------------gtt-----------
A0A2K5X2I7_BCL2L11      ------------------------------------gtt-----------
F7HHA9_BCL2L11-03       ------------------------------------gtt-----------
A0A2K6E226_BCL2L11      ------------------------------------gtt-----------
A0A2K5Z8B6_BCL2L11      ------------------------------------gtt-----------
A0A2I3M6I1_BCL2L11      ------------------------------------gtt-----------
O43521_BCL2L11-07       ------------------------------------gtt-----------
O43521_BCL2L11-19       ------------------------------------gtt-----------
A0A2I2YQ13_BCL2L11      ------------------------------------gcttccatgaggca
A0A2R9CA99_BCL2L11      ------------------------------------gcttccatgaggca
A0A2J8JCT2_BCL2L11      ------------------------------------gcttccatgaggca
A0A2J8JCT2_BCL2L11      ------------------------------------gcttccatgaggca
A0A2I2YQ13_BCL2L11      ------------------------------------gcttccatgaggca
A0A2R9CA99_BCL2L11      ------------------------------------gcttccatgaggca
A0A2I3HW02_BCL2L11      ------------------------------------gcttccatgaggca
A0A2K6KJP8_BCL2L11      ------------------------------------gctaactgg-----
A0A2K6QIL2_BCL2L11      ------------------------------------gctaactgg-----
O43521_BCL2L11-24       ------------------------------------gctaactgg-----
O43521_BCL2L11-12       ------------------------------------gctaactgg-----
A0A2I2YQ13_BCL2L11      ------------------------------------gctaactgg-----
A0A2I3HW02_BCL2L11      ------------------------------------gctaactgg-----
A0A2R9CA99_BCL2L11      ------------------------------------gctaactgg-----
A0A2J8JCT2_BCL2L11      ------------------------------------gctaactgg-----
A0A2K5NU92_BCL2L11      ------------------------------------gctaactgg-----
A0A2K5X2I7_BCL2L11      ------------------------------------gctaactgg-----
F7HHA9_BCL2L11-06       ------------------------------------gctaactgg-----
A0A2K6E226_BCL2L11      ------------------------------------gctaactgg-----
A0A2K5Z8B6_BCL2L11      ------------------------------------gctaactgg-----
A0A2I3M6I1_BCL2L11      ------------------------------------gctaactgg-----
A0A2K5HZI7_BCL2L11      ------------------------------------gctaactgg-----
A0A2K6KJP8_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6QIL2_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5HZI7_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5NU92_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5X2I7_BCL2L11      ------------------------------------gcttccaggaggca
F7HHA9_BCL2L11-04       ------------------------------------gcttccaggaggca
A0A2K6E226_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5Z8B6_BCL2L11      ------------------------------------gcttccaggaggca
A0A2I3M6I1_BCL2L11      ------------------------------------gcttccaggaggca
A0A0D9RWE0_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5NU92_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5X2I7_BCL2L11      ------------------------------------gcttccaggaggca
F7HHA9_BCL2L11-02       ------------------------------------gcttccaggaggca
A0A2K6E226_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5Z8B6_BCL2L11      ------------------------------------gcttccaggaggca
A0A2I3M6I1_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6KJP8_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K6QIL2_BCL2L11      ------------------------------------gcttccaggaggca
A0A2K5HZI7_BCL2L11      ------------------------------------gcttccaggaggca
A0A2I3HW02_BCL2L11      ------------------------------------g-----atgaggc-
A0A2I2YQ13_BCL2L11      ------------------------------------g-----atgactc-
O43521_BCL2L11-23       ------------------------------------g-----atgactc-
A0A2R9CA99_BCL2L11      ------------------------------------g-----atgactc-
A0A2J8JCT2_BCL2L11      ------------------------------------g-----atgactc-
A0A2I3M6I1_BCL2L11      ------------------------------------g-----atgaggc-
A0A2K5X2I7_BCL2L11      ------------------------------------g-----atgaggc-
F7HHA9_BCL2L11-07       ------------------------------------g-----atgaggc-
A0A2K5HZI7_BCL2L11      ------------------------------------g-----atgaggc-
A0A2K5NU92_BCL2L11      ------------------------------------g-----atgaggc-
A0A2K5Z8B6_BCL2L11      ------------------------------------g-----atgaggc-
A0A2K5CAB2_BCL2L11      ------------------------------------g-----atgaggc-
A0A2K6TRZ5_BCL2L11      ------------------------------------g-----atgaggc-
F1SU81_BCL2L11-01       ------------------------------------gcttccatgaggca
C1KGB8_BCL2L11-01       ------------------------------------gcttccatgaggca
F1SU81_BCL2L11-02       ------------------------------------gcttccatgaggca
F1SU81_BCL2L11-03       ------------------------------------gcttccatgaggca
G3SU55_BCL2L11-01       ------------------------------------gcttccatgaggca
M3YDI3_BCL2L11-01       ------------------------------------gcttccaggaggca
A0A337SW42_BCL2L11      -------------------------------------cttccatgaggca
G1LDR8_BCL2L11-01       ------------------------------------gcttccatgaggca
J9NWV6_BCL2L11-01       ------------------------------------gcttccatgaggca
A0A337SW42_BCL2L11      ------------------------------------gtt-----------
A0A337SW42_BCL2L11      ------------------------------------gcttccatgaggca
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      ------------------------------------gcttccatgaggca
A0A337SW42_BCL2L11      ------------------------------------gcttccatgaggca
                                                                          

A0A3B3QC78_BCL2L11      gacgct-gtcgatgctgccg-----------------gacatgcggccag
B2KKY9_BCL2L11-01       gcacca--------gtcgca-----------------gccctgccgccgg
B8JK68_BCL2L11-01       gcacca--------gtcgca-----------------gccctgccgccgg
Q4KMV9_BCL2L11-01       ---------------ctgtg--------------aatcagatgtcaccag
M3XHJ5_BCL2L11-01       -------------------------------------gaacagcatcccg
A0A3B1JXK6_BCL2L11      -ccacagagcagcggctgcg--------------ggggacatgcaagcgc
W5UEE7_BCL2L11-01       -ccacggagcagcatctgcg--------------ggggacatgcaagcgg
A0A3B4BVX1_BCL2L11      -ccacggagcagcgcctgcg--------------ggggacatgcgaccgg
A0A3B4BVX1_BCL2L11      -ccacggagcagcgcctgcg--------------ggggacatgcgaccgg
A0A3B4BVX1_BCL2L11      -ccacggagcagcgcctgcg--------------ggggacatgcgaccgg
A0A3B4V919_BCL2L11      gcagcagcacggtgagc---------------------------------
A0A3B4XZH1_BCL2L11      gcagcagcacggtgagcacaggcactttgcatcaggggacatgcaggcgg
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      ---------------------------------------------gtgag
A0A3B5QAM1_BCL2L11      gtctcccaaccactatagcactattaacgcggcacgggatatgcagtcag
A0A3B5QAM1_BCL2L11      gtctcccaaccactatagcactattaacgcggcacgggatatgcagtcag
A0A3B3VNE0_BCL2L11      ctctcccaaccactatagcactattaacgcggcgcgggatatgcagtcag
A0A3B3YII5_BCL2L11      ctctcccaaccactatagcactattaacgcggcgcgggatatgcagtcag
A0A3B3YII5_BCL2L11      ctctcccaaccactatagcactattaacgcggcgcgggatatgcagtcag
R4G9R5_BCL2L11-01       gtcacg-gccaattcctgaa-----------------gatatgcagccag
F7FTC8_BCL2L11-01       gcctca-gtctgttcctgaa-----------------gatatgcggccgg
G1MV54_BCL2L11-01       atctca-ctcacttgcagaa-----------------gaaatacaaccag
K7GA86_BCL2L11-01       gtcccc-ctcaatacgtgaa-----------------gacatgcagccag
G1PDJ5_BCL2L11-01       gtctca-ggccctacctgta-----------------gacatgcgtccgg
F7CXT2_BCL2L11-01       gtctca-atcaatacctgca-----------------gatatgcggccag
G3W979_BCL2L11-01       gtctca-gtcaatacctgca-----------------gatatgcgaccag
O43521_BCL2L11-11       gcctcc--------------------------------------------
F7HHA9_BCL2L11-08       gcctcc--------------------------------------------
G1SSY0_BCL2L11-01       gtctca-ggctgaacctgca-----------------gacacgcgtccgg
O54918_BCL2L11-03       gt------------------------------------------------
O88498_BCL2L11-01       gtctca-ggaggaacctgaa-----------------gatctgcgcccag
O88498_BCL2L11-02       gtctca-ggaggaacctgaa-----------------gatctgcgcccag
O54918_BCL2L11-05       gtctca-ggaggaacctgaa-----------------gatctgcgcccgg
O54918_BCL2L11-01       gtctca-ggaggaacctgaa-----------------gatctgcgcccgg
O54918_BCL2L11-08       gtctca-ggaggaacctgaa-----------------gatctgcgcccgg
O54918_BCL2L11-06       gtctca-ggaggaacctgaa-----------------gatctgcgcccgg
W5PY58_BCL2L11-01       gtctca-ggctgtacctgca-----------------gatacacgcccag
Q2YDF0_BCL2L11-02       gtctca-ggctgtacctgca-----------------gatacacgcccag
Q2YDF0_BCL2L11-03       gtctca-ggctgtacctgca-----------------gatacacgcccag
Q2YDF0_BCL2L11-01       gtctca-ggctgtacctgca-----------------gatacacgcccag
A0A286XJN2_BCL2L11      gtctca-ggctggacctccg-----------------catttgcgcccag
A0A286XJN2_BCL2L11      gtctca-ggctggacctccg-----------------catttgcgcccag
A0A286XJN2_BCL2L11      gtctca-ggctggacctccg-----------------catttgcgcccag
A0A287DFJ0_BCL2L11      gtctca-ggcagaacctgca-----------------gacatgcgcccgg
A0A287DFJ0_BCL2L11      gtctca-ggcagaacctgca-----------------gacatgcgcccgg
H0XW23_BCL2L11-01       gtctca-ggccgaacctgca-----------------gatttgcgcccgg
A0A2K6GE31_BCL2L11      atttca-ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6GE31_BCL2L11      ------------------------------------------------ag
A0A2K6GE31_BCL2L11      atttca-ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      atttca-ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6GE31_BCL2L11      atttca-ggctgaacctgca-----------------gatatgcgcccgg
A0A2I3HW02_BCL2L11      ggatgt-aggtgatatttca-----------------ctgtggtttggat
A0A2R9CA99_BCL2L11      ggatat-aggtgatctttca-----------------ctgtgctttggat
A0A2J8JCT2_BCL2L11      ggatat-aggtgatctttca-----------------ctgtgctttggat
A0A2I2YQ13_BCL2L11      ggatat-aggtgatctttca-----------------ctgtggtttggat
O43521_BCL2L11-06       ggatat-aggtgatctttca-----------------ctgtgctttggat
O43521_BCL2L11-15       ggatat-aggtgatctttca-----------------ctgtgctttggat
A0A2K5X2I7_BCL2L11      ggatat-aggtgatagttca-----------------ttgtggtttggat
F7HHA9_BCL2L11-09       ggatat-aggtgatagttca-----------------ttgtggtttggat
A0A2K6E226_BCL2L11      ggatat-aggtgatagttca-----------------ttgtggtttggat
A0A2K5NU92_BCL2L11      ggatat-aggtgatagttca-----------------ttgtggtttggat
A0A2K5Z8B6_BCL2L11      ggatat-aggtgatagttca-----------------tt---gtttggat
A0A2I3M6I1_BCL2L11      ggatat-aggtgatagttca-----------------ttgtggtttggat
A0A2K5HZI7_BCL2L11      ggatat-aggtgatacttca-----------------ttgtggtttggat
A0A2K6KJP8_BCL2L11      ggatat-aggtgatacttca-----------------ttgtggtttggat
A0A2K6QIL2_BCL2L11      ggatat-aggtgatacttca-----------------ttgtggtttggat
F6XMC1_BCL2L11-09       ggatat-aggtgatatttca-----------------ttgtggtttagat
A0A2K5CAB2_BCL2L11      --------ggtgatatttca-----------------ttgtggtttagat
A0A2K6TRZ5_BCL2L11      ggatat-aggtgatatttca-----------------ttgtggtttaggt
A0A2K5NU92_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5X2I7_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
F7HHA9_BCL2L11-05       -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5Z8B6_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5HZI7_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6QIL2_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6KJP8_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
O43521_BCL2L11-13       -------ggctgaacctgca-----------------gatatgcgcccag
O43521_BCL2L11-17       -------ggctgaacctgca-----------------gatatgcgcccag
A0A2J8JCT2_BCL2L11      -------ggctgaacctgca-----------------gatatgcgaccgg
A0A2I3HW02_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2I2YQ13_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2R9CA99_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
F6XMC1_BCL2L11-02       atctca-ggctgaacctgca-----------------ggtatgcgcccgg
F6XMC1_BCL2L11-01       atctca-ggctgaacctgca-----------------ggtatgcgcccgg
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       gactcactggtcagcagcca-----------------tgtctgccctgga
A0A2K5CAB2_BCL2L11      -------gactgg-------------------------------------
A0A2K6TRZ5_BCL2L11      -------gactgg-------------------------------------
F6XMC1_BCL2L11-03       atctca-ggctgaacctgca-----------------ggtatgcgcccgg
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      atctca-ggctgaacctgca-----------------ggtatgcgcccgg
A0A2K5CAB2_BCL2L11      atctca-ggctgaacctgca-----------------ggtatgcgcccgg
A0A2K5CAB2_BCL2L11      atctca-ggctgaacctgca-----------------ggtatgcgcccgg
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      atctca-ggctgaacctgca-----------------ggtatgcgcccgg
A0A2K6TRZ5_BCL2L11      atctca-ggctgaacctgca-----------------ggtatgcgcccgg
A0A2K6TRZ5_BCL2L11      atctca-ggctgaacctgca-----------------ggtatgcgcccgg
F6XMC1_BCL2L11-05       atctca-ggctgaacctgca-----------------ggtatgcgcccgg
F6XMC1_BCL2L11-07       atctca-ggctgaacctgca-----------------ggtatgcgcccgg
A0A2K5CAB2_BCL2L11      atctca-ggctgaacctgca-----------------ggtatgcgcccgg
A0A2K6TRZ5_BCL2L11      atctca-ggctgaacctgca-----------------ggtatgcgcccgg
A0A2K5CAB2_BCL2L11      atctca-ggctgaacctgca-----------------ggtatgcgcccgg
A0A2K6TRZ5_BCL2L11      atctca-ggctgaacctgca-----------------ggtatgcgcccgg
H2P5E2_BCL2L11-01       -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6E226_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       -------ggctgaacctgca-----------------gatatgcgcccag
O43521_BCL2L11-03       -------ggctgaacctgca-----------------gatatgcgcccag
A0A2J8JCT2_BCL2L11      -------ggctgaacctgca-----------------gatatgcgaccgg
A0A2J8JCT2_BCL2L11      -------ggctgaacctgca-----------------gatatgcgaccgg
A0A2I3HW02_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2R9CA99_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2I2YQ13_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2R9CA99_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2I3M6I1_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2I3M6I1_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2I3M6I1_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5X2I7_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6E226_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6E226_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5Z8B6_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5NU92_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5X2I7_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6E226_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5Z8B6_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5HZI7_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6QIL2_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6QIL2_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6QIL2_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6KJP8_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6KJP8_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
Q6JTU4_BCL2L11-01       -------ggctgaacctgca-----------------gatatgcgcccag
O43521_BCL2L11-05       -------ggctgaacctgca-----------------gatatgcgcccag
O43521_BCL2L11-25       -------ggctgaacctgca-----------------gatatgcgcccag
O43521_BCL2L11-18       -------ggctgaacctgca-----------------gatatgcgcccag
O43521_BCL2L11-09       -------ggctgaacctgca-----------------gatatgcgcccag
O43521_BCL2L11-16       -------ggctgaacctgca-----------------gatatgcgcccag
O43521_BCL2L11-10       -------ggctgaacctgca-----------------gatatgcgcccag
O43521_BCL2L11-20       -------ggctgaacctgca-----------------gatatgcgcccag
A0A2K6KJP8_BCL2L11      ------------------------------------------------ag
A0A2K6QIL2_BCL2L11      ------------------------------------------------ag
A0A2K5HZI7_BCL2L11      ------------------------------------------------ag
O43521_BCL2L11-22       ------------------------------------------------ag
O43521_BCL2L11-08       ------------------------------------------------ag
A0A2I2YQ13_BCL2L11      ------------------------------------------------ag
A0A2I3HW02_BCL2L11      ------------------------------------------------ag
A0A2R9CA99_BCL2L11      ------------------------------------------------ag
A0A2J8JCT2_BCL2L11      ------------------------------------------------ag
A0A2K5NU92_BCL2L11      ------------------------------------------------ag
A0A2K5X2I7_BCL2L11      ------------------------------------------------ag
F7HHA9_BCL2L11-03       ------------------------------------------------ag
A0A2K6E226_BCL2L11      ------------------------------------------------ag
A0A2K5Z8B6_BCL2L11      ------------------------------------------------ag
A0A2I3M6I1_BCL2L11      ------------------------------------------------ag
O43521_BCL2L11-07       ------------------------------------------------ag
O43521_BCL2L11-19       ------------------------------------------------ag
A0A2I2YQ13_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2R9CA99_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2J8JCT2_BCL2L11      -------ggctgaacctgca-----------------gatatgcgaccgg
A0A2J8JCT2_BCL2L11      -------ggctgaacctgca-----------------gatatgcgaccgg
A0A2I2YQ13_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2R9CA99_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2I3HW02_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6QIL2_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5HZI7_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5NU92_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5X2I7_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
F7HHA9_BCL2L11-04       -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6E226_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5Z8B6_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2I3M6I1_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A0D9RWE0_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5NU92_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5X2I7_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
F7HHA9_BCL2L11-02       -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6E226_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5Z8B6_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2I3M6I1_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6KJP8_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K6QIL2_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2K5HZI7_BCL2L11      -------ggctgaacctgca-----------------gatatgcgcccgg
A0A2I3HW02_BCL2L11      -------cgctggatcctc-------------------------------
A0A2I2YQ13_BCL2L11      -------cgctggatcctc-------------------------------
O43521_BCL2L11-23       -------cgctggatcctc-------------------------------
A0A2R9CA99_BCL2L11      -------cgctggatcctc-------------------------------
A0A2J8JCT2_BCL2L11      -------cgctggatcctc-------------------------------
A0A2I3M6I1_BCL2L11      -------cactggatcctc-------------------------------
A0A2K5X2I7_BCL2L11      -------cactggatcctc-------------------------------
F7HHA9_BCL2L11-07       -------cactggatcctc-------------------------------
A0A2K5HZI7_BCL2L11      -------cactggatcctc-------------------------------
A0A2K5NU92_BCL2L11      -------cactggatcctc-------------------------------
A0A2K5Z8B6_BCL2L11      -------cactggatcctc-------------------------------
A0A2K5CAB2_BCL2L11      -------cactgaatcctc-------------------------------
A0A2K6TRZ5_BCL2L11      -------cactggatcctc-------------------------------
F1SU81_BCL2L11-01       gtctca-ggctgaacccgca-----------------gatatgcgcccgg
C1KGB8_BCL2L11-01       gtctca-ggctgaacccgca-----------------gatatgcgcccgg
F1SU81_BCL2L11-02       gtctca-ggctgaacccgca-----------------gatatgcgcccgg
F1SU81_BCL2L11-03       gtctca-ggctgaacccgca-----------------gatatgcgcccgg
G3SU55_BCL2L11-01       gtctca-ggctctacctgca-----------------gacctgcgcccgg
M3YDI3_BCL2L11-01       gtctca-ggctgtacctgca-----------------gatatgcgcccgg
A0A337SW42_BCL2L11      gcctca-ggctgtacccgca-----------------gatatgcgcccgg
G1LDR8_BCL2L11-01       gtctca-ggctgtacctgcc-----------------gatatgcgcccgg
J9NWV6_BCL2L11-01       gtctca-ggctgtacctgca-----------------gatatgcgcccgg
A0A337SW42_BCL2L11      ------------------------------------------------ag
A0A337SW42_BCL2L11      gcctca-ggctgtacccgca-----------------gatatgcgcccgg
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      gcctca-ggctgtacccgca-----------------gatatgcgcccgg
A0A337SW42_BCL2L11      gcctca-ggctgtacccgca-----------------gatatgcgcccgg
                                                                          

A0A3B3QC78_BCL2L11      agatgctggtcgcacgagagctgcgg--------------------cgca
B2KKY9_BCL2L11-01       agatggtggtcgctcgtgaactgcga--------------------cgca
B8JK68_BCL2L11-01       agatggtggtcgctcgtgaactgcga--------------------cgca
Q4KMV9_BCL2L11-01       aactgtggatagcacaggaactccgg--------------------cgga
M3XHJ5_BCL2L11-01       aaactcatg----gtaagaacccttt------------------------
A0A3B1JXK6_BCL2L11      attggtacatcgcgcaagagttgcga--------------------cgca
W5UEE7_BCL2L11-01       agttggaaattgcgcgagagttgcgg--------------------cgca
A0A3B4BVX1_BCL2L11      agtcgtacgtggcgcaagagctgcgg--------------------cgca
A0A3B4BVX1_BCL2L11      agtcgtacgtggcgcaagagctgcgg--------------------cgca
A0A3B4BVX1_BCL2L11      agtcgtacgtggcgcaagagctgcgg--------------------cgca
A0A3B4V919_BCL2L11      --------------taaaa---cctg--------------------cgct
A0A3B4XZH1_BCL2L11      aggcag---tcggacaagagctccga--------------------cgca
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      caaact---tcagtc-----ctccct--------------------cct-
A0A3B5QAM1_BCL2L11      aaacct---atggtcgtcaactccgt--------------------gcta
A0A3B5QAM1_BCL2L11      aaacct---atggtcgtcaactccgt--------------------gcta
A0A3B3VNE0_BCL2L11      aaacct---ttggtcgtcaactccgt--------------------gcta
A0A3B3YII5_BCL2L11      aaaact---ttggtcgtcaactccgt--------------------gcta
A0A3B3YII5_BCL2L11      aaaact---ttggtcgtcaactccgt--------------------gcta
R4G9R5_BCL2L11-01       aaatatggattgcacaggaattacgg--------------------cgca
F7FTC8_BCL2L11-01       aaatatggattgcccaggagttacgg--------------------cgaa
G1MV54_BCL2L11-01       aaatatggattgcacaggagctgcgg--------------------cgca
K7GA86_BCL2L11-01       aaatatggattgcacaggagctgcgg--------------------cgaa
G1PDJ5_BCL2L11-01       agatgtggatcgctcaggagctgcgg--------------------cgga
F7CXT2_BCL2L11-01       aaatttggattgcacaagaattgcgc--------------------cgta
G3W979_BCL2L11-01       aaatttggattgcacaagaattgcga--------------------cgta
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       agacctggatcgcgcaggagttgcgg--------------------cgga
O54918_BCL2L11-03       -----------------------tgg--------------------agaa
O88498_BCL2L11-01       agatacggatcgcacaggagctgcgg--------------------cgga
O88498_BCL2L11-02       agatacggatcgcacaggagctgcgg--------------------cgga
O54918_BCL2L11-05       agatacggattgcacaggagctgcgg--------------------cgga
O54918_BCL2L11-01       agatacggattgcacaggagctgcgg--------------------cgga
O54918_BCL2L11-08       agatacggattgcacaggagctgcgg--------------------cgga
O54918_BCL2L11-06       agatacggattgcacaggagctgcgg--------------------cgga
W5PY58_BCL2L11-01       agatatggattgctcaagagctacgg--------------------cgta
Q2YDF0_BCL2L11-02       agatatggattgcccaagagctacgg--------------------cgta
Q2YDF0_BCL2L11-03       agatatggattgcccaagagctacgg--------------------cgta
Q2YDF0_BCL2L11-01       agatatggattgcccaagagctacgg--------------------cgta
A0A286XJN2_BCL2L11      agatatggatcgcacaggaattgcgt--------------------cgca
A0A286XJN2_BCL2L11      agatatggatcgcacaggaattgcgt--------------------cgca
A0A286XJN2_BCL2L11      agatatggatcgcacaggaattgcgt--------------------cgca
A0A287DFJ0_BCL2L11      agatctggatcgcgcaggagctgcgg--------------------cgaa
A0A287DFJ0_BCL2L11      agatctggatcgcgcaggagctgcgg--------------------cgaa
H0XW23_BCL2L11-01       agatgtggatcgcccaagagttgcgg--------------------cgta
A0A2K6GE31_BCL2L11      agatatggatcgcgcaggagttgcgg--------------------cgta
A0A2K6GE31_BCL2L11      agaaataga-----------------------------------------
A0A2K6GE31_BCL2L11      agatatggatcgcgcaggagttgcgg--------------------cgta
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      agatatggatcgcgcaggagttgcgg--------------------cgta
A0A2K6GE31_BCL2L11      agatatggatcgcgcaggagttgcgg--------------------cgta
A0A2I3HW02_BCL2L11      ttatatttactggcttagatttgtatg---------------gccac-ca
A0A2R9CA99_BCL2L11      ttatatttactggcttagatttgtatg---------------gccac-ca
A0A2J8JCT2_BCL2L11      ttatatttactggcttagatttgtatg---------------gccac-ca
A0A2I2YQ13_BCL2L11      ttatatttactggcttagatttgtatg---------------gccac-ca
O43521_BCL2L11-06       ttatatttactggcttagatttgtatg---------------gccac-ca
O43521_BCL2L11-15       ttatatttactggcttagatttgtatg---------------gccac-ca
A0A2K5X2I7_BCL2L11      ttatatttactggcttagatttgtatg---------------gccac-ca
F7HHA9_BCL2L11-09       ttatatttactggcttagatttgtatg---------------gccac-ca
A0A2K6E226_BCL2L11      ttatatttactggcttagatttgtatg---------------gccac-ca
A0A2K5NU92_BCL2L11      ttatatttactggcttagatttgtatg---------------gccac-ca
A0A2K5Z8B6_BCL2L11      ttatatttactggcttagatttgtatg---------------gccac-ca
A0A2I3M6I1_BCL2L11      ttatatttactggcttagatttgtatg---------------gccac-ca
A0A2K5HZI7_BCL2L11      ttatatttactggcttagatttgtatg---------------gccac-ca
A0A2K6KJP8_BCL2L11      ttatatttactggcttagatttgtatgtggtttggatttatatttac-ca
A0A2K6QIL2_BCL2L11      ttatatttactggcttagatttgtatgtggtttggatttatatttac-ca
F6XMC1_BCL2L11-09       ttacatttaccttctttgatttgtgtg---------------gccac-ca
A0A2K5CAB2_BCL2L11      ttatatttaccttctttgatttgtatg---------------gccac-ca
A0A2K6TRZ5_BCL2L11      ttatatttaccttctttgatttgtatg---------------gctac-ca
A0A2K5NU92_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5X2I7_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
F7HHA9_BCL2L11-05       agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5Z8B6_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5HZI7_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6QIL2_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6KJP8_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
O43521_BCL2L11-13       agatatggatcgcccaagagttgcgg--------------------cgta
O43521_BCL2L11-17       agatatggatcgcccaagagttgcgg--------------------cgta
A0A2J8JCT2_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2I3HW02_BCL2L11      agatatggattgcccaagagttgcgg--------------------cgta
A0A2I2YQ13_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2R9CA99_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
F6XMC1_BCL2L11-02       agatatggatcgcccaagagttgcgg--------------------cgta
F6XMC1_BCL2L11-01       agatatggatcgcccaagagttgcgg--------------------cgta
F6XMC1_BCL2L11-06       ----------------agagaaatag------------------------
A0A2K5CAB2_BCL2L11      ----------------agagaaatag------------------------
A0A2K6TRZ5_BCL2L11      ----------------agagaaatag------------------------
F6XMC1_BCL2L11-08       aagtgaggggcatcggggagaagcaggaagaacgtgtgaacccacacaca
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-03       agatatggatcgcccaagagttgcgg--------------------cgta
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2K5CAB2_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2K5CAB2_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2K6TRZ5_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2K6TRZ5_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
F6XMC1_BCL2L11-05       agatatggatcgcccaagagttgcgg--------------------cgta
F6XMC1_BCL2L11-07       agatatggatcgcccaagagttgcgg--------------------cgta
A0A2K5CAB2_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2K6TRZ5_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2K5CAB2_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2K6TRZ5_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
H2P5E2_BCL2L11-01       agatatggatcgcccaagagttgcgg--------------------cgta
A0A2K6E226_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       agatatggatcgcccaagagttgcgg--------------------cgta
O43521_BCL2L11-03       agatatggatcgcccaagagttgcgg--------------------cgta
A0A2J8JCT2_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2J8JCT2_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2I3HW02_BCL2L11      agatatggattgcccaagagttgcgg--------------------cgta
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2R9CA99_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2I2YQ13_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2R9CA99_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2I3M6I1_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2I3M6I1_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2I3M6I1_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5X2I7_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6E226_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6E226_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5Z8B6_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5NU92_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5X2I7_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6E226_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5Z8B6_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5HZI7_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6QIL2_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6QIL2_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6QIL2_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6KJP8_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6KJP8_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
Q6JTU4_BCL2L11-01       agatatggatcgcccaagagttgcgg--------------------cgta
O43521_BCL2L11-05       agatatggatcgcccaagagttgcgg--------------------cgta
O43521_BCL2L11-25       agatatggatcgcccaagagttgcgg--------------------cgta
O43521_BCL2L11-18       agatatggatcgcccaagagttgcgg--------------------cgta
O43521_BCL2L11-09       agatatggatcgcccaagagttgcgg--------------------cgta
O43521_BCL2L11-16       agatatggatcgcccaagagttgcgg--------------------cgta
O43521_BCL2L11-10       agatatggatcgcccaagagttgcgg--------------------cgta
O43521_BCL2L11-20       agatatggatcgcccaagagttgcgg--------------------cgta
A0A2K6KJP8_BCL2L11      agaaatag------------------------------------------
A0A2K6QIL2_BCL2L11      agaaatag------------------------------------------
A0A2K5HZI7_BCL2L11      agaaatag------------------------------------------
O43521_BCL2L11-22       agaaatag------------------------------------------
O43521_BCL2L11-08       agaaatag------------------------------------------
A0A2I2YQ13_BCL2L11      agaaatag------------------------------------------
A0A2I3HW02_BCL2L11      agaaatag------------------------------------------
A0A2R9CA99_BCL2L11      agaaatag------------------------------------------
A0A2J8JCT2_BCL2L11      agaaatag------------------------------------------
A0A2K5NU92_BCL2L11      agaaatag------------------------------------------
A0A2K5X2I7_BCL2L11      agaaatag------------------------------------------
F7HHA9_BCL2L11-03       agaaatag------------------------------------------
A0A2K6E226_BCL2L11      agaaatag------------------------------------------
A0A2K5Z8B6_BCL2L11      agaaatag------------------------------------------
A0A2I3M6I1_BCL2L11      agaaatag------------------------------------------
O43521_BCL2L11-07       agaaatag------------------------------------------
O43521_BCL2L11-19       agaaatag------------------------------------------
A0A2I2YQ13_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2R9CA99_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2J8JCT2_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2J8JCT2_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2I2YQ13_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2R9CA99_BCL2L11      agatatggatcgcccaagagttgcgg--------------------cgta
A0A2I3HW02_BCL2L11      agatatggattgcccaagagttgcgg--------------------cgta
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6QIL2_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5HZI7_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5NU92_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5X2I7_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
F7HHA9_BCL2L11-04       agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6E226_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5Z8B6_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2I3M6I1_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A0D9RWE0_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5NU92_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5X2I7_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
F7HHA9_BCL2L11-02       agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6E226_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5Z8B6_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2I3M6I1_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6KJP8_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K6QIL2_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2K5HZI7_BCL2L11      agatacggatcgcccaagagttgcgg--------------------cgaa
A0A2I3HW02_BCL2L11      ------------cctc----------------------------------
A0A2I2YQ13_BCL2L11      ------------cctcagaattg-----------------------ccct
O43521_BCL2L11-23       ------------cctcagaattg-----------------------ccct
A0A2R9CA99_BCL2L11      ------------cctcagaattg-----------------------ccct
A0A2J8JCT2_BCL2L11      ------------cctcagaattg-----------------------ccct
A0A2I3M6I1_BCL2L11      ------------cctcggaattg-----------------------ccct
A0A2K5X2I7_BCL2L11      ------------cctcggaattg-----------------------ccct
F7HHA9_BCL2L11-07       ------------cctcggaattg-----------------------ccct
A0A2K5HZI7_BCL2L11      ------------cctcagaattg-----------------------ccct
A0A2K5NU92_BCL2L11      ------------cctcagaattg-----------------------ccct
A0A2K5Z8B6_BCL2L11      ------------cctcggaattg-----------------------ccct
A0A2K5CAB2_BCL2L11      ------------ccttggaattg-----------------------ccct
A0A2K6TRZ5_BCL2L11      ------------cc------ttg-----------------------ccct
F1SU81_BCL2L11-01       agatatggattgcgcaggagttacgg--------------------cgta
C1KGB8_BCL2L11-01       agatatggattgcgcaggagttacgg--------------------cgta
F1SU81_BCL2L11-02       agatatggattgcgcaggagttacgg--------------------cgta
F1SU81_BCL2L11-03       agatatggattgcgcaggagttacgg--------------------cgta
G3SU55_BCL2L11-01       agatctggattgcgcgagagctacgg--------------------cgca
M3YDI3_BCL2L11-01       agatgtggattgcgcaggagttgcgg--------------------cgta
A0A337SW42_BCL2L11      agatatggattgcacaagagttgcgg--------------------cgta
G1LDR8_BCL2L11-01       agatatggattgcgcaagagttgcgg--------------------cgta
J9NWV6_BCL2L11-01       agatatggattgcacaagagttgcgg--------------------cgta
A0A337SW42_BCL2L11      agcaatag------------------------------------------
A0A337SW42_BCL2L11      agatatggattgcacaagagttgcgg--------------------cgta
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      agatatggattgcacaagagttgcgg--------------------cgta
A0A337SW42_BCL2L11      agatatggattgcacaagagttgcgg--------------------cgta
                                                                          

A0A3B3QC78_BCL2L11      tcggtgac---------aagttcaatgatatctac---------------
B2KKY9_BCL2L11-01       taggcgat---------gagttcaatcgcctcta---ctgtgaggc----
B8JK68_BCL2L11-01       taggcgat---------gagttcaatcgcctcta---ctgtgaggc----
Q4KMV9_BCL2L11-01       ttggggat---------gactttaatgcatcattcagt------------
M3XHJ5_BCL2L11-01       -----------------gaactttaca-----------------------
A0A3B1JXK6_BCL2L11      ttggggat---------gaattcaacgatctgtacttccgaggggc-agg
W5UEE7_BCL2L11-01       tcggcgat---------gaatttaaccagctttattttcatgaggc-aga
A0A3B4BVX1_BCL2L11      tcggcgat---------gagtttaacgagctttattttcacggggtgagt
A0A3B4BVX1_BCL2L11      tcggcgat---------gagtttaacgagctttattttcacggggtgagt
A0A3B4BVX1_BCL2L11      tcggcgat---------gagtttaacgagctttattttcacggggc-agg
A0A3B4V919_BCL2L11      tctaaaac---------acactaagatgacttct----------------
A0A3B4XZH1_BCL2L11      tcggagac---------gactttaatagacttct----------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      -------------------------cccccttctga--------------
A0A3B5QAM1_BCL2L11      ttggagat---------gagtacaacaacctcctgatggga---------
A0A3B5QAM1_BCL2L11      ttggagat---------gagtacaacaacctcctgatggga---------
A0A3B3VNE0_BCL2L11      ttggagat---------gactacaacaaccacctgatggta---------
A0A3B3YII5_BCL2L11      ttggagat---------gactacaacaaccacctgat-------------
A0A3B3YII5_BCL2L11      ttggagat---------gactacaacaaccacctgat-------------
R4G9R5_BCL2L11-01       tcggagat---------gaattcaatgcttccca---ctgt---------
F7FTC8_BCL2L11-01       ttggagat---------gagtttaacgcttccta---ttgt---------
G1MV54_BCL2L11-01       tcggggat---------gaattcaatgcctccta---ttgt---------
K7GA86_BCL2L11-01       ttggagat---------gagtttaatgcctctta---ctgc---------
G1PDJ5_BCL2L11-01       tcggggac---------gagttcaacaactcctaccgcaac---------
F7CXT2_BCL2L11-01       ttggagat---------gaatttaatg---cttcctattat---------
G3W979_BCL2L11-01       ttggagat---------gaatttaatg---cttc---ttat---------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       tcggagac---------gagttcaacg---cgta---ttac---------
O54918_BCL2L11-03       tcttaacc---------aagtggcaca---aaat---atcc---------
O88498_BCL2L11-01       tcggagac---------gagttcaatg---agac---ttac---------
O88498_BCL2L11-02       tcggagac---------gagttcaatg---agac---ttac---------
O54918_BCL2L11-05       tcggagac---------gagttcaacg---aaac---ttac---------
O54918_BCL2L11-01       tcggagac---------gagttcaacg---aaac---ttac---------
O54918_BCL2L11-08       tcggagac---------gagttcaacg---aaac---ttac---------
O54918_BCL2L11-06       tcggagac---------gagttcaacg---aaac---ttac---------
W5PY58_BCL2L11-01       tcggagac---------gagtttaatg---cgta---ttat---------
Q2YDF0_BCL2L11-02       tcggagac---------gagtttaatg---cata---ttac---------
Q2YDF0_BCL2L11-03       tcggagac---------gagtttaatg---cata---ttac---------
Q2YDF0_BCL2L11-01       tcggagac---------gagtttaatg---cata---ttac---------
A0A286XJN2_BCL2L11      tcggagat---------gagtttaatg---cctc---gtac---------
A0A286XJN2_BCL2L11      tcggagat---------gagtttaatg---cctc---gtac---------
A0A286XJN2_BCL2L11      tcggagat---------gagtttaatg---cctc---gtac---------
A0A287DFJ0_BCL2L11      tcggagat---------gagtttaacc---tgta---ttac---------
A0A287DFJ0_BCL2L11      tcggagat---------gagtttaacc---tgta---ttac---------
H0XW23_BCL2L11-01       ttggagac---------gagtttaacg---ctta---ctac---------
A0A2K6GE31_BCL2L11      ttggagat---------gagtttaacg---ctta---ttac---------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ttggagat---------gagtttaacg---ctta---ttac---------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      ttggagat---------gagtttaacg---ctta---ttac---------
A0A2K6GE31_BCL2L11      ttggagat---------gagtttaacg---ctta---ttac---------
A0A2I3HW02_BCL2L11      ccatagtc---------aagatacaga---acaa---ttca---------
A0A2R9CA99_BCL2L11      ccatagtc---------aagatgcaga---acaa---ctca---------
A0A2J8JCT2_BCL2L11      ccatagtc---------aagatgcaga---acaa---ctca---------
A0A2I2YQ13_BCL2L11      ccatagtc---------aagatacaga---acaa---ctca---------
O43521_BCL2L11-06       ccatagtc---------aagatacaga---acaa---ctca---------
O43521_BCL2L11-15       ccatagtc---------aagatacaga---acaa---ctca---------
A0A2K5X2I7_BCL2L11      ccacagtc---------aagatacaga---acaa---ctca---------
F7HHA9_BCL2L11-09       ccacagtc---------aagatacaga---acaa---ctca---------
A0A2K6E226_BCL2L11      ccacagtc---------aagatacaga---acaa---ctca---------
A0A2K5NU92_BCL2L11      ccacagtc---------aagatacaga---acaa---ctca---------
A0A2K5Z8B6_BCL2L11      ccacagtc---------aagatacaga---acaa---ctca---------
A0A2I3M6I1_BCL2L11      ccacagtc---------aagatacaga---acaa---ctca---------
A0A2K5HZI7_BCL2L11      ccacagtc---------aagatacaga---acaa---ctca---------
A0A2K6KJP8_BCL2L11      ccacagtc---------aagatacaga---acaa---ctca---------
A0A2K6QIL2_BCL2L11      ccacagtc---------aagatacaga---acaa---ctca---------
F6XMC1_BCL2L11-09       ccacagtc---------aaggtacaga---acaa------c---------
A0A2K5CAB2_BCL2L11      ccacagtc---------aaggtacaga---acaa---ctcc---------
A0A2K6TRZ5_BCL2L11      ccacagtc---------aaggtacaga---acaa---ctcc---------
A0A2K5NU92_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5X2I7_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
F7HHA9_BCL2L11-05       tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5Z8B6_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5HZI7_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6QIL2_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6KJP8_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
O43521_BCL2L11-13       ttggagac---------gagtttaacg---ctta---ctat---------
O43521_BCL2L11-17       ttggagac---------gagtttaacg---ctta---ctat---------
A0A2J8JCT2_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2I3HW02_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2I2YQ13_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2R9CA99_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
F6XMC1_BCL2L11-02       tcggagac---------gagtttaacg---ctta---ttat---------
F6XMC1_BCL2L11-01       tcggagac---------gagtttaacg---ctta---ttat---------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       tgggagaccttcaaaagcaccagaact---caca---gtct---------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-03       tcggagac---------gagtttaacg---ctta---ttat---------
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      tcggagac---------gagtttaacg---ctta---ttat---------
A0A2K5CAB2_BCL2L11      tcggagac---------gagtttaacg---ctta---ttat---------
A0A2K5CAB2_BCL2L11      tcggagac---------gagtttaacg---ctta---ttat---------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      tcggagac---------gagtttaacg---ctta---ttat---------
A0A2K6TRZ5_BCL2L11      tcggagac---------gagtttaacg---ctta---ttat---------
A0A2K6TRZ5_BCL2L11      tcggagac---------gagtttaacg---ctta---ttat---------
F6XMC1_BCL2L11-05       tcggagac---------gagtttaacg---ctta---ttat---------
F6XMC1_BCL2L11-07       tcggagac---------gagtttaacg---ctta---ttat---------
A0A2K5CAB2_BCL2L11      tcggagac---------gagtttaacg---ctta---ttat---------
A0A2K6TRZ5_BCL2L11      tcggagac---------gagtttaacg---ctta---ttat---------
A0A2K5CAB2_BCL2L11      tcggagac---------gagtttaacg---ctta---ttat---------
A0A2K6TRZ5_BCL2L11      tcggagac---------gagtttaacg---ctta---ttat---------
H2P5E2_BCL2L11-01       tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6E226_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       ttggagac---------gagtttaacg---ctta---ctat---------
O43521_BCL2L11-03       ttggagac---------gagtttaacg---ctta---ctat---------
A0A2J8JCT2_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2J8JCT2_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2I3HW02_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2R9CA99_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2I2YQ13_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2R9CA99_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2I3M6I1_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2I3M6I1_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2I3M6I1_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5X2I7_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6E226_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6E226_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5Z8B6_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5NU92_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5X2I7_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6E226_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5Z8B6_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5HZI7_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6QIL2_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6QIL2_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6QIL2_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6KJP8_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6KJP8_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
Q6JTU4_BCL2L11-01       tcggagac---------gagtttaacg---ctta---ctat---------
O43521_BCL2L11-05       ttggagac---------gagtttaacg---ctta---ctat---------
O43521_BCL2L11-25       ttggagac---------gagtttaacg---ctta---ctat---------
O43521_BCL2L11-18       ttggagac---------gagtttaacg---ctta---ctat---------
O43521_BCL2L11-09       ttggagac---------gagtttaacg---ctta---ctat---------
O43521_BCL2L11-16       ttggagac---------gagtttaacg---ctta---ctat---------
O43521_BCL2L11-10       ttggagac---------gagtttaacg---ctta---ctat---------
O43521_BCL2L11-20       ttggagac---------gagtttaacg---ctta---ctat---------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2R9CA99_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2J8JCT2_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2J8JCT2_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2I2YQ13_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2R9CA99_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2I3HW02_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6QIL2_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5HZI7_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5NU92_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5X2I7_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
F7HHA9_BCL2L11-04       tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6E226_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5Z8B6_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2I3M6I1_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A0D9RWE0_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5NU92_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5X2I7_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
F7HHA9_BCL2L11-02       tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6E226_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5Z8B6_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2I3M6I1_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6KJP8_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K6QIL2_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2K5HZI7_BCL2L11      tcggagac---------gagtttaacg---ctta---ctat---------
A0A2I3HW02_BCL2L11      -------g---------aagttcagtg---gcca---ttc----------
A0A2I2YQ13_BCL2L11      tcataggg---------aagttcagtg---gcca---ctc----------
O43521_BCL2L11-23       tcataggg---------aagttcagtg---gcca---ctc----------
A0A2R9CA99_BCL2L11      tcataggg---------aagttcagtg---gcca---ctc----------
A0A2J8JCT2_BCL2L11      tcataggg---------aagttcagtg---gcca---ctc----------
A0A2I3M6I1_BCL2L11      tcataggg---------aagttcagtg---gcca---ctg----------
A0A2K5X2I7_BCL2L11      tcataggg---------aagttcagtg---gccg---ctc----------
F7HHA9_BCL2L11-07       tcataggg---------aagttcagtg---gccg---ctc----------
A0A2K5HZI7_BCL2L11      tcataggg---------aagttcagta---g-------------------
A0A2K5NU92_BCL2L11      tcataggg---------aagttcagtg---gccg---ctc----------
A0A2K5Z8B6_BCL2L11      tcataggg---------aagttcagtg---gccg---ctc----------
A0A2K5CAB2_BCL2L11      tcgtaggg---------aggttcagtg---gcca---ctt----------
A0A2K6TRZ5_BCL2L11      tcgtaggg---------aggttcagtg---ccca---ctt----------
F1SU81_BCL2L11-01       ttggagac---------gaatttaatg---cata---ttac---------
C1KGB8_BCL2L11-01       ttggagac---------gaatttaatg---cata---ttac---------
F1SU81_BCL2L11-02       ttggagac---------gaatttaatg---cata---ttac---------
F1SU81_BCL2L11-03       ttggagac---------gaatttaatg---cata---ttac---------
G3SU55_BCL2L11-01       ttggagac---------gaattcaatg---ccta---ctac---------
M3YDI3_BCL2L11-01       ttggagac---------gagtttaatg---cgta---ttac---------
A0A337SW42_BCL2L11      tcggagac---------gaatttaatg---cata---ttac---------
G1LDR8_BCL2L11-01       ttggagac---------gaatttaatg---cata---ttac---------
J9NWV6_BCL2L11-01       ttggagac---------gaatttaatg---cata---ttac---------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      tcggagac---------gaatttaatg---cata---ttac---------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      tcggagac---------gaatttaatg---cata---ttac---------
A0A337SW42_BCL2L11      tcggagac---------gaatttaatg---cata---ttac---------
                                                                          

A0A3B3QC78_BCL2L11      -----ataaatggggtgagtatcctactctgtcctcactgtcctcttcgg
B2KKY9_BCL2L11-01       -----cggagcaggagt---------------------------------
B8JK68_BCL2L11-01       -----cggagcaggagt---------------------------------
Q4KMV9_BCL2L11-01       -----ccaagaaggggc--------------attttcaa-----------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      cag--aaatggaggtgg---------------------------------
W5UEE7_BCL2L11-01       aag--aaatggtggcgc---------------------------------
A0A3B4BVX1_BCL2L11      cagctgcatgggtgcgt---------------------------------
A0A3B4BVX1_BCL2L11      cagctgcatgggtgcgt---------------------------------
A0A3B4BVX1_BCL2L11      cag--aaatggaggcag---------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      -----aggaggatggcg---------------------------------
A0A3B5QAM1_BCL2L11      -----aggaggatggcg---------------------------------
A0A3B3VNE0_BCL2L11      -----aggaggatggcg---------------------------------
A0A3B3YII5_BCL2L11      -------gaggatggcg---------------------------------
A0A3B3YII5_BCL2L11      -------gaggatggcg---------------------------------
R4G9R5_BCL2L11-01       -----ccaagaaggggt--------------ttctt--------------
F7FTC8_BCL2L11-01       -----ccaagaaggggt--------------ctctt-------gga----
G1MV54_BCL2L11-01       -----ccaagaaggggt--------------ttctt-------gga----
K7GA86_BCL2L11-01       -----ccaagaaggggt--------------ttctt-------gga----
G1PDJ5_BCL2L11-01       -----ccacggagggac--------------tttct-------gaa----
F7CXT2_BCL2L11-01       -----ccaagaaggggg--------------ttttt-------ggataa-
G3W979_BCL2L11-01       -----ccaagaaggggt--------------ttttt-------ggataa-
O43521_BCL2L11-11       ------caagtag-------------------------------------
F7HHA9_BCL2L11-08       ------caagtag-------------------------------------
G1SSY0_BCL2L11-01       -----ccacgcagggtt--------------ttttt-------gaa----
O54918_BCL2L11-03       -----acggtga--------------------------------------
O88498_BCL2L11-01       -----acgaggagggcg--------------tttgc-------aaa----
O88498_BCL2L11-02       -----acgaggagggcg--------------tttgc-------aaa----
O54918_BCL2L11-05       -----acaaggagggtg--------------tttgc-------aaa----
O54918_BCL2L11-01       -----acaaggagggtg--------------tttgc-------aaa----
O54918_BCL2L11-08       -----acaaggagggtg--------------tttgc-------aaa----
O54918_BCL2L11-06       -----acaaggagggtg--------------tttgc-------aaa----
W5PY58_BCL2L11-01       -----ccaagaagggtc--------------ttcgt--------------
Q2YDF0_BCL2L11-02       -----ccaagaagggtc--------------ttcgt--------------
Q2YDF0_BCL2L11-03       -----ccaagaagggtc--------------ttcgt--------------
Q2YDF0_BCL2L11-01       -----ccaagaagggtc--------------ttcgt--------------
A0A286XJN2_BCL2L11      -----ccaaggcgggtg--------------ttctt-------gaa----
A0A286XJN2_BCL2L11      -----ccaaggcgggtg--------------ttctt-------gaa----
A0A286XJN2_BCL2L11      -----ccaaggcgggtg--------------ttctt-------gaa----
A0A287DFJ0_BCL2L11      -----ccacggagggta--------------ttttt--------------
A0A287DFJ0_BCL2L11      -----ccacggagggta--------------ttttt--------------
H0XW23_BCL2L11-01       -----ccaacgagggta--------------ttttt-------gca----
A0A2K6GE31_BCL2L11      -----ccaaggaggctg--------------------------gca----
A0A2K6GE31_BCL2L11      ------------ggaag--------------ttgtc-------gtg----
A0A2K6GE31_BCL2L11      -----ccaaggaggatg--------------cctct--------------
A0A2K6GE31_BCL2L11      ------------gggta--------------ttttt-------gaa----
A0A2K6GE31_BCL2L11      -----ccaaggagggta--------------ttttt-------gaa----
A0A2K6GE31_BCL2L11      -----ccaaggagggta--------------ttttt-------gaa----
A0A2I3HW02_BCL2L11      -----accacaaggatt--------------tctca--------------
A0A2R9CA99_BCL2L11      -----accacaaggatt--------------tctca--------------
A0A2J8JCT2_BCL2L11      -----accacaaggatt--------------tctca--------------
A0A2I2YQ13_BCL2L11      -----accacaaggatt--------------tctca--------------
O43521_BCL2L11-06       -----accacaaggatt--------------tctca--------------
O43521_BCL2L11-15       -----accacaaggatt--------------tctca--------------
A0A2K5X2I7_BCL2L11      -----accacaaggatt--------------tctca--------------
F7HHA9_BCL2L11-09       -----accacaaggatt--------------tctca--------------
A0A2K6E226_BCL2L11      -----accacaaggatt--------------tctca--------------
A0A2K5NU92_BCL2L11      -----accacaaggatt--------------tctca--------------
A0A2K5Z8B6_BCL2L11      -----accacaaggatt--------------tctca--------------
A0A2I3M6I1_BCL2L11      -----accacaaggatt--------------tctca--------------
A0A2K5HZI7_BCL2L11      -----accacagggatt--------------tctca--------------
A0A2K6KJP8_BCL2L11      -----accacagggatt--------------tctca--------------
A0A2K6QIL2_BCL2L11      -----accacagggatt--------------tctca--------------
F6XMC1_BCL2L11-09       -----agcacaaggatt--------------tctca--------------
A0A2K5CAB2_BCL2L11      -----accacaagtatt--------------tctca--------------
A0A2K6TRZ5_BCL2L11      -----accacaagtatg--------------tctca--------------
A0A2K5NU92_BCL2L11      -----gcaaggaggttg--------------------------gca----
A0A2K5X2I7_BCL2L11      -----gcaaggaggttg--------------------------gca----
F7HHA9_BCL2L11-05       -----gcaaggaggttg--------------------------gca----
A0A2K5Z8B6_BCL2L11      -----gcaaggaggttg--------------------------gca----
A0A2K5HZI7_BCL2L11      -----gcaaggaggttg--------------------------gca----
A0A2K6QIL2_BCL2L11      -----gcaaggaggttg--------------------------gca----
A0A2K6KJP8_BCL2L11      -----gcaaggaggttg--------------------------gca----
O43521_BCL2L11-13       -----gcaaggaggctg--------------------------gca----
O43521_BCL2L11-17       -----gcaaggaggctg--------------------------gca----
A0A2J8JCT2_BCL2L11      -----gcaaggaggctg--------------------------gca----
A0A2I3HW02_BCL2L11      -----gcaaggaggctg--------------------------gca----
A0A2I2YQ13_BCL2L11      -----gcaaggaggctg--------------------------gca----
A0A2R9CA99_BCL2L11      -----gcaaggaggctg--------------------------gca----
F6XMC1_BCL2L11-02       -----ccaaggagggtaaactggatactgcccttttgccatcggaaggaa
F6XMC1_BCL2L11-01       -----ccaaggagggtaaactggatactgcccttttgccatcggaaggaa
F6XMC1_BCL2L11-06       --------aggaagttg--------------tc----------gtg----
A0A2K5CAB2_BCL2L11      --------aggaagttg--------------tc----------gtg----
A0A2K6TRZ5_BCL2L11      --------aggaagttg--------------tc----------gtg----
F6XMC1_BCL2L11-08       -----ttcagcacgtaa--------------ttctatacatcc--t----
A0A2K5CAB2_BCL2L11      -------------------------------------------gac----
A0A2K6TRZ5_BCL2L11      -------------------------------------------gac----
F6XMC1_BCL2L11-03       -----ccaaggagggta--------------ttttt-------gaa----
F6XMC1_BCL2L11-04       ------------gggta--------------ttttt-------gaa----
A0A2K5CAB2_BCL2L11      ------------gggta--------------ttttt-------gaa----
A0A2K5CAB2_BCL2L11      -----ccaaggagggta--------------ttttt-------gaa----
A0A2K5CAB2_BCL2L11      -----ccaaggagggta--------------ttttt-------gaa----
A0A2K5CAB2_BCL2L11      -----ccaaggagggta--------------ttttt-------gaa----
A0A2K6TRZ5_BCL2L11      ------------gggta--------------ttttt-------gaa----
A0A2K6TRZ5_BCL2L11      -----ccaaggagggta--------------ttttt-------gaa----
A0A2K6TRZ5_BCL2L11      -----ccaaggagggta--------------ttttt-------gaa----
A0A2K6TRZ5_BCL2L11      -----ccaaggagggta--------------ttttt-------gaa----
F6XMC1_BCL2L11-05       -----ccaaggaggata--------------tctcttctacctgat----
F6XMC1_BCL2L11-07       -----ccaaggagg-----------------------ttagagaaa----
A0A2K5CAB2_BCL2L11      -----ccaaggaggata--------------tctcttccatctgat----
A0A2K6TRZ5_BCL2L11      -----ccaaggaggata--------------tctcttccacctgat----
A0A2K5CAB2_BCL2L11      -----ccaaggaggtta--------------------------gag----
A0A2K6TRZ5_BCL2L11      -----ccaaggaggtta--------------------------gag----
H2P5E2_BCL2L11-01       -----gcaaggagggta--------------ttttt-------gaa----
A0A2K6E226_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
O43521_BCL2L11-21       ------------gggta--------------ttttt-------gaa----
O43521_BCL2L11-02       -----gcaaggagggta--------------ttttt-------gaa----
O43521_BCL2L11-03       -----gcaaggagggta--------------ttttt-------gaa----
A0A2J8JCT2_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2J8JCT2_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2I3HW02_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2I2YQ13_BCL2L11      ------------gggta--------------ttttt-------gaa----
A0A2I3HW02_BCL2L11      ------------gggta--------------ttttt-------gaa----
A0A2R9CA99_BCL2L11      ------------gggta--------------ttttt-------gaa----
A0A2J8JCT2_BCL2L11      ------------gggta--------------ttttt-------gaa----
A0A2I2YQ13_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2R9CA99_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2I2YQ13_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2R9CA99_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2I3M6I1_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2I3M6I1_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2I3M6I1_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K5NU92_BCL2L11      ------------gggta--------------ttttt-------gaa----
A0A2K5X2I7_BCL2L11      ------------gggta--------------ttttt-------gaa----
F7HHA9_BCL2L11-01       ------------gggta--------------ttttt-------gaa----
A0A2K6E226_BCL2L11      ------------gggta--------------ttttt-------gaa----
A0A2K5Z8B6_BCL2L11      ------------gggta--------------ttttt-------gaa----
A0A2I3M6I1_BCL2L11      ------------gggta--------------ttttt-------gaa----
A0A2K5NU92_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K5X2I7_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K6E226_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K6E226_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K5Z8B6_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K5NU92_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K5X2I7_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K6E226_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K5Z8B6_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K5HZI7_BCL2L11      ------------gggtg--------------ttttt-------gaa----
A0A2K5HZI7_BCL2L11      -----gcaaggagggtg--------------ttttt-------gaa----
A0A2K5HZI7_BCL2L11      -----gcaaggagggtg--------------ttttt-------gaa----
A0A2K6QIL2_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K6QIL2_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K6QIL2_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K6KJP8_BCL2L11      ------------gggta--------------ttttt-------gaa----
A0A2K6QIL2_BCL2L11      ------------gggta--------------ttttt-------gaa----
A0A2K6KJP8_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K6KJP8_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
A0A2K6KJP8_BCL2L11      -----gcaaggagggta--------------ttttt-------gaa----
Q6JTU4_BCL2L11-01       -----gcaaggaggtt-----------------------agagaaa----
O43521_BCL2L11-05       -----gcaaggaggtt-----------------------agagaaa----
O43521_BCL2L11-25       -----gcaaggaggtt-----------------------agagaaa----
O43521_BCL2L11-18       -----gcaaggaggtt-----------------------agagaaa----
O43521_BCL2L11-09       -----gcaaggaggatg--------------cctcttccacctgat----
O43521_BCL2L11-16       -----gcaaggaggatg--------------cctcttccacctgat----
O43521_BCL2L11-10       -----gcaaggaggatg--------------cctcttccacctgat----
O43521_BCL2L11-20       -----gcaaggaggatg--------------cctcttccacctgat----
A0A2K6KJP8_BCL2L11      --------aggaagttg--------------tc----------gtg----
A0A2K6QIL2_BCL2L11      --------aggaagttg--------------tc----------gtg----
A0A2K5HZI7_BCL2L11      --------aggaagttg--------------tc----------gtg----
O43521_BCL2L11-22       --------aggaagttg--------------tc----------gtg----
O43521_BCL2L11-08       --------aggaagttg--------------tc----------gtg----
A0A2I2YQ13_BCL2L11      --------aggaagttg--------------tc----------gtg----
A0A2I3HW02_BCL2L11      --------aggaagttg--------------tc----------gtg----
A0A2R9CA99_BCL2L11      --------aggaagttg--------------tc----------gtg----
A0A2J8JCT2_BCL2L11      --------aggaagttg--------------tc----------gtg----
A0A2K5NU92_BCL2L11      --------aggaagttg--------------tc----------gtg----
A0A2K5X2I7_BCL2L11      --------aggaagttg--------------tc----------gtg----
F7HHA9_BCL2L11-03       --------aggaagttg--------------tc----------gtg----
A0A2K6E226_BCL2L11      --------aggaagttg--------------tc----------gtg----
A0A2K5Z8B6_BCL2L11      --------aggaagttg--------------tc----------gtg----
A0A2I3M6I1_BCL2L11      --------aggaagttg--------------tc----------gtg----
O43521_BCL2L11-07       --------aggaagttg--------------tc----------gtg----
O43521_BCL2L11-19       --------aggaagttg--------------tc----------gtg----
A0A2I2YQ13_BCL2L11      -----gcaaggaggatg--------------cctcttccacctgat----
A0A2R9CA99_BCL2L11      -----gcaaggaggatg--------------cctcttccacctgat----
A0A2J8JCT2_BCL2L11      -----gcaaggaggatg--------------cctcttccacctgat----
A0A2J8JCT2_BCL2L11      -----gcaaggaggtt-----------------------agagaaa----
A0A2I2YQ13_BCL2L11      -----gcaaggaggtt-----------------------agagaaa----
A0A2R9CA99_BCL2L11      -----gcaaggaggtt-----------------------agagaaa----
A0A2I3HW02_BCL2L11      -----gcaaggaggtt-----------------------agagaaa----
A0A2K6KJP8_BCL2L11      -------------------------------------------gac----
A0A2K6QIL2_BCL2L11      -------------------------------------------gac----
O43521_BCL2L11-24       -------------------------------------------gac----
O43521_BCL2L11-12       -------------------------------------------gac----
A0A2I2YQ13_BCL2L11      -------------------------------------------gac----
A0A2I3HW02_BCL2L11      -------------------------------------------gac----
A0A2R9CA99_BCL2L11      -------------------------------------------gac----
A0A2J8JCT2_BCL2L11      -------------------------------------------gac----
A0A2K5NU92_BCL2L11      -------------------------------------------gac----
A0A2K5X2I7_BCL2L11      -------------------------------------------gac----
F7HHA9_BCL2L11-06       -------------------------------------------gac----
A0A2K6E226_BCL2L11      -------------------------------------------gac----
A0A2K5Z8B6_BCL2L11      -------------------------------------------gac----
A0A2I3M6I1_BCL2L11      -------------------------------------------gac----
A0A2K5HZI7_BCL2L11      -------------------------------------------gac----
A0A2K6KJP8_BCL2L11      -----gcaaggaggtt-----------------------agagaaa----
A0A2K6QIL2_BCL2L11      -----gcaaggaggtt-----------------------agagaaa----
A0A2K5HZI7_BCL2L11      -----gcaaggaggtt-----------------------agagaaa----
A0A2K5NU92_BCL2L11      -----gcaaggaggtt-----------------------agagaaa----
A0A2K5X2I7_BCL2L11      -----gcaaggaggtt-----------------------agagaaa----
F7HHA9_BCL2L11-04       -----gcaaggaggtt-----------------------agagaaa----
A0A2K6E226_BCL2L11      -----gcaaggaggtt-----------------------agagaaa----
A0A2K5Z8B6_BCL2L11      -----gcaaggaggtt-----------------------agagaaa----
A0A2I3M6I1_BCL2L11      -----gcaaggaggtt-----------------------agagaaa----
A0A0D9RWE0_BCL2L11      -----gcaaggaggtt-----------------------agagaaa----
A0A2K5NU92_BCL2L11      -----gcaaggaggatg--------------tcgcttccacctgat----
A0A2K5X2I7_BCL2L11      -----gcaaggaggatg--------------tcgcttccacctgat----
F7HHA9_BCL2L11-02       -----gcaaggaggatg--------------tcgcttccacctgat----
A0A2K6E226_BCL2L11      -----gcaaggaggatg--------------tcgcttccacctgat----
A0A2K5Z8B6_BCL2L11      -----gcaaggaggatg--------------tcgcttccacctgat----
A0A2I3M6I1_BCL2L11      -----gcaaggaggatg--------------tcgcttccacctgat----
A0A2K6KJP8_BCL2L11      -----gcaaggaggatg--------------tctcttccacctgat----
A0A2K6QIL2_BCL2L11      -----gcaaggaggatg--------------tctcttccacctgat----
A0A2K5HZI7_BCL2L11      -----gcaaggaggatg--------------tctcttccacctgat----
A0A2I3HW02_BCL2L11      --------gagtggtta--------------------------gca----
A0A2I2YQ13_BCL2L11      --------gagtggtta--------------------------gca----
O43521_BCL2L11-23       --------aagtggtta--------------------------gca----
A0A2R9CA99_BCL2L11      --------aagtggtta--------------------------gca----
A0A2J8JCT2_BCL2L11      --------aagtggtta--------------------------gca----
A0A2I3M6I1_BCL2L11      --------gaatggtta--------------------------gc-----
A0A2K5X2I7_BCL2L11      --------gagtggtta--------------------------gc-----
F7HHA9_BCL2L11-07       --------gagtggtta--------------------------gc-----
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------gaatgctta--------------------------gc-----
A0A2K5Z8B6_BCL2L11      --------gaatgctta--------------------------gc-----
A0A2K5CAB2_BCL2L11      --------gagtggtta--------------------------gca----
A0A2K6TRZ5_BCL2L11      --------gagtggtta--------------------------gca----
F1SU81_BCL2L11-01       -----ccaaggagggtc--------------tttct-------gaa----
C1KGB8_BCL2L11-01       -----ccaaggagggta--------------atgct-------gtt----
F1SU81_BCL2L11-02       -----ccaaggagggta--------------atgct-------gtt----
F1SU81_BCL2L11-03       -----ccaaggagggta--------------atgct-------gtt----
G3SU55_BCL2L11-01       -----ccaaggagggct--------------ttttt-------gaa----
M3YDI3_BCL2L11-01       -----ccaaggagggtc--------------ttttt-------gaa----
A0A337SW42_BCL2L11      -----ccaaggagg-------------------ctg-------gca----
G1LDR8_BCL2L11-01       -----ccaaggagggtc--------------tttct-------gaa----
J9NWV6_BCL2L11-01       -----ccaaggagggtc--------------ttttt-------gaa----
A0A337SW42_BCL2L11      --------aggaaggtg--------------tcctg-------tag----
A0A337SW42_BCL2L11      -----ccaaggagg-------------------tta-------gag----
A0A337SW42_BCL2L11      ------------gggtc--------------ttttt-------gaa----
A0A337SW42_BCL2L11      -----ccaaggagggtc--------------ttttt-------gaa----
A0A337SW42_BCL2L11      -----ccaaggagggtc--------------ttttt-------gaa----
                                                                          

A0A3B3QC78_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
W5UEE7_BCL2L11-01       --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
Q2YDF0_BCL2L11-02       --------------------------------------------------
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       gtgtgtcttgaagcattcccggttttaccatcgaaagccagccagagtgc
F6XMC1_BCL2L11-01       gtgtgtcttgaagcattcccggttttaccatcgaaagccagccagagtgc
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
                                                                          

A0A3B3QC78_BCL2L11      --------------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
W5UEE7_BCL2L11-01       --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B5QAM1_BCL2L11      --------------------------------------------------
A0A3B3VNE0_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
A0A3B3YII5_BCL2L11      --------------------------------------------------
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
Q2YDF0_BCL2L11-02       --------------------------------------------------
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       ttactggaccacaatcagagatcgttcaatcaatacttgctgtgccaaag
F6XMC1_BCL2L11-01       ttactggaccacaatcagagatcgttcaatcaatacttgctgtgccaaag
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-03       --------------------------------------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
                                                                          

A0A3B3QC78_BCL2L11      -------------------ccaactgctatgggccaaggggcaacactga
B2KKY9_BCL2L11-01       -------------------gaaccagctgcgtgctcccaacgaacacgcc
B8JK68_BCL2L11-01       -------------------gaaccagctgcatgctcccaacgaacacgcc
Q4KMV9_BCL2L11-01       -------------------caaccttccacgacccttggacaacgaccaa
M3XHJ5_BCL2L11-01       -------------------taa----------------------------
A0A3B1JXK6_BCL2L11      -------------------tgcccaacttcctgcacaaaatgaacccgcc
W5UEE7_BCL2L11-01       -------------------agcccgtccgcaggcccaaaacgagcccgcc
A0A3B4BVX1_BCL2L11      -------------------tgctggtatgcaagcgttgagtg--------
A0A3B4BVX1_BCL2L11      -------------------tgctggtatgcaagcgttgagtaatcctgtt
A0A3B4BVX1_BCL2L11      -------------------agtccagctgccggcggaggaggaacctgcc
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      --------------------------------------------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      ------------------------------------aacatcaac--aac
A0A3B5QAM1_BCL2L11      --------------------------------agaggacaccaacggaat
A0A3B5QAM1_BCL2L11      --------------------------------agaggacaccaacggaat
A0A3B3VNE0_BCL2L11      --------------------------------agaagacaccaacggaat
A0A3B3YII5_BCL2L11      --------------------------------agaagacaccaacggaat
A0A3B3YII5_BCL2L11      --------------------------------agaagacaccaacggaat
R4G9R5_BCL2L11-01       -------------------ggattaccaagcagtaa------accatcag
F7FTC8_BCL2L11-01       -------------------taataataatccggcaggaaacaaccaccaa
G1MV54_BCL2L11-01       -------------------taaccat------gctgga---aacccccag
K7GA86_BCL2L11-01       -------------------taatcaa------gcaata---aaccaccaa
G1PDJ5_BCL2L11-01       -------------------tgtttaccgggaagcagaaggccacccccag
F7CXT2_BCL2L11-01       -------------------taactatcaaggagcaggtgaccatcaccaa
G3W979_BCL2L11-01       -------------------taactatcaagcagcagatgatcatcaccaa
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       -------------------taattacccagcagcggaggagcagccccaa
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       -------------------cgattaccgagaggcggaagaccacccgcaa
O88498_BCL2L11-02       -------------------cgattaccgagaggcggaagaccacccgcaa
O54918_BCL2L11-05       -------------------tgattaccgcgaggctgaagaccaccctcaa
O54918_BCL2L11-01       -------------------tgattaccgcgaggctgaagaccaccctcaa
O54918_BCL2L11-08       -------------------tgattaccgcgaggctgaagaccaccctcaa
O54918_BCL2L11-06       -------------------tgattaccgcgaggctgaagaccaccctcaa
W5PY58_BCL2L11-01       -------------------gcgtcaccaggcgattgagggccacccacaa
Q2YDF0_BCL2L11-02       -------------------gcgtcaccaggcagttgagggccacccgcaa
Q2YDF0_BCL2L11-03       -------------------gcgtcaccaggcagttgagggccacccgcaa
Q2YDF0_BCL2L11-01       -------------------gcgtcaccaggcagttgagggccacccgcaa
A0A286XJN2_BCL2L11      -------------------tcattaccagcccgctgaagaccaaccccaa
A0A286XJN2_BCL2L11      -------------------tcattaccagcccgctgaagaccaaccccaa
A0A286XJN2_BCL2L11      -------------------tcattaccagcccgctgaagaccaaccccaa
A0A287DFJ0_BCL2L11      -------------------taataattaccaacctgaagaccgcccccaa
A0A287DFJ0_BCL2L11      -------------------taataattaccaacctgaagaccgcccccaa
H0XW23_BCL2L11-01       -------------------taattaccaagcagccgaagaccaccctcaa
A0A2K6GE31_BCL2L11      -------------------aaa----------------------------
A0A2K6GE31_BCL2L11      -------------------tag----------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      -------------------taa----------------------------
A0A2K6GE31_BCL2L11      -------------------taattaccaagccgacgaagaccaccctcaa
A0A2K6GE31_BCL2L11      -------------------taattaccaagccgacgaagaccaccctcaa
A0A2I3HW02_BCL2L11      -------------------tga----------------------------
A0A2R9CA99_BCL2L11      -------------------tga----------------------------
A0A2J8JCT2_BCL2L11      -------------------tga----------------------------
A0A2I2YQ13_BCL2L11      -------------------tga----------------------------
O43521_BCL2L11-06       -------------------tga----------------------------
O43521_BCL2L11-15       -------------------tga----------------------------
A0A2K5X2I7_BCL2L11      -------------------tga----------------------------
F7HHA9_BCL2L11-09       -------------------tga----------------------------
A0A2K6E226_BCL2L11      -------------------tga----------------------------
A0A2K5NU92_BCL2L11      -------------------tga----------------------------
A0A2K5Z8B6_BCL2L11      -------------------tga----------------------------
A0A2I3M6I1_BCL2L11      -------------------tga----------------------------
A0A2K5HZI7_BCL2L11      -------------------tga----------------------------
A0A2K6KJP8_BCL2L11      -------------------tga----------------------------
A0A2K6QIL2_BCL2L11      -------------------tga----------------------------
F6XMC1_BCL2L11-09       -------------------tgg----------------------------
A0A2K5CAB2_BCL2L11      -------------------tga----------------------------
A0A2K6TRZ5_BCL2L11      -------------------tga----------------------------
A0A2K5NU92_BCL2L11      -------------------gaa----------------------------
A0A2K5X2I7_BCL2L11      -------------------gaa----------------------------
F7HHA9_BCL2L11-05       -------------------gaa----------------------------
A0A2K5Z8B6_BCL2L11      -------------------gaa----------------------------
A0A2K5HZI7_BCL2L11      -------------------aaa----------------------------
A0A2K6QIL2_BCL2L11      -------------------aaa----------------------------
A0A2K6KJP8_BCL2L11      -------------------aaa----------------------------
O43521_BCL2L11-13       -------------------aaa----------------------------
O43521_BCL2L11-17       -------------------aaa----------------------------
A0A2J8JCT2_BCL2L11      -------------------aaa----------------------------
A0A2I3HW02_BCL2L11      -------------------aaa----------------------------
A0A2I2YQ13_BCL2L11      -------------------aaa----------------------------
A0A2R9CA99_BCL2L11      -------------------aaa----------------------------
F6XMC1_BCL2L11-02       cccaaagaattatttctggtaatattctccaatctgtggccagatggtgc
F6XMC1_BCL2L11-01       cccaaagaattatttctggtaatattctccaatctgtggccagatggtgc
F6XMC1_BCL2L11-06       -------------------tag----------------------------
A0A2K5CAB2_BCL2L11      -------------------tag----------------------------
A0A2K6TRZ5_BCL2L11      -------------------tag----------------------------
F6XMC1_BCL2L11-08       -------------------taa----------------------------
A0A2K5CAB2_BCL2L11      -------------------tag----------------------------
A0A2K6TRZ5_BCL2L11      -------------------tag----------------------------
F6XMC1_BCL2L11-03       -------------------taattaccaagcagctgaagaccacccacac
F6XMC1_BCL2L11-04       -------------------taa----------------------------
A0A2K5CAB2_BCL2L11      -------------------taa----------------------------
A0A2K5CAB2_BCL2L11      -------------------taattaccaagcagccgaagaccacccacac
A0A2K5CAB2_BCL2L11      -------------------taattaccaagcagccgaagaccacccacac
A0A2K5CAB2_BCL2L11      -------------------taattaccaagcagccgaagaccacccacac
A0A2K6TRZ5_BCL2L11      -------------------taa----------------------------
A0A2K6TRZ5_BCL2L11      -------------------taattaccaagcagccgaagaccacccgcac
A0A2K6TRZ5_BCL2L11      -------------------taattaccaagcagccgaagaccacccgcac
A0A2K6TRZ5_BCL2L11      -------------------taattaccaagcagccgaagaccacccgcac
F6XMC1_BCL2L11-05       -------------------tga----------------------------
F6XMC1_BCL2L11-07       -------------------tag----------------------------
A0A2K5CAB2_BCL2L11      -------------------tga----------------------------
A0A2K6TRZ5_BCL2L11      -------------------tga----------------------------
A0A2K5CAB2_BCL2L11      -------------------aaatag-------------------------
A0A2K6TRZ5_BCL2L11      -------------------aaatag-------------------------
H2P5E2_BCL2L11-01       -------------------taattaccaagcagccgaagaccacccacga
A0A2K6E226_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
O43521_BCL2L11-21       -------------------taa----------------------------
O43521_BCL2L11-02       -------------------taattaccaagcagccgaagaccacccacga
O43521_BCL2L11-03       -------------------taattaccaagcagccgaagaccacccacga
A0A2J8JCT2_BCL2L11      -------------------taattaccaagcagccgaagaccacccacga
A0A2J8JCT2_BCL2L11      -------------------taattaccaagcagccgaagaccacccacga
A0A2I3HW02_BCL2L11      -------------------taattaccaagcagccgaagaccacccacga
A0A2I2YQ13_BCL2L11      -------------------taa----------------------------
A0A2I3HW02_BCL2L11      -------------------taa----------------------------
A0A2R9CA99_BCL2L11      -------------------taa----------------------------
A0A2J8JCT2_BCL2L11      -------------------taa----------------------------
A0A2I2YQ13_BCL2L11      -------------------taattaccaagcagccgaagaccacccacga
A0A2R9CA99_BCL2L11      -------------------taattaccaagcagccgaagaccacccacga
A0A2I2YQ13_BCL2L11      -------------------taattaccaagcagccgaagaccacccacga
A0A2R9CA99_BCL2L11      -------------------taattaccaagcagccgaagaccacccacga
A0A2I3M6I1_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2I3M6I1_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2I3M6I1_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K5NU92_BCL2L11      -------------------taa----------------------------
A0A2K5X2I7_BCL2L11      -------------------taa----------------------------
F7HHA9_BCL2L11-01       -------------------taa----------------------------
A0A2K6E226_BCL2L11      -------------------taa----------------------------
A0A2K5Z8B6_BCL2L11      -------------------taa----------------------------
A0A2I3M6I1_BCL2L11      -------------------taa----------------------------
A0A2K5NU92_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K5X2I7_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K6E226_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K6E226_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K5Z8B6_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K5NU92_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K5X2I7_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K6E226_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K5Z8B6_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K5HZI7_BCL2L11      -------------------taa----------------------------
A0A2K5HZI7_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K5HZI7_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K6QIL2_BCL2L11      -------------------taattaccaagcagccgaagaacacccacaa
A0A2K6QIL2_BCL2L11      -------------------taattaccaagcagccgaagaacacccacaa
A0A2K6QIL2_BCL2L11      -------------------taattaccaagcagccgaagaacacccacaa
A0A2K6KJP8_BCL2L11      -------------------taa----------------------------
A0A2K6QIL2_BCL2L11      -------------------taa----------------------------
A0A2K6KJP8_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K6KJP8_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
A0A2K6KJP8_BCL2L11      -------------------taattaccaagcagccgaagaccacccacaa
Q6JTU4_BCL2L11-01       -------------------tag----------------------------
O43521_BCL2L11-05       -------------------tag----------------------------
O43521_BCL2L11-25       -------------------tag----------------------------
O43521_BCL2L11-18       -------------------tag----------------------------
O43521_BCL2L11-09       -------------------taa----------------------------
O43521_BCL2L11-16       -------------------taa----------------------------
O43521_BCL2L11-10       -------------------taa----------------------------
O43521_BCL2L11-20       -------------------taa----------------------------
A0A2K6KJP8_BCL2L11      -------------------tag----------------------------
A0A2K6QIL2_BCL2L11      -------------------tag----------------------------
A0A2K5HZI7_BCL2L11      -------------------tag----------------------------
O43521_BCL2L11-22       -------------------tag----------------------------
O43521_BCL2L11-08       -------------------tag----------------------------
A0A2I2YQ13_BCL2L11      -------------------tag----------------------------
A0A2I3HW02_BCL2L11      -------------------tag----------------------------
A0A2R9CA99_BCL2L11      -------------------tag----------------------------
A0A2J8JCT2_BCL2L11      -------------------tag----------------------------
A0A2K5NU92_BCL2L11      -------------------tag----------------------------
A0A2K5X2I7_BCL2L11      -------------------tag----------------------------
F7HHA9_BCL2L11-03       -------------------tag----------------------------
A0A2K6E226_BCL2L11      -------------------tag----------------------------
A0A2K5Z8B6_BCL2L11      -------------------tag----------------------------
A0A2I3M6I1_BCL2L11      -------------------tag----------------------------
O43521_BCL2L11-07       -------------------tag----------------------------
O43521_BCL2L11-19       -------------------tag----------------------------
A0A2I2YQ13_BCL2L11      -------------------taa----------------------------
A0A2R9CA99_BCL2L11      -------------------taa----------------------------
A0A2J8JCT2_BCL2L11      -------------------taa----------------------------
A0A2J8JCT2_BCL2L11      -------------------tag----------------------------
A0A2I2YQ13_BCL2L11      -------------------tag----------------------------
A0A2R9CA99_BCL2L11      -------------------tag----------------------------
A0A2I3HW02_BCL2L11      -------------------tag----------------------------
A0A2K6KJP8_BCL2L11      -------------------tag----------------------------
A0A2K6QIL2_BCL2L11      -------------------tag----------------------------
O43521_BCL2L11-24       -------------------tag----------------------------
O43521_BCL2L11-12       -------------------tag----------------------------
A0A2I2YQ13_BCL2L11      -------------------tag----------------------------
A0A2I3HW02_BCL2L11      -------------------tag----------------------------
A0A2R9CA99_BCL2L11      -------------------tag----------------------------
A0A2J8JCT2_BCL2L11      -------------------tag----------------------------
A0A2K5NU92_BCL2L11      -------------------tag----------------------------
A0A2K5X2I7_BCL2L11      -------------------tag----------------------------
F7HHA9_BCL2L11-06       -------------------tag----------------------------
A0A2K6E226_BCL2L11      -------------------tag----------------------------
A0A2K5Z8B6_BCL2L11      -------------------tag----------------------------
A0A2I3M6I1_BCL2L11      -------------------tag----------------------------
A0A2K5HZI7_BCL2L11      -------------------tag----------------------------
A0A2K6KJP8_BCL2L11      -------------------tag----------------------------
A0A2K6QIL2_BCL2L11      -------------------tag----------------------------
A0A2K5HZI7_BCL2L11      -------------------tag----------------------------
A0A2K5NU92_BCL2L11      -------------------tag----------------------------
A0A2K5X2I7_BCL2L11      -------------------tag----------------------------
F7HHA9_BCL2L11-04       -------------------tag----------------------------
A0A2K6E226_BCL2L11      -------------------tag----------------------------
A0A2K5Z8B6_BCL2L11      -------------------tag----------------------------
A0A2I3M6I1_BCL2L11      -------------------tag----------------------------
A0A0D9RWE0_BCL2L11      -------------------tag----------------------------
A0A2K5NU92_BCL2L11      -------------------taa----------------------------
A0A2K5X2I7_BCL2L11      -------------------taa----------------------------
F7HHA9_BCL2L11-02       -------------------taa----------------------------
A0A2K6E226_BCL2L11      -------------------taa----------------------------
A0A2K5Z8B6_BCL2L11      -------------------taa----------------------------
A0A2I3M6I1_BCL2L11      -------------------taa----------------------------
A0A2K6KJP8_BCL2L11      -------------------taa----------------------------
A0A2K6QIL2_BCL2L11      -------------------taa----------------------------
A0A2K5HZI7_BCL2L11      -------------------taa----------------------------
A0A2I3HW02_BCL2L11      ----------aaatcaagctaa----------------------------
A0A2I2YQ13_BCL2L11      ----------aaatcaagctaa----------------------------
O43521_BCL2L11-23       ----------aaatcaagctaa----------------------------
A0A2R9CA99_BCL2L11      ----------aaatcaagctaa----------------------------
A0A2J8JCT2_BCL2L11      ----------aaatcaagctaa----------------------------
A0A2I3M6I1_BCL2L11      ------------atcaagctaa----------------------------
A0A2K5X2I7_BCL2L11      ------------atcaagctaa----------------------------
F7HHA9_BCL2L11-07       ------------a------taa----------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      ------------atcaagctaa----------------------------
A0A2K5Z8B6_BCL2L11      ------------atcaagctaa----------------------------
A0A2K5CAB2_BCL2L11      ----------aaatcaagctga----------------------------
A0A2K6TRZ5_BCL2L11      ----------aaatcaagctga----------------------------
F1SU81_BCL2L11-01       -------------------taattaccaagcagccgaagcccaccctcag
C1KGB8_BCL2L11-01       -------------------ttctt-----------------taccccc--
F1SU81_BCL2L11-02       -------------------ttctt-----------------taccccc--
F1SU81_BCL2L11-03       -------------------ttctt-----------------taccccc--
G3SU55_BCL2L11-01       -------------------taattaccaagcagccgaagaccaccctcaa
M3YDI3_BCL2L11-01       -------------------taattacccagcagccgaagcccacccccaa
A0A337SW42_BCL2L11      -------------------agggtaccg----------------------
G1LDR8_BCL2L11-01       -------------------taattaccaagcagccgaagcccacccccaa
J9NWV6_BCL2L11-01       -------------------taattaccaagcagccgaagcccacccccaa
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      -------------------caatag-------------------------
A0A337SW42_BCL2L11      -------------------taa----------------------------
A0A337SW42_BCL2L11      -------------------taattaccaagcagccgaagcccagccccaa
A0A337SW42_BCL2L11      -------------------taattaccaagcagccgaagcccagccccaa
                                                                          

A0A3B3QC78_BCL2L11      ctccttaccctggggacaacaagaacaaagagtcacccctaagatccaga
B2KKY9_BCL2L11-01       atcg---tcctgtggatgaacgtcattatcggacgcc-------------
B8JK68_BCL2L11-01       atcg---tcctgtggatgaacgacattatcggacgcc-------------
Q4KMV9_BCL2L11-01       gtaataatcctgcgtgttttacgtttcattatccgac-------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      ttcatactgtggatggggctcc---tgattgaacgtc-------------
W5UEE7_BCL2L11-01       atcatgctgtggattgggctcc---tgattggacggc-------------
A0A3B4BVX1_BCL2L11      ------------ctcgagatctgcacgatcaaatgtt-------------
A0A3B4BVX1_BCL2L11      gccttttcaatcctggggcttt---ttcgtggacac--------------
A0A3B4BVX1_BCL2L11      ttcatgctgtggctggggctcg---tgatcagacgcc-------------
A0A3B4V919_BCL2L11      -cagtgctgccaa-----acccatttctgctga-----------------
A0A3B4XZH1_BCL2L11      -c----ctgttaagggtcagtcatcacagatggtgtg-------------
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      atggg--------------------------aacaaa-------------
A0A3B5QAM1_BCL2L11      atagtccctctaaacctgatgccgcacatccagcaag-------------
A0A3B5QAM1_BCL2L11      atagtccctctaaacctgatgccgcacatccagcaag-------------
A0A3B3VNE0_BCL2L11      atagtccctctaaacctgatgccgcacatccagcaag-------------
A0A3B3YII5_BCL2L11      atagtccctctaaacctgatgccacacatccagcaag-------------
A0A3B3YII5_BCL2L11      atagtccctctaaacctgatgccacacatccagcaag-------------
R4G9R5_BCL2L11-01       atcataattttgcgcctgttacattacattgtccgct-------------
F7FTC8_BCL2L11-01       atgggttttgtgcacctgttacgttacatcatccgcc-------------
G1MV54_BCL2L11-01       gtggtcattctgcgcctcctgcattacatcatccgcc-------------
K7GA86_BCL2L11-01       attg---ttttgcgcttgttgcattacatcatccgcc-------------
G1PDJ5_BCL2L11-01       atggtggtcttacgactgttgcgttacatcctccgtc-------------
F7CXT2_BCL2L11-01       atggttattttacgcctgttacgttacatcatccgcc-------------
G3W979_BCL2L11-01       atggttattttacggctattacattacatcatccgcc-------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       atggttatcttgcgactgttgcgttacatcgtgcgcc-------------
O54918_BCL2L11-03       ---------------------------------tgcc-------------
O88498_BCL2L11-01       atggttatcttacaactgttacgattcatcttccgtc-------------
O88498_BCL2L11-02       atggttatcttacaactgttacgattcatcttccgtc-------------
O54918_BCL2L11-05       atggttatcttacaactgttacgctttatcttccgtc-------------
O54918_BCL2L11-01       atggttatcttacaactgttacgctttatcttccgtc-------------
O54918_BCL2L11-08       atggttatcttacaactgttacgctttatcttccgtc-------------
O54918_BCL2L11-06       atggttatcttacaactgttacgctttatcttccgtc-------------
W5PY58_BCL2L11-01       atggtcctcctgcgcgtcttgcgctacctggtgcgtc-------------
Q2YDF0_BCL2L11-02       atggtcctcttgcgcgtcttgcgctacatcgtgcgtc-------------
Q2YDF0_BCL2L11-03       atggtcctcttgcgcgtcttgcgctacatcgtgcgtc-------------
Q2YDF0_BCL2L11-01       atggtcctcttgcgcgtcttgcgctacatcgtgcgtc-------------
A0A286XJN2_BCL2L11      atggttatcttgcgattgttacgttacattatccgcc-------------
A0A286XJN2_BCL2L11      atggttatcttgcgattgttacgttacattatccgcc-------------
A0A286XJN2_BCL2L11      atggttatcttgcgattgttacgttacattatccgcc-------------
A0A287DFJ0_BCL2L11      atggttatcttgcgcctgttgcgttgcatcatccgcc-------------
A0A287DFJ0_BCL2L11      atggttatcttgcgcctgttgcgttgcatcatccgcc-------------
H0XW23_BCL2L11-01       atggttatattacgactgttgcgttacatcgtccgcc-------------
A0A2K6GE31_BCL2L11      -------------------tgcctggtaccctccatc-------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      -------------------------------tccatc-------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      atgcttatcttgcgactgttacgttacattgtccgcc-------------
A0A2K6GE31_BCL2L11      atgcttatcttgcgactgttacgttacattgtccgcc-------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      -------------------ctcctggcatcctccacc-------------
A0A2K5X2I7_BCL2L11      -------------------ctcctggcatcctccacc-------------
F7HHA9_BCL2L11-05       -------------------ctcctggcatcctccacc-------------
A0A2K5Z8B6_BCL2L11      -------------------ctcctggcatcctccacc-------------
A0A2K5HZI7_BCL2L11      -------------------ctcctggcatcctccacc-------------
A0A2K6QIL2_BCL2L11      -------------------ctcctggcatcctccacc-------------
A0A2K6KJP8_BCL2L11      -------------------cttctggcatcctccacc-------------
O43521_BCL2L11-13       -------------------ctcctggcatcctccacc-------------
O43521_BCL2L11-17       -------------------ctcctggcatcctccacc-------------
A0A2J8JCT2_BCL2L11      -------------------ctcctggcatcctccacc-------------
A0A2I3HW02_BCL2L11      -------------------ctcctggcatcctccacc-------------
A0A2I2YQ13_BCL2L11      -------------------ctcctggcatcctccacc-------------
A0A2R9CA99_BCL2L11      -------------------ctcctg---tcctccacc-------------
F6XMC1_BCL2L11-02       caaatgatgttgaccccacagctgtacttggttctca-------------
F6XMC1_BCL2L11-01       caaatgatgttgaccccacagctgtacttggttctca-------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-03       atggttatcttacgactgttacgttacattgtccgcc-------------
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2K5CAB2_BCL2L11      atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2K5CAB2_BCL2L11      atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2K6TRZ5_BCL2L11      atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2K6TRZ5_BCL2L11      atggttatcttacgactgttacgttacattgtccgcc-------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2K6E226_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       atggttatcttacgactgttacgttacattgtccgcc-------------
O43521_BCL2L11-03       atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2J8JCT2_BCL2L11      atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2J8JCT2_BCL2L11      atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2I3HW02_BCL2L11      atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2R9CA99_BCL2L11      atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2I2YQ13_BCL2L11      atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2R9CA99_BCL2L11      atggttatcttacgactgttacgttacattgtccgcc-------------
A0A2I3M6I1_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2I3M6I1_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2I3M6I1_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K5X2I7_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K6E226_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K6E226_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K5Z8B6_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K5NU92_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K5X2I7_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K6E226_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K5Z8B6_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K5HZI7_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K6QIL2_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K6QIL2_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K6QIL2_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K6KJP8_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
A0A2K6KJP8_BCL2L11      atggttatcttacgactgttgcgttacattgtccgcc-------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F1SU81_BCL2L11-01       atggttatcttacgactgttacgctacatcgcccgtc-------------
C1KGB8_BCL2L11-01       -------cttttcccctcacaccctccctccccctta-------------
F1SU81_BCL2L11-02       -------cttttcccctcacaccctccctccccctta-------------
F1SU81_BCL2L11-03       -------cttttcccctcacaccctccctccccctta-------------
G3SU55_BCL2L11-01       atggttatcttacgtctcttacgctacatcgtccgcc-------------
M3YDI3_BCL2L11-01       atgattatcttacgactgttacgttacatcatccgcc-------------
A0A337SW42_BCL2L11      -------------------------gcatcctacatc-------------
G1LDR8_BCL2L11-01       atgattatcttgcgactgttacgttacatcgtccgcc-------------
J9NWV6_BCL2L11-01       atgattatcttacgactgttacgttacatcgtccgcc-------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      atgattatcttacgactgttacgttacatcgtccgcc-------------
A0A337SW42_BCL2L11      atgattatcttacgactgttacgttacatcgtccgcc-------------
                                                                          

A0A3B3QC78_BCL2L11      tcttcctggctccatgttagaatgggggaagtggagcaacaggaaatagt
B2KKY9_BCL2L11-01       -----------------tagtacactttttcctgcgaagaagatga----
B8JK68_BCL2L11-01       -----------------tagtacactttttcctgcgaagaagatga----
Q4KMV9_BCL2L11-01       -----------------tgatcctgagattataa----------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      -----------------tccgacagttcctccacagaagaagatga----
W5UEE7_BCL2L11-01       -----------------tattacaattcttcctgagacaaagatga----
A0A3B4BVX1_BCL2L11      -----------------tgctttaagc----------------taa----
A0A3B4BVX1_BCL2L11      -------------------------------------------tga----
A0A3B4BVX1_BCL2L11      -----------------tattagaggtcctcctaagacgaagatga----
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      -----------------tgtgtgtgtgtgtgtgt-gtgtgtgcgtgcggg
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      -----------------tagctgtta---------atatcggc---ccag
A0A3B5QAM1_BCL2L11      -----------------agcctgttgccatgctttgtgtctgccttctgc
A0A3B5QAM1_BCL2L11      -----------------agcctgttgccatgctttgtgtctgccttctgc
A0A3B3VNE0_BCL2L11      -----------------agcctgttgccatgctttgtgtctgccttctgc
A0A3B3YII5_BCL2L11      -----------------agcctgttgccatgctttgtgtctgccttctgc
A0A3B3YII5_BCL2L11      -----------------agcctgttgccatgctttgtgtctgccttctgc
R4G9R5_BCL2L11-01       -----------------tcatttggagaatgcagtga-------------
F7FTC8_BCL2L11-01       -----------------gcgtttggagactgcagtga-------------
G1MV54_BCL2L11-01       -----------------tcatctggaggatgcagtga-------------
K7GA86_BCL2L11-01       -----------------tcatttggagaatgcagtaa-------------
G1PDJ5_BCL2L11-01       -----------------tggtgtggaggaggatg----------------
F7CXT2_BCL2L11-01       -----------------ttgtttggagaatgcagtga-------------
G3W979_BCL2L11-01       -----------------ttgtttggagaatgcagtga-------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       -----------------tggtgtggaggatgcat----------------
O54918_BCL2L11-03       -----------------tggtaca--------actga-------------
O88498_BCL2L11-01       -----------------tggtctggagaaggcactga-------------
O88498_BCL2L11-02       -----------------tggtctggagaaggcactga-------------
O54918_BCL2L11-05       -----------------tggtatggagaaggcattga-------------
O54918_BCL2L11-01       -----------------tggtatggagaaggcattga-------------
O54918_BCL2L11-08       -----------------tggtatggagaaggcattga-------------
O54918_BCL2L11-06       -----------------tggtatggagaaggcattga-------------
W5PY58_BCL2L11-01       -----------------tggtgtggaggatgcagtga-------------
Q2YDF0_BCL2L11-02       -----------------tggtgtggaggatgcagtga-------------
Q2YDF0_BCL2L11-03       -----------------tggtgtggaggatgcagtga-------------
Q2YDF0_BCL2L11-01       -----------------tggtgtggaggatgcagtga-------------
A0A286XJN2_BCL2L11      -----------------tggtatggcgaatgcattga-------------
A0A286XJN2_BCL2L11      -----------------tggtatggcgaatgcattga-------------
A0A286XJN2_BCL2L11      -----------------tggtatggcgaatgcattga-------------
A0A287DFJ0_BCL2L11      -----------------tggtgtggaggatgcactga-------------
A0A287DFJ0_BCL2L11      -----------------tggtgtggaggatgcactga-------------
H0XW23_BCL2L11-01       -----------------tggtgtggaggctgcactga-------------
A0A2K6GE31_BCL2L11      -----------------tga------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      -----------------tg-------------attaa-------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      -----------------tggtgtggaggaggcattga-------------
A0A2K6GE31_BCL2L11      -----------------tggtgtggaggaggcattga-------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      -----------------tga------------------------------
A0A2K5X2I7_BCL2L11      -----------------tga------------------------------
F7HHA9_BCL2L11-05       -----------------tga------------------------------
A0A2K5Z8B6_BCL2L11      -----------------tga------------------------------
A0A2K5HZI7_BCL2L11      -----------------tga------------------------------
A0A2K6QIL2_BCL2L11      -----------------tga------------------------------
A0A2K6KJP8_BCL2L11      -----------------tga------------------------------
O43521_BCL2L11-13       -----------------tga------------------------------
O43521_BCL2L11-17       -----------------tga------------------------------
A0A2J8JCT2_BCL2L11      -----------------tga------------------------------
A0A2I3HW02_BCL2L11      -----------------tga------------------------------
A0A2I2YQ13_BCL2L11      -----------------tga------------------------------
A0A2R9CA99_BCL2L11      -----------------tga------------------------------
F6XMC1_BCL2L11-02       -----------------aggacggtggccccgtggtcaaatctgctttaa
F6XMC1_BCL2L11-01       -----------------aggacggtggccccgtggtcaaatctgctttaa
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-03       -----------------tggtgtggag-----------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      -----------------tggtgtggag-----------------------
A0A2K5CAB2_BCL2L11      -----------------tggtgtggag-----------------------
A0A2K5CAB2_BCL2L11      -----------------tggtgtggag-----------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      -----------------tggtgtggag-----------------------
A0A2K6TRZ5_BCL2L11      -----------------tggtgtggag-----------------------
A0A2K6TRZ5_BCL2L11      -----------------tggtgtggag-----------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       -----------------tggtatggagaatgcattga-------------
A0A2K6E226_BCL2L11      -----------------tggtgtggagaatgcattga-------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       -----------------tggtgtggagaatgcattga-------------
O43521_BCL2L11-03       -----------------tggtgtggagaatgcattga-------------
A0A2J8JCT2_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2J8JCT2_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2I3HW02_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2R9CA99_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2I2YQ13_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2R9CA99_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2I3M6I1_BCL2L11      -----------------tggtgtggaggatgcattga-------------
A0A2I3M6I1_BCL2L11      -----------------tggtgtggaggatgcattga-------------
A0A2I3M6I1_BCL2L11      -----------------tggtgtggaggatgcattga-------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K5X2I7_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K6E226_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K6E226_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K5Z8B6_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K5NU92_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K5X2I7_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K6E226_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K5Z8B6_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K5HZI7_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K6QIL2_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K6QIL2_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K6QIL2_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K6KJP8_BCL2L11      -----------------tggtgtggagaatgcattga-------------
A0A2K6KJP8_BCL2L11      -----------------tggtgtggagaatgcattga-------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F1SU81_BCL2L11-01       -----------------tggtgtggaggatgcagtga-------------
C1KGB8_BCL2L11-01       -----------------catt-------------taa-------------
F1SU81_BCL2L11-02       -----------------catt-------------taa-------------
F1SU81_BCL2L11-03       -----------------catt-------------taa-------------
G3SU55_BCL2L11-01       -----------------tggtgtggaga----------------------
M3YDI3_BCL2L11-01       -----------------tggtgtggagattacagtga-------------
A0A337SW42_BCL2L11      -----------------tga------------------------------
G1LDR8_BCL2L11-01       -----------------tggtgtggagattgcagtga-------------
J9NWV6_BCL2L11-01       -----------------tggtgtggagattgcagtga-------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      -----------------tggtatggcgattgcagtga-------------
A0A337SW42_BCL2L11      -----------------tggtatggcgattgcagtga-------------
                                                                          

A0A3B3QC78_BCL2L11      atga----------------------------------------------
B2KKY9_BCL2L11-01       --------------------------------------------------
B8JK68_BCL2L11-01       --------------------------------------------------
Q4KMV9_BCL2L11-01       --------------------------------------------------
M3XHJ5_BCL2L11-01       --------------------------------------------------
A0A3B1JXK6_BCL2L11      --------------------------------------------------
W5UEE7_BCL2L11-01       --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4BVX1_BCL2L11      --------------------------------------------------
A0A3B4V919_BCL2L11      --------------------------------------------------
A0A3B4XZH1_BCL2L11      tgtgtgtgtgcgtgcgggtgtgtgtgcgggtgtgtgcgggtgtgtggtgg
U3IW89_BCL2L11-01       --------------------------------------------------
A0A3B5M375_BCL2L11      ttttatttatcaggccgataccgatgttagtgc-cgatatatcatgcatc
A0A3B5QAM1_BCL2L11      tcctcctggtcggacgaata---atgtacatgcaaggcaacacaagcagc
A0A3B5QAM1_BCL2L11      tcctcctggtcggacgaata---atgtacatgcaaggcaacacaagcagc
A0A3B3VNE0_BCL2L11      tcctcctggtcggacgaata---atgtacatgcaaggcaacacaagcagc
A0A3B3YII5_BCL2L11      tcctcctggtcggacgaata---atgtacatgcaaggcaacacaagcagc
A0A3B3YII5_BCL2L11      tcctcctggtcggacgaata---atgtacatgcaaggcaacacaagcagc
R4G9R5_BCL2L11-01       --------------------------------------------------
F7FTC8_BCL2L11-01       --------------------------------------------------
G1MV54_BCL2L11-01       --------------------------------------------------
K7GA86_BCL2L11-01       --------------------------------------------------
G1PDJ5_BCL2L11-01       --------------------------------------------------
F7CXT2_BCL2L11-01       --------------------------------------------------
G3W979_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-11       --------------------------------------------------
F7HHA9_BCL2L11-08       --------------------------------------------------
G1SSY0_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-03       --------------------------------------------------
O88498_BCL2L11-01       --------------------------------------------------
O88498_BCL2L11-02       --------------------------------------------------
O54918_BCL2L11-05       --------------------------------------------------
O54918_BCL2L11-01       --------------------------------------------------
O54918_BCL2L11-08       --------------------------------------------------
O54918_BCL2L11-06       --------------------------------------------------
W5PY58_BCL2L11-01       --------------------------------------------------
Q2YDF0_BCL2L11-02       --------------------------------------------------
Q2YDF0_BCL2L11-03       --------------------------------------------------
Q2YDF0_BCL2L11-01       --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A286XJN2_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
A0A287DFJ0_BCL2L11      --------------------------------------------------
H0XW23_BCL2L11-01       --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2K6GE31_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-06       --------------------------------------------------
O43521_BCL2L11-15       --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-09       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-09       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-05       --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
O43521_BCL2L11-13       --------------------------------------------------
O43521_BCL2L11-17       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-02       aactgccatggttccactctccagtggcatga------------------
F6XMC1_BCL2L11-01       aactgccatggttccactctccagtggcatga------------------
F6XMC1_BCL2L11-06       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-08       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F6XMC1_BCL2L11-03       ----------------------aatgcattga------------------
F6XMC1_BCL2L11-04       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      ----------------------aatgcattga------------------
A0A2K5CAB2_BCL2L11      ----------------------aatgcattga------------------
A0A2K5CAB2_BCL2L11      ----------------------aatgcattga------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ----------------------aatgcattga------------------
A0A2K6TRZ5_BCL2L11      ----------------------aatgcattga------------------
A0A2K6TRZ5_BCL2L11      ----------------------aatgcattga------------------
F6XMC1_BCL2L11-05       --------------------------------------------------
F6XMC1_BCL2L11-07       --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
H2P5E2_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
O43521_BCL2L11-21       --------------------------------------------------
O43521_BCL2L11-02       --------------------------------------------------
O43521_BCL2L11-03       --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-01       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
Q6JTU4_BCL2L11-01       --------------------------------------------------
O43521_BCL2L11-05       --------------------------------------------------
O43521_BCL2L11-25       --------------------------------------------------
O43521_BCL2L11-18       --------------------------------------------------
O43521_BCL2L11-09       --------------------------------------------------
O43521_BCL2L11-16       --------------------------------------------------
O43521_BCL2L11-10       --------------------------------------------------
O43521_BCL2L11-20       --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
O43521_BCL2L11-22       --------------------------------------------------
O43521_BCL2L11-08       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-03       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
O43521_BCL2L11-07       --------------------------------------------------
O43521_BCL2L11-19       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
O43521_BCL2L11-24       --------------------------------------------------
O43521_BCL2L11-12       --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-06       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-04       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A0D9RWE0_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-02       --------------------------------------------------
A0A2K6E226_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K6KJP8_BCL2L11      --------------------------------------------------
A0A2K6QIL2_BCL2L11      --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2I3HW02_BCL2L11      --------------------------------------------------
A0A2I2YQ13_BCL2L11      --------------------------------------------------
O43521_BCL2L11-23       --------------------------------------------------
A0A2R9CA99_BCL2L11      --------------------------------------------------
A0A2J8JCT2_BCL2L11      --------------------------------------------------
A0A2I3M6I1_BCL2L11      --------------------------------------------------
A0A2K5X2I7_BCL2L11      --------------------------------------------------
F7HHA9_BCL2L11-07       --------------------------------------------------
A0A2K5HZI7_BCL2L11      --------------------------------------------------
A0A2K5NU92_BCL2L11      --------------------------------------------------
A0A2K5Z8B6_BCL2L11      --------------------------------------------------
A0A2K5CAB2_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
G3SU55_BCL2L11-01       --------------------------------------------------
M3YDI3_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
G1LDR8_BCL2L11-01       --------------------------------------------------
J9NWV6_BCL2L11-01       --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
A0A337SW42_BCL2L11      --------------------------------------------------
                                                                          

A0A3B3QC78_BCL2L11      ----------------------------
B2KKY9_BCL2L11-01       ----------------------------
B8JK68_BCL2L11-01       ----------------------------
Q4KMV9_BCL2L11-01       ----------------------------
M3XHJ5_BCL2L11-01       ----------------------------
A0A3B1JXK6_BCL2L11      ----------------------------
W5UEE7_BCL2L11-01       ----------------------------
A0A3B4BVX1_BCL2L11      ----------------------------
A0A3B4BVX1_BCL2L11      ----------------------------
A0A3B4BVX1_BCL2L11      ----------------------------
A0A3B4V919_BCL2L11      ----------------------------
A0A3B4XZH1_BCL2L11      tgga---------gggggggtagagtag
U3IW89_BCL2L11-01       ----------------------------
A0A3B5M375_BCL2L11      cacgttaagaatctcagctctcgagtaa
A0A3B5QAM1_BCL2L11      catg--accactctcaggtttag-----
A0A3B5QAM1_BCL2L11      catg--accactctcaggtttag-----
A0A3B3VNE0_BCL2L11      cacg--accactctcaggtttag-----
A0A3B3YII5_BCL2L11      cacg--accactctcaggtttag-----
A0A3B3YII5_BCL2L11      cacg--accactctcaggtttag-----
R4G9R5_BCL2L11-01       ----------------------------
F7FTC8_BCL2L11-01       ----------------------------
G1MV54_BCL2L11-01       ----------------------------
K7GA86_BCL2L11-01       ----------------------------
G1PDJ5_BCL2L11-01       ----------------------------
F7CXT2_BCL2L11-01       ----------------------------
G3W979_BCL2L11-01       ----------------------------
O43521_BCL2L11-11       ----------------------------
F7HHA9_BCL2L11-08       ----------------------------
G1SSY0_BCL2L11-01       ----------------------------
O54918_BCL2L11-03       ----------------------------
O88498_BCL2L11-01       ----------------------------
O88498_BCL2L11-02       ----------------------------
O54918_BCL2L11-05       ----------------------------
O54918_BCL2L11-01       ----------------------------
O54918_BCL2L11-08       ----------------------------
O54918_BCL2L11-06       ----------------------------
W5PY58_BCL2L11-01       ----------------------------
Q2YDF0_BCL2L11-02       ----------------------------
Q2YDF0_BCL2L11-03       ----------------------------
Q2YDF0_BCL2L11-01       ----------------------------
A0A286XJN2_BCL2L11      ----------------------------
A0A286XJN2_BCL2L11      ----------------------------
A0A286XJN2_BCL2L11      ----------------------------
A0A287DFJ0_BCL2L11      ----------------------------
A0A287DFJ0_BCL2L11      ----------------------------
H0XW23_BCL2L11-01       ----------------------------
A0A2K6GE31_BCL2L11      ----------------------------
A0A2K6GE31_BCL2L11      ----------------------------
A0A2K6GE31_BCL2L11      ----------------------------
A0A2K6GE31_BCL2L11      ----------------------------
A0A2K6GE31_BCL2L11      ----------------------------
A0A2K6GE31_BCL2L11      ----------------------------
A0A2I3HW02_BCL2L11      ----------------------------
A0A2R9CA99_BCL2L11      ----------------------------
A0A2J8JCT2_BCL2L11      ----------------------------
A0A2I2YQ13_BCL2L11      ----------------------------
O43521_BCL2L11-06       ----------------------------
O43521_BCL2L11-15       ----------------------------
A0A2K5X2I7_BCL2L11      ----------------------------
F7HHA9_BCL2L11-09       ----------------------------
A0A2K6E226_BCL2L11      ----------------------------
A0A2K5NU92_BCL2L11      ----------------------------
A0A2K5Z8B6_BCL2L11      ----------------------------
A0A2I3M6I1_BCL2L11      ----------------------------
A0A2K5HZI7_BCL2L11      ----------------------------
A0A2K6KJP8_BCL2L11      ----------------------------
A0A2K6QIL2_BCL2L11      ----------------------------
F6XMC1_BCL2L11-09       ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K6TRZ5_BCL2L11      ----------------------------
A0A2K5NU92_BCL2L11      ----------------------------
A0A2K5X2I7_BCL2L11      ----------------------------
F7HHA9_BCL2L11-05       ----------------------------
A0A2K5Z8B6_BCL2L11      ----------------------------
A0A2K5HZI7_BCL2L11      ----------------------------
A0A2K6QIL2_BCL2L11      ----------------------------
A0A2K6KJP8_BCL2L11      ----------------------------
O43521_BCL2L11-13       ----------------------------
O43521_BCL2L11-17       ----------------------------
A0A2J8JCT2_BCL2L11      ----------------------------
A0A2I3HW02_BCL2L11      ----------------------------
A0A2I2YQ13_BCL2L11      ----------------------------
A0A2R9CA99_BCL2L11      ----------------------------
F6XMC1_BCL2L11-02       ----------------------------
F6XMC1_BCL2L11-01       ----------------------------
F6XMC1_BCL2L11-06       ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K6TRZ5_BCL2L11      ----------------------------
F6XMC1_BCL2L11-08       ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K6TRZ5_BCL2L11      ----------------------------
F6XMC1_BCL2L11-03       ----------------------------
F6XMC1_BCL2L11-04       ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K6TRZ5_BCL2L11      ----------------------------
A0A2K6TRZ5_BCL2L11      ----------------------------
A0A2K6TRZ5_BCL2L11      ----------------------------
A0A2K6TRZ5_BCL2L11      ----------------------------
F6XMC1_BCL2L11-05       ----------------------------
F6XMC1_BCL2L11-07       ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K6TRZ5_BCL2L11      ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K6TRZ5_BCL2L11      ----------------------------
H2P5E2_BCL2L11-01       ----------------------------
A0A2K6E226_BCL2L11      ----------------------------
O43521_BCL2L11-21       ----------------------------
O43521_BCL2L11-02       ----------------------------
O43521_BCL2L11-03       ----------------------------
A0A2J8JCT2_BCL2L11      ----------------------------
A0A2J8JCT2_BCL2L11      ----------------------------
A0A2I3HW02_BCL2L11      ----------------------------
A0A2I2YQ13_BCL2L11      ----------------------------
A0A2I3HW02_BCL2L11      ----------------------------
A0A2R9CA99_BCL2L11      ----------------------------
A0A2J8JCT2_BCL2L11      ----------------------------
A0A2I2YQ13_BCL2L11      ----------------------------
A0A2R9CA99_BCL2L11      ----------------------------
A0A2I2YQ13_BCL2L11      ----------------------------
A0A2R9CA99_BCL2L11      ----------------------------
A0A2I3M6I1_BCL2L11      ----------------------------
A0A2I3M6I1_BCL2L11      ----------------------------
A0A2I3M6I1_BCL2L11      ----------------------------
A0A2K5NU92_BCL2L11      ----------------------------
A0A2K5X2I7_BCL2L11      ----------------------------
F7HHA9_BCL2L11-01       ----------------------------
A0A2K6E226_BCL2L11      ----------------------------
A0A2K5Z8B6_BCL2L11      ----------------------------
A0A2I3M6I1_BCL2L11      ----------------------------
A0A2K5NU92_BCL2L11      ----------------------------
A0A2K5X2I7_BCL2L11      ----------------------------
A0A2K6E226_BCL2L11      ----------------------------
A0A2K6E226_BCL2L11      ----------------------------
A0A2K5Z8B6_BCL2L11      ----------------------------
A0A2K5NU92_BCL2L11      ----------------------------
A0A2K5X2I7_BCL2L11      ----------------------------
A0A2K6E226_BCL2L11      ----------------------------
A0A2K5Z8B6_BCL2L11      ----------------------------
A0A2K5HZI7_BCL2L11      ----------------------------
A0A2K5HZI7_BCL2L11      ----------------------------
A0A2K5HZI7_BCL2L11      ----------------------------
A0A2K6QIL2_BCL2L11      ----------------------------
A0A2K6QIL2_BCL2L11      ----------------------------
A0A2K6QIL2_BCL2L11      ----------------------------
A0A2K6KJP8_BCL2L11      ----------------------------
A0A2K6QIL2_BCL2L11      ----------------------------
A0A2K6KJP8_BCL2L11      ----------------------------
A0A2K6KJP8_BCL2L11      ----------------------------
A0A2K6KJP8_BCL2L11      ----------------------------
Q6JTU4_BCL2L11-01       ----------------------------
O43521_BCL2L11-05       ----------------------------
O43521_BCL2L11-25       ----------------------------
O43521_BCL2L11-18       ----------------------------
O43521_BCL2L11-09       ----------------------------
O43521_BCL2L11-16       ----------------------------
O43521_BCL2L11-10       ----------------------------
O43521_BCL2L11-20       ----------------------------
A0A2K6KJP8_BCL2L11      ----------------------------
A0A2K6QIL2_BCL2L11      ----------------------------
A0A2K5HZI7_BCL2L11      ----------------------------
O43521_BCL2L11-22       ----------------------------
O43521_BCL2L11-08       ----------------------------
A0A2I2YQ13_BCL2L11      ----------------------------
A0A2I3HW02_BCL2L11      ----------------------------
A0A2R9CA99_BCL2L11      ----------------------------
A0A2J8JCT2_BCL2L11      ----------------------------
A0A2K5NU92_BCL2L11      ----------------------------
A0A2K5X2I7_BCL2L11      ----------------------------
F7HHA9_BCL2L11-03       ----------------------------
A0A2K6E226_BCL2L11      ----------------------------
A0A2K5Z8B6_BCL2L11      ----------------------------
A0A2I3M6I1_BCL2L11      ----------------------------
O43521_BCL2L11-07       ----------------------------
O43521_BCL2L11-19       ----------------------------
A0A2I2YQ13_BCL2L11      ----------------------------
A0A2R9CA99_BCL2L11      ----------------------------
A0A2J8JCT2_BCL2L11      ----------------------------
A0A2J8JCT2_BCL2L11      ----------------------------
A0A2I2YQ13_BCL2L11      ----------------------------
A0A2R9CA99_BCL2L11      ----------------------------
A0A2I3HW02_BCL2L11      ----------------------------
A0A2K6KJP8_BCL2L11      ----------------------------
A0A2K6QIL2_BCL2L11      ----------------------------
O43521_BCL2L11-24       ----------------------------
O43521_BCL2L11-12       ----------------------------
A0A2I2YQ13_BCL2L11      ----------------------------
A0A2I3HW02_BCL2L11      ----------------------------
A0A2R9CA99_BCL2L11      ----------------------------
A0A2J8JCT2_BCL2L11      ----------------------------
A0A2K5NU92_BCL2L11      ----------------------------
A0A2K5X2I7_BCL2L11      ----------------------------
F7HHA9_BCL2L11-06       ----------------------------
A0A2K6E226_BCL2L11      ----------------------------
A0A2K5Z8B6_BCL2L11      ----------------------------
A0A2I3M6I1_BCL2L11      ----------------------------
A0A2K5HZI7_BCL2L11      ----------------------------
A0A2K6KJP8_BCL2L11      ----------------------------
A0A2K6QIL2_BCL2L11      ----------------------------
A0A2K5HZI7_BCL2L11      ----------------------------
A0A2K5NU92_BCL2L11      ----------------------------
A0A2K5X2I7_BCL2L11      ----------------------------
F7HHA9_BCL2L11-04       ----------------------------
A0A2K6E226_BCL2L11      ----------------------------
A0A2K5Z8B6_BCL2L11      ----------------------------
A0A2I3M6I1_BCL2L11      ----------------------------
A0A0D9RWE0_BCL2L11      ----------------------------
A0A2K5NU92_BCL2L11      ----------------------------
A0A2K5X2I7_BCL2L11      ----------------------------
F7HHA9_BCL2L11-02       ----------------------------
A0A2K6E226_BCL2L11      ----------------------------
A0A2K5Z8B6_BCL2L11      ----------------------------
A0A2I3M6I1_BCL2L11      ----------------------------
A0A2K6KJP8_BCL2L11      ----------------------------
A0A2K6QIL2_BCL2L11      ----------------------------
A0A2K5HZI7_BCL2L11      ----------------------------
A0A2I3HW02_BCL2L11      ----------------------------
A0A2I2YQ13_BCL2L11      ----------------------------
O43521_BCL2L11-23       ----------------------------
A0A2R9CA99_BCL2L11      ----------------------------
A0A2J8JCT2_BCL2L11      ----------------------------
A0A2I3M6I1_BCL2L11      ----------------------------
A0A2K5X2I7_BCL2L11      ----------------------------
F7HHA9_BCL2L11-07       ----------------------------
A0A2K5HZI7_BCL2L11      ----------------------------
A0A2K5NU92_BCL2L11      ----------------------------
A0A2K5Z8B6_BCL2L11      ----------------------------
A0A2K5CAB2_BCL2L11      ----------------------------
A0A2K6TRZ5_BCL2L11      ----------------------------
F1SU81_BCL2L11-01       ----------------------------
C1KGB8_BCL2L11-01       ----------------------------
F1SU81_BCL2L11-02       ----------------------------
F1SU81_BCL2L11-03       ----------------------------
G3SU55_BCL2L11-01       ----------------------------
M3YDI3_BCL2L11-01       ----------------------------
A0A337SW42_BCL2L11      ----------------------------
G1LDR8_BCL2L11-01       ----------------------------
J9NWV6_BCL2L11-01       ----------------------------
A0A337SW42_BCL2L11      ----------------------------
A0A337SW42_BCL2L11      ----------------------------
A0A337SW42_BCL2L11      ----------------------------
A0A337SW42_BCL2L11      ----------------------------
A0A337SW42_BCL2L11      ----------------------------
                                                    

© 1998-2019