Dataset for CDS BBC3 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

38 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gttaggttgggggaggctccggggaagcccctctcgccaggttgcggcag
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          cggccagcggggtccgggcggggcggggtcgggcggggcggggcggggcg
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gtgggagccgcagcaggcgccgcagcctcagcagcccggcgctggcaagt
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          cccaactgcctcggcgcagacggctgcaggagggcgggagcggggggcgg
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gagcggggcggggcggtcggtgacgtcacgcgggagccggggcgcgcggc
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          tgcagcgcgaggcggcggcggcggcggccgcggcagaaccagcctgggag
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          ccggcggcgcaagacacatgcgtgcggcccgcgggagccacagcaggagc
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gggagcgggagcagtggcgagcggcggcggcgacagaggtggcggcagca
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gcagcagcagcagcagcagcagcagcagcagcagcagcagaggcagcagc
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          agaggcagcggtggagagcaggcagcgcggagccaggcgcccccgggccg
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gcccggaccccgcctgacagcccctcaggcccgcccccgaaggcgcgttc
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          atgcccccggggggctcggcgtgggcctccgcagtggtgagtgtgcgccg
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          cggctgggggtgcgcgtgccgtgccgtgagcgggggccgctgtcaccgcg
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          ctgctgctgccgctgtgagtgcggggccggactggggaaactgaggcggg
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      ------------------------------atgaaatgtg----------
A0A2K5F6X4_BBC3-02      ---------------------------------aaatgtg----------
A0A2R8MW85_BBC3-03      ------------------------------atgaaatgtg----------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      ------------------------------atgaaatttg----------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      ------------------------------ataaaatttg----------
A0A2K5P2T8_BBC3-03      ------------------------------ataaaatttg----------
A0A2K5V8J3_BBC3-03      ------------------------------ataaaatttg----------
F7FFP6_BBC3-03          ------------------------------ataaaatttg----------
A0A2K6ASP2_BBC3-03      ------------------------------ataaaatttg----------
A0A2I3N2Z9_BBC3-03      ------------------------------ataaaatttg----------
A0A2I3HWI8_BBC3-03      ------------------------------atgaaatttg----------
A0A2R9BZA9_BBC3-01      ------------------------------atgaaatttg----------
A0A2I3RGH5_BBC3-03      ------------------------------atgaaatttg----------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          ------------------------------atgaaatttg----------
Q9BXH1_BBC3-05          ------------------------------atgaaatttg----------
Q9BXH1_BBC3-03          ------------------------------atgaaatttggcatggggtc
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gccgggcccgaggggtggcaccgccgctcacctgctccgcccacctgtct
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          tgcccaggcatgtccatgccaggtgcccagggctgcttccacgacgtggg
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          ---------------------------------atggcccgcgcacgcca
K7E5Y2_BBC3-01          gtgtccctccgcaggctccctccccactggggcatggccagagcccagca
K7E5Y2_BBC3-02          ---------------------------------atggccagagcccagca
Q99ML1_BBC3-02          ---------------------------------atggcccgcgcacgcca
Q80ZG6_BBC3-01          ---------------------------------atggcccgcgcacgcca
M3Y0R3_BBC3-01          ---------------caggccccagggagcgccatggcccgagcacgcca
F1RM01_BBC3-01          ---------------------------------atggcccgagcacgcca
A0A337SQV0_BBC3-03      ---------------------------------------------tacct
A0A3Q1LXZ6_BBC3-01      ---------------------------------atggcccgagcacgcca
A0A452E3G1_BBC3-01      ---------------------------------atggcccgagcacgcca
A0A3Q2GWE8_BBC3-01      ---------------------------------atggcccgagcacgcca
J9NTK9_BBC3-01          ---------------------------------atggcccgagcacgcca
A0A337SQV0_BBC3-02      ---------------------------------atggcccgagcacgcca
H0XQ00_BBC3-01          ---------------------------------atggcccgcgcacgcca
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      ---------------------------------atggcccgcgcacgcca
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          ---------------------------------atggcccgcgcacggca
A0A2I3RGH5_BBC3-01      ---------------------------------atggcccgcgcacgcca
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          tcccctgccagatttgtggccccagggagcgccatggcccgcgcacgcca
B4DQK3_BBC3-01          ---------------atggccccagggagcgccatggcccgcgcacgcca
Q9BXH1_BBC3-06          ---------------------------------atggcccgcgcacgcca
A0A0D9S2H2_BBC3-01      ---------------caggccccagggagcgccatggcccgcgcacgcca
A0A2K6QZU4_BBC3-01      ---------------------------------atggcccgcgcacgcca
                                                                          

G3T2N1_BBC3-01          ggagggcagctcccccgagcccgtagagggtctggcccgcgagagcccgc
K7E5Y2_BBC3-01          ggatggcagctctccggagccggtggaggggctgccccgggagagcccca
K7E5Y2_BBC3-02          ggatggcagctctccggagccggtggaggggctgccccgggagagcccca
Q99ML1_BBC3-02          ggagggcagctctccggagcccgtagagggtctagcccgcgacagtccgc
Q80ZG6_BBC3-01          ggagggcagctctccggagcccgtagagggcctagcccgcgacagcccgc
M3Y0R3_BBC3-01          ggagggcagctccccggagcccgtagagggcctgtcccgcgacggcccgc
F1RM01_BBC3-01          ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgc
A0A337SQV0_BBC3-03      gggggg------------------ggggggtct-----------------
A0A3Q1LXZ6_BBC3-01      ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgc
A0A452E3G1_BBC3-01      ggagggcagctcccccgagcccgtagagggcctggcccgcgacggcccgc
A0A3Q2GWE8_BBC3-01      ggagggcagctccccggagccggtagagggcctggcccgcgacggcccgc
J9NTK9_BBC3-01          ggagggcagctccccggagcccgtagagggcctggcccgcgacggtccgc
A0A337SQV0_BBC3-02      ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgc
H0XQ00_BBC3-01          agagggcagctccccggagcccgtagagggcctggctcgcgacggtccgc
A0A2K6STD6_BBC3-02      ----------------------gcatggggtctgcctgggcatgtcc---
A0A2K5F6X4_BBC3-02      ----------------------gcgtggggtctgcctgggcatgtcc---
A0A2R8MW85_BBC3-03      ----------------------gcgtggggtctgcctgggcatgtcc---
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      ----------------------gtgcggggtctgcccgggcatgtcc---
A0A2K6FQZ3_BBC3-01      ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgc
A0A2K6QZU4_BBC3-04      ----------------------gcgtggggtctgcccgggcatgtcc---
A0A2K5P2T8_BBC3-03      ----------------------gcgtggggtctgcccgggcatgtcc---
A0A2K5V8J3_BBC3-03      ----------------------gcgtggggtctgcccgggcatgtcc---
F7FFP6_BBC3-03          ----------------------gcgtggggtctgcccgggcatgtcc---
A0A2K6ASP2_BBC3-03      ----------------------gcgtggggtctgcccgggcatgtcc---
A0A2I3N2Z9_BBC3-03      ----------------------gcgtggggtctgcccgggcatgtcc---
A0A2I3HWI8_BBC3-03      ----------------------gcatggggtctgcccgggcatgtcc---
A0A2R9BZA9_BBC3-01      ----------------------gcatggggtctgcccaggcatgtcc---
A0A2I3RGH5_BBC3-03      ----------------------gcatggggtctgcccaggcatgtcc---
H2NZD3_BBC3-01          ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgc
A0A2I3RGH5_BBC3-01      ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgc
Q9BXH1_BBC3-04          ----------------------gcatggggtctgcccaggcatgtcc---
Q9BXH1_BBC3-05          ----------------------gcatggggtctgcccaggcatgtcc---
Q9BXH1_BBC3-03          ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgc
B4DQK3_BBC3-01          ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgc
Q9BXH1_BBC3-06          ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgc
A0A0D9S2H2_BBC3-01      ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgc
A0A2K6QZU4_BBC3-01      ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgc
                                                                          

G3T2N1_BBC3-01          gccccttcccactcggcagcctggtgccctcggccgtgtcctgtggcctc
K7E5Y2_BBC3-01          ggaccttccccctgggccggctcatgccctctgcggtctcctgcagcctc
K7E5Y2_BBC3-02          ggaccttccccctgggccggctcatgccctctgcggtctcctgcagcctc
Q99ML1_BBC3-02          gccccttcccgctcggccgcctgatgccctccgctgtatcctgcagcctt
Q80ZG6_BBC3-01          gtcctttcccgctcggccgcctgatgccctccgctgtatcctgcggcctc
M3Y0R3_BBC3-01          gcccctttcccctcagccgcctggtgccctcggccgtgtcctgtggcctc
F1RM01_BBC3-01          gtcccttccccctcagccgcctggtgccctccgccgtgtcctgcggcctc
A0A337SQV0_BBC3-03      ---------------------cggtg--------agagttgtgtg---tg
A0A3Q1LXZ6_BBC3-01      gccccttcccgctcagccgcctggtgccctcggcggtgtcctgcggcctc
A0A452E3G1_BBC3-01      gccccttcccgctcagccgcctggtgccctcggcggtgtcctgtggcctc
A0A3Q2GWE8_BBC3-01      gccccttcccgctcagccgcctggtgccctcggccgtgtcctgcggcctc
J9NTK9_BBC3-01          gcccgtttcccctcagccgcctggtgccctcggccgtgtcctgcggcctc
A0A337SQV0_BBC3-02      gcccctttcccctcagccgcctggtgccctcggccgtgtcctgcggcctc
H0XQ00_BBC3-01          gccccttcccgctcggccgcctagtgccctcggccgtgtcctgcggcctc
A0A2K6STD6_BBC3-02      ----------------atgccaagtgcccagg----------gcttcttc
A0A2K5F6X4_BBC3-02      ----------------atgccaagtgcctagg----------gcttcttc
A0A2R8MW85_BBC3-03      ----------------atgccaagtgcccagg----------gcttcttc
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      ----------------ctgccaggtgcccggg----------acttcctt
A0A2K6FQZ3_BBC3-01      gccccttcccgctcggccgcctggtgccctcggccgtgtcctgcggcctc
A0A2K6QZU4_BBC3-04      ----------------atgccaggtgcccagg----------gcttcttc
A0A2K5P2T8_BBC3-03      ----------------atgccaggtgcccagg----------gctgcttc
A0A2K5V8J3_BBC3-03      ----------------atgccaggtgcccagg----------gcttcttc
F7FFP6_BBC3-03          ----------------atgccaggtgcccagg----------gcttcttc
A0A2K6ASP2_BBC3-03      ----------------atgccaggtgcccagg----------gcttcttc
A0A2I3N2Z9_BBC3-03      ----------------atgccaggtgcccagg----------gcttcttc
A0A2I3HWI8_BBC3-03      ----------------atgccaggtgcccagg----------gcttcttc
A0A2R9BZA9_BBC3-01      ----------------atgccaggtgcccagg----------gctgcttc
A0A2I3RGH5_BBC3-03      ----------------atgccaggtgcccagg----------gctgcttc
H2NZD3_BBC3-01          gccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctc
A0A2I3RGH5_BBC3-01      gccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctc
Q9BXH1_BBC3-04          ----------------atgccaggtgcccagg----------gctgcttc
Q9BXH1_BBC3-05          ----------------atgccaggtgcccagg----------gctgcttc
Q9BXH1_BBC3-03          gccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctc
B4DQK3_BBC3-01          gccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctc
Q9BXH1_BBC3-06          gccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctc
A0A0D9S2H2_BBC3-01      gccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctc
A0A2K6QZU4_BBC3-01      gccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctc
                                                                          

G3T2N1_BBC3-01          tgcgagcccggcctt---------------cctcgagttgcagggccacg
K7E5Y2_BBC3-01          tgtgaggccggcttgaacccctctggcgactccatgtgcccagccccggg
K7E5Y2_BBC3-02          tgtgaggccggcttgaacccctctggcgactccatgtgcccagccccggg
Q99ML1_BBC3-02          tgcgagcccggcctg------cccgccgcccctgctgcccctgccttgct
Q80ZG6_BBC3-01          tgcgagcccggcctg------cccgctgcccctgctgcccctgccttgct
M3Y0R3_BBC3-01          tgggaatctgactgc------agtccccgagttgcagcccacggcctttt
F1RM01_BBC3-01          tgcgaacccggtctg------cctgccgcccccgccgcccccaccctgct
A0A337SQV0_BBC3-03      tgcgcgcgcg----------------------------------------
A0A3Q1LXZ6_BBC3-01      tgcgaacccggcctg------cctgctgcccccgccgcccccgccctgct
A0A452E3G1_BBC3-01      tgcgaacccggcctg------cctgctgcccccgccgcccccgccctgct
A0A3Q2GWE8_BBC3-01      tgcgagcccggcctg------cccgccgcgcccgccgcgcccgccctgct
J9NTK9_BBC3-01          tgcgagcccggcctg------cccgccgcccctgctgcccctgccctgct
A0A337SQV0_BBC3-02      tgcgagcccggcctg------cccgccgcccccgccgcccccgccctgct
H0XQ00_BBC3-01          tgcgagcccggcctg------cccgccgcccctgccgccccggctctgct
A0A2K6STD6_BBC3-02      cttga---------------------------------------------
A0A2K5F6X4_BBC3-02      ctcga---------------------------------------------
A0A2R8MW85_BBC3-03      ctcgg---------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      ctcat---------------------------------------------
A0A2K6FQZ3_BBC3-01      tgcgagcccggcctg------cccgctgcccccgccgcccccgccctgct
A0A2K6QZU4_BBC3-04      tgcga---------------------------------------------
A0A2K5P2T8_BBC3-03      tgcga---------------------------------------------
A0A2K5V8J3_BBC3-03      tgcga---------------------------------------------
F7FFP6_BBC3-03          tgcga---------------------------------------------
A0A2K6ASP2_BBC3-03      tgcga---------------------------------------------
A0A2I3N2Z9_BBC3-03      tgcga---------------------------------------------
A0A2I3HWI8_BBC3-03      cgtga---------------------------------------------
A0A2R9BZA9_BBC3-01      cgtga---------------------------------------------
A0A2I3RGH5_BBC3-03      cgcga---------------------------------------------
H2NZD3_BBC3-01          tgcgagcccggcctg------gccgccgcccccgccgcccccgccctgct
A0A2I3RGH5_BBC3-01      tgcgagcccggcctg------gctgccgcccccgccgcccccaccctgct
Q9BXH1_BBC3-04          cacga---------------------------------------------
Q9BXH1_BBC3-05          cacga---------------------------------------------
Q9BXH1_BBC3-03          tgcgagcccggcctg------gctgccgcccccgccgcccccaccctgct
B4DQK3_BBC3-01          tgcgagcccggcctg------gctgccgcccccgccgcccccaccctgct
Q9BXH1_BBC3-06          tgcgagcccggcctg------gctgccgcccccgccgcccccaccctgct
A0A0D9S2H2_BBC3-01      tgcgagcccggcctg------gctgccgcccccgccgcccccgccctgct
A0A2K6QZU4_BBC3-01      tgcgagcccggcctg------gctgccacccccgctgcccccgccctgct
                                                                          

G3T2N1_BBC3-01          gctccttccggggcctcggacacagctgtttcccagcccctctccagtct
K7E5Y2_BBC3-01          gccagcgctggcaccctcttccctcctgcccctcgcttacttctgcacgc
K7E5Y2_BBC3-02          gccagcgctggcaccctcttccctcctgcccctcgcttacttctgcacgc
Q99ML1_BBC3-02          gcc--ggccg--------cctacctctgcgcccccaccgctcc---acct
Q80ZG6_BBC3-01          gcc--ggccg--------cctacctctgcgcccccaccgcccc---gcct
M3Y0R3_BBC3-01          ccg--ggccggggcagcagctgtttcccagcccccacctcccccagtctg
F1RM01_BBC3-01          gcc--cgctg--------cctacctctgcgcccccaccgcccc---gccc
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      gcc--cgccg--------cctacctctgcgcccccaccgcccc---gccc
A0A452E3G1_BBC3-01      gcc--cgccg--------cctacctctgcgcccccaccgcccc---gccc
A0A3Q2GWE8_BBC3-01      gcc--cgctg--------cctacctctgcgcccccgccgcccc---gccc
J9NTK9_BBC3-01          gcc--cgctg--------cctacctctgcgcccccaccgcccc---gccc
A0A337SQV0_BBC3-02      gcc--cgccg--------cctacctctgcgcccccaccgcccc---gccc
H0XQ00_BBC3-01          gcc--cgccg--------cctacctctgcgcccccaccgcccc---gccc
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      acc--cgctg--------cctacctctgcgcccccaccgcccc---gccc
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          gcc--cgctg--------cctacctctgcgcccccaccgcccc---accc
A0A2I3RGH5_BBC3-01      gcc--cgctg--------cctacctctgcgcccccaccgcccc---accc
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          gcc--cgctg--------cctacctctgcgcccccaccgcccc---accc
B4DQK3_BBC3-01          gcc--cgctg--------cctacctctgcgcccccaccgcccc---accc
Q9BXH1_BBC3-06          gcc--cgctg--------cctacctctgcgcccccaccgcccc---accc
A0A0D9S2H2_BBC3-01      gcc--cgctg--------cctacctctgcgcccccaccgcccc---accc
A0A2K6QZU4_BBC3-01      gcc--cgctg--------cctacctctgcgcccccaccgcccc---accc
                                                                          

G3T2N1_BBC3-01          gggtctctgatctctcgggactgcagttggagagaggtggggccgagtgg
K7E5Y2_BBC3-01          gacagccccgtgcctatgggggcccccgctgggcacgggcggccaggagc
K7E5Y2_BBC3-02          gacagccccgtgcctatgggggcccccgctgggcacgggcggccaggagc
Q99ML1_BBC3-02          gccgtcaccgccgccctggggggcccccgctggcctgggggtcaccgcag
Q80ZG6_BBC3-01          gccgtcaccgccgccctggggggcccccgctggcctgggggtcaccgcag
M3Y0R3_BBC3-01          ggtctccttaacctcccagaggacgatagttggagggagtgt-----ggg
F1RM01_BBC3-01          gccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcag
A0A337SQV0_BBC3-03      --------cgctgtgtgggggtgactccgtgggtctgtg-----------
A0A3Q1LXZ6_BBC3-01      gccgtcaccgccgccctgggggccccccgctggcctgggggtccccgcag
A0A452E3G1_BBC3-01      gccgtcactgccgccctgggggccccccgctggcctgggggtccccgcag
A0A3Q2GWE8_BBC3-01      gccgtcaccgccgccctggggggcccccgctggcctgggggcccccgcag
J9NTK9_BBC3-01          gccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcag
A0A337SQV0_BBC3-02      gccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcag
H0XQ00_BBC3-01          gccgtcactgccaccctagggggcccccgctggcctgggggtccccgcag
A0A2K6STD6_BBC3-02      -----------------------------------cgtgggtcccct--g
A0A2K5F6X4_BBC3-02      -----------------------------------cgtgggtcccct--g
A0A2R8MW85_BBC3-03      -----------------------------------tgtgggtcccct--g
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      -----------------------------------ggtgggtcctgg--g
A0A2K6FQZ3_BBC3-01      gccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcag
A0A2K6QZU4_BBC3-04      -----------------------------------cgtgggtcccct--g
A0A2K5P2T8_BBC3-03      -----------------------------------cgtgggtcctct--g
A0A2K5V8J3_BBC3-03      -----------------------------------cgtgggtcccct--g
F7FFP6_BBC3-03          -----------------------------------cgtgggtcccct--g
A0A2K6ASP2_BBC3-03      -----------------------------------cgtgggtcccct--g
A0A2I3N2Z9_BBC3-03      -----------------------------------cgtgggtcccct--g
A0A2I3HWI8_BBC3-03      -----------------------------------cgtgggtcccct--g
A0A2R9BZA9_BBC3-01      -----------------------------------cgtgggtcccct--g
A0A2I3RGH5_BBC3-03      -----------------------------------cgtgggtcccct--g
H2NZD3_BBC3-01          gccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcag
A0A2I3RGH5_BBC3-01      gccgtcaccgccgccctggggggtccccgctggcctgggggtccccgcag
Q9BXH1_BBC3-04          -----------------------------------cgtgggtcccct--g
Q9BXH1_BBC3-05          -----------------------------------cgtgggtcccct--g
Q9BXH1_BBC3-03          gccgtcaccgccgccctggggggttcccgctggcctgggggtccccgcag
B4DQK3_BBC3-01          gccgtcaccgccgccctggggggttcccgctggcctgggggtccccgcag
Q9BXH1_BBC3-06          gccgtcaccgccgccctggggggttcccgctggcctgggggtccccgcag
A0A0D9S2H2_BBC3-01      gccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcag
A0A2K6QZU4_BBC3-01      gccgtcaccgccgccctggggggcccccgctggcctgggggtccccgcag
                                                                          

G3T2N1_BBC3-01          gagga---cagggcccctcgtcctctctcaggtcctcagccctcact---
K7E5Y2_BBC3-01          ccggcggccggcaaccagggccaaagc---ggttccctgccctccctggg
K7E5Y2_BBC3-02          ccggcggccggcaaccagggccaaagc---ggttccctgccctccctggg
Q99ML1_BBC3-02          ccggc--ccagaggcccgcgcccggac---ggtcctcagccctccct---
Q80ZG6_BBC3-01          ccggc--cccgaggcccgcgcccggac---ggtcctcagccctcgct---
M3Y0R3_BBC3-01          cagag--cgagaggactgcttttccca---ggtcctcagccctcact---
F1RM01_BBC3-01          ccggc--cccgaggcccgcgccccgac---ggtcctcagccctcact---
A0A337SQV0_BBC3-03      ----------------------tcgcc---tgtcctcagccctcact---
A0A3Q1LXZ6_BBC3-01      ccggc--cccgaggcccgcgacccgac---ggtcctcagccttcact---
A0A452E3G1_BBC3-01      ccggc--cccgaggcccgcgacccgac---ggtcctcagccttcact---
A0A3Q2GWE8_BBC3-01      ccgtc--cccgagccccgcgccccgac---ggtccacagccctcact---
J9NTK9_BBC3-01          ccggc--cccgaggcccgcgccccgac---ggtcctcagccctcact---
A0A337SQV0_BBC3-02      ccggc--cccgagggccgcgccccgac---ggtcctcagccctcact---
H0XQ00_BBC3-01          ccggc--cccgaggcccgcgcctggat---ggtcctcagccatcact---
A0A2K6STD6_BBC3-02      ccaga--tgtg---------------t---ggttctcagccctcgct---
A0A2K5F6X4_BBC3-02      ccaga--tgtg---------------t---ggtcctcagccctcgct---
A0A2R8MW85_BBC3-03      ccaga--tgtg---------------t---ggtcctcagccctcgct---
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      ccata--ttcc---------------t---ggtcctcagccatcact---
A0A2K6FQZ3_BBC3-01      ccgac--cccgaggcccgcgcccggac---ggtcctcagccatcact---
A0A2K6QZU4_BBC3-04      ccaga--tttg---------------t---ggtcctcagccctcgct---
A0A2K5P2T8_BBC3-03      ccaga--tttg---------------t---ggtcctcagccctcgct---
A0A2K5V8J3_BBC3-03      ccaga--tttg---------------t---ggtcctcagccctcgct---
F7FFP6_BBC3-03          ccaga--tttg---------------t---ggtcctcagccctcgct---
A0A2K6ASP2_BBC3-03      ccaga--tttg---------------t---ggtcctcagccctcgct---
A0A2I3N2Z9_BBC3-03      ccaga--tttg---------------t---ggtcctcagccctcgct---
A0A2I3HWI8_BBC3-03      ccaga--tttg---------------------------------------
A0A2R9BZA9_BBC3-01      ccaga--tttg---------------t---ggtcctcagccctcgct---
A0A2I3RGH5_BBC3-03      ccaga--tttg---------------t---ggtcctcagccctcgct---
H2NZD3_BBC3-01          ccggc--cccgaggcccgcgcccggac---ggtcctcagccctcgct---
A0A2I3RGH5_BBC3-01      ccggc--cccgaggcccgcgcccggac---ggtcctcagccctcgct---
Q9BXH1_BBC3-04          ccaga--tttg---------------------------------------
Q9BXH1_BBC3-05          ccaga--tttg---------------t---ggtcctcagccctcgct---
Q9BXH1_BBC3-03          ccggc--cccgaggcccgcgcccggac---ggtcctcagccctcgct---
B4DQK3_BBC3-01          ccggc--cccgaggcccgcgcccggac---ggtcctcagccctcgct---
Q9BXH1_BBC3-06          ccggc--cccgaggcccgcgcccggac---ggtcctcagccctcgct---
A0A0D9S2H2_BBC3-01      ccggc--cccgaggcccacgcccggac---ggtcctcagccctcgct---
A0A2K6QZU4_BBC3-01      ccggc--cccgaggcccacgcccggac---ggtcctcagccctcgct---
                                                                          

G3T2N1_BBC3-01          ---ctcgccggcggagcagcacctggagtcgccggtg-------------
K7E5Y2_BBC3-01          ccccaggtctgcccaggagga----ggggggacaggagggagagccccag
K7E5Y2_BBC3-02          ccccaggtctgcccaggagga----ggggggacaggagggagagccccag
Q99ML1_BBC3-02          ---gtcaccagcccagcagcacttagagtcgcccgtgcccagcgccccgg
Q80ZG6_BBC3-01          ---gtcaccagcccagcagcacctagagtcgcccgtgcccagcgccccgg
M3Y0R3_BBC3-01          ---ctcgccggcggagccgcacctggaatcgccggtgcccagtgccccgg
F1RM01_BBC3-01          ---ctcgccggcggagcagcacctggaatcgccagtgcccagcgctccgg
A0A337SQV0_BBC3-03      ---ctcgccggcagagcagcacctggaatcgccggtgcccagcgccccgg
A0A3Q1LXZ6_BBC3-01      ---ctcgcccgcggagcagcacctggaatcaccagtgcccagcgccccgg
A0A452E3G1_BBC3-01      ---ctcgcccgcggagcagcacctggaatcgccagtgcccagcgccccgg
A0A3Q2GWE8_BBC3-01      ---cttgccggccgagcagcacctggagtcgccggtgcccagcgccccgg
J9NTK9_BBC3-01          ---gtcgccggcggaacagcacctggaatcgccggtgcccagcgccccgg
A0A337SQV0_BBC3-02      ---ctcgccggcagagcagcacctggaatcgccggtgcccagcgccccgg
H0XQ00_BBC3-01          ---cttgccggccgagcagcacctggagtcgcccgttcccagcaccccgg
A0A2K6STD6_BBC3-02      ---ctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
A0A2K5F6X4_BBC3-02      ---ctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
A0A2R8MW85_BBC3-03      ---ctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccag
A0A2K6KS56_BBC3-02      -------ctggcggagc-gcacctggagtcg-cggtgcc---agccccgg
A0A2K6FQZ3_BBC3-04      ---ctcgctggcagagcagcacctggagtcgcccgtccccagcgccccgg
A0A2K6FQZ3_BBC3-01      ---ctcgctggcagagcagcacctggagtcgcccgtccccagcgccccgg
A0A2K6QZU4_BBC3-04      ---ctcgctggcggagcagcacctggagtcgccggtgcccagcgccccgg
A0A2K5P2T8_BBC3-03      ---cttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
A0A2K5V8J3_BBC3-03      ---cttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
F7FFP6_BBC3-03          ---cttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
A0A2K6ASP2_BBC3-03      ---cttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
A0A2I3N2Z9_BBC3-03      ---cttgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      ---ctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
A0A2I3RGH5_BBC3-03      ---ctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
H2NZD3_BBC3-01          ---ctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
A0A2I3RGH5_BBC3-01      ---ctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          ---ctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
Q9BXH1_BBC3-03          ---ctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
B4DQK3_BBC3-01          ---ctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
Q9BXH1_BBC3-06          ---ctcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
A0A0D9S2H2_BBC3-01      ---ttcgctggcggagcagcacctggagtcgcccgtgcccagcgccccgg
A0A2K6QZU4_BBC3-01      ---ctcgctggcggagcagcacctggagtcgccggtgcccagcgccccgg
                                                                          

G3T2N1_BBC3-01          ------------------------cccacgcaggcg---gccccgggggt
K7E5Y2_BBC3-01          ggagcgtcccccatgtctggcggccccccgggggtgttaggcccggagca
K7E5Y2_BBC3-02          ggagcgtcccccatgtctggcggccccccgggggtgttaggcccggagca
Q99ML1_BBC3-02          agg-------ccctggcaggaggccccacccaagct---gccccgggagt
Q80ZG6_BBC3-01          agg-------ccctggcgggaggccccacccaagct---gccccgggagt
M3Y0R3_BBC3-01          ggg-------ccctggcgggcggccccacccaggca---gccccgggagt
F1RM01_BBC3-01          ggg-------ccctggcgggcggccccacccaagca---gccccgggaat
A0A337SQV0_BBC3-03      ggg-------ccctggcgggcggccccacccaggca---gccccgggagt
A0A3Q1LXZ6_BBC3-01      ggg-------ccctggcgggcggccccacccaagcg---gccccgggagt
A0A452E3G1_BBC3-01      ggg-------ccctggcgggcggacccacccaagcg---gccccgggagt
A0A3Q2GWE8_BBC3-01      ggg-------ccctggagggcggccccacccaggca---gccccgggagt
J9NTK9_BBC3-01          ggg-------ccctggcgggcggtcccacccaagca---gccccgggagt
A0A337SQV0_BBC3-02      ggg-------ccctggcgggcggccccacccaggca---gccccgggagt
H0XQ00_BBC3-01          ggg-------ccctggcgggcggtcccacccaggcg---gccccggaggt
A0A2K6STD6_BBC3-02      ggg-------ccctggcgggcggtcccacccaggcg---gccccgggagt
A0A2K5F6X4_BBC3-02      ggg-------ccctggcgggcggtcccacccaggcg---gccccgggagt
A0A2R8MW85_BBC3-03      ggg-------ccctggcgggcggtcccacccaggcg---gcccccggagt
A0A2K6KS56_BBC3-02      gg--------------------------ccctggcg---gccccgggagt
A0A2K6FQZ3_BBC3-04      ggg-------ccctggcgggcggtcccacccaggcg---gccccgggagt
A0A2K6FQZ3_BBC3-01      ggg-------ccctggcgggcggtcccacccaggcg---gccccgggagt
A0A2K6QZU4_BBC3-04      ggg-------ccctggcgggcggtcccacccaggcg---gccccgggagt
A0A2K5P2T8_BBC3-03      ggg-------ccctggcgggcggtcccacccaggcg---gccccgggagt
A0A2K5V8J3_BBC3-03      ggg-------ccctggcgggcggtcccacccaggcg---gccccgggagt
F7FFP6_BBC3-03          ggg-------ccctggcgggcggtcccacccaggcg---gccccgggagt
A0A2K6ASP2_BBC3-03      ggg-------ccctggcgggcggtcccacccaggcg---gccccgggagt
A0A2I3N2Z9_BBC3-03      ggg-------ccctggcgggcggtcccacccaggcg---gccccgggagt
A0A2I3HWI8_BBC3-03      --------------tgcaggcggtcccacccaggcg---gctccgggagt
A0A2R9BZA9_BBC3-01      ggg-------ctctggcgggcggtcccacccaggcg---gccccgggagt
A0A2I3RGH5_BBC3-03      ggg-------ctctggcgggcggtcccacccaggcg---gccccgggagt
H2NZD3_BBC3-01          ggg-------ctctggcgggcggtcccacccaggcg---gccccgggagt
A0A2I3RGH5_BBC3-01      ggg-------ctctggcgggcggtcccacccaggcg---gccccgggagt
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          ggg-------ctctggcgggcggtcccacccaggcg---gccccgggagt
Q9BXH1_BBC3-03          ggg-------ctctggcgggcggtcccacccaggcg---gccccgggagt
B4DQK3_BBC3-01          ggg-------ctctggcgggcggtcccacccaggcg---gccccgggagt
Q9BXH1_BBC3-06          ggg-------ctctggcgggcggtcccacccaggcg---gccccgggagt
A0A0D9S2H2_BBC3-01      ggg-------ccctggcgggcggtcccacccaggcg---gccccgggagt
A0A2K6QZU4_BBC3-01      ggg-------ccctggcgggcggtcccacccaggcg---gccccgggagt
                                                                          

G3T2N1_BBC3-01          ccggggagaggatgagcaatgggcccgagagatcggggcccagtttcggc
K7E5Y2_BBC3-01          cggggaccaaggcgagcagcaggaccgggagatcggcgcccagctgcgca
K7E5Y2_BBC3-02          cggggaccaaggcgagcagcaggaccgggagatcggcgcccagctgcgca
Q99ML1_BBC3-02          gcgtgtggaggaggaggagtgggcccgggagatcggggcccagctgcggc
Q80ZG6_BBC3-01          gcgtgtggaggaggaggagtgggcccgggagatcggggcccagctgcgga
M3Y0R3_BBC3-01          ccggggggaggaggagcagtgggcccgggagatcggggcccagctgcgga
F1RM01_BBC3-01          ccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggc
A0A337SQV0_BBC3-03      ccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggc
A0A3Q1LXZ6_BBC3-01      ccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggc
A0A452E3G1_BBC3-01      ccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggc
A0A3Q2GWE8_BBC3-01      ccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggc
J9NTK9_BBC3-01          ccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggc
A0A337SQV0_BBC3-02      ccggggggaggaggagcagtgggcccgggagatcggggcccagctgcggc
H0XQ00_BBC3-01          ccggggggaggaggagcagtgggccagagagataggggcccagctgcggc
A0A2K6STD6_BBC3-02      ccgcggggaggaggagcagtgggctcgggagatcggggcccagctgcggc
A0A2K5F6X4_BBC3-02      ccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcggc
A0A2R8MW85_BBC3-03      ccgcggggaggaggagcagtgggcccgggagatcggggcccagctgcgac
A0A2K6KS56_BBC3-02      -cgcggggaggaggcgaagtgggcc--gggaatcggggcccagctgcggc
A0A2K6FQZ3_BBC3-04      ccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggc
A0A2K6FQZ3_BBC3-01      ccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggc
A0A2K6QZU4_BBC3-04      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
A0A2K5P2T8_BBC3-03      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
A0A2K5V8J3_BBC3-03      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
F7FFP6_BBC3-03          ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
A0A2K6ASP2_BBC3-03      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
A0A2I3N2Z9_BBC3-03      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
A0A2I3HWI8_BBC3-03      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
A0A2R9BZA9_BBC3-01      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
A0A2I3RGH5_BBC3-03      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
H2NZD3_BBC3-01          ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
A0A2I3RGH5_BBC3-01      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
Q9BXH1_BBC3-04          --------------------------------------------------
Q9BXH1_BBC3-05          ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
Q9BXH1_BBC3-03          ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
B4DQK3_BBC3-01          ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
Q9BXH1_BBC3-06          ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
A0A0D9S2H2_BBC3-01      ccgcggggaggaggaacagtgggcccaggagatcggggcccagctgcggc
A0A2K6QZU4_BBC3-01      ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggc
                                                                          

G3T2N1_BBC3-01          ggaaggcg-gacgacctctatgcgctgtacgagcggtcggtgagacagga
K7E5Y2_BBC3-01          ggatggcc-gatgacctcaacgccctgtacgagcagc---ggagacggga
K7E5Y2_BBC3-02          ggatggcc-gatgacctcaacgccctgtacgagcagc---ggagacggga
Q99ML1_BBC3-02          ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
Q80ZG6_BBC3-01          ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
M3Y0R3_BBC3-01          ggatggcg-gacgacctcaacgcgctgtacgagcggc---ggagacaaga
F1RM01_BBC3-01          ggatggct-gacgatctcaacgcgctgtacgagcggc---ggagacaaga
A0A337SQV0_BBC3-03      ggatggcg-gacgacctcaacgcgctgtacgagcggc---ggagacaaga
A0A3Q1LXZ6_BBC3-01      ggatggcg-gacgacctcaacgcgctatacgagcggc---ggagacaaga
A0A452E3G1_BBC3-01      ggatggcg-gacgacctcaacgcgctatacgagcggc---ggagacaaga
A0A3Q2GWE8_BBC3-01      ggatggcg-gacgacctgaacgcgctgtacgagcggc---ggagacaaga
J9NTK9_BBC3-01          ggatggcg-gacgacctcaacgcgctgtacgagcggc---ggagacaaga
A0A337SQV0_BBC3-02      ggatggcg-gacgacctcaacgcgctgtacgagcggc---ggagacaaga
H0XQ00_BBC3-01          ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
A0A2K6STD6_BBC3-02      ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
A0A2K5F6X4_BBC3-02      ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
A0A2R8MW85_BBC3-03      ggatggcg-gacgacctcaacgcgctgtacgagcggc---ggagacaaga
A0A2K6KS56_BBC3-02      ggatggcgagacga-ctcaacgcgcagtacagacggc---ggagacaaga
A0A2K6FQZ3_BBC3-04      ggatggca-gacgacctcaatgcgcagtacgagcggc---ggagacaaga
A0A2K6FQZ3_BBC3-01      ggatggca-gacgacctcaatgcgcagtacgagcggc---ggagacaaga
A0A2K6QZU4_BBC3-04      ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
A0A2K5P2T8_BBC3-03      ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
A0A2K5V8J3_BBC3-03      ggatggcg-gacgacctcaacgcgcaatacgagcggc---ggagacaaga
F7FFP6_BBC3-03          ggatggcg-gacgacctcaacgcgcaatacgagcggc---ggagacaaga
A0A2K6ASP2_BBC3-03      ggatggcg-gacgacctcaacgcgcaatacgagcggc---ggagacaaga
A0A2I3N2Z9_BBC3-03      ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
A0A2I3HWI8_BBC3-03      ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
A0A2R9BZA9_BBC3-01      ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
A0A2I3RGH5_BBC3-03      ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
H2NZD3_BBC3-01          ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
A0A2I3RGH5_BBC3-01      ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
Q9BXH1_BBC3-04          ----------------------------------------tgagacaaga
Q9BXH1_BBC3-05          ggatggcg-gacgacctcaacgcacagtacgagcggc---ggagacaaga
Q9BXH1_BBC3-03          ggatggcg-gacgacctcaacgcacagtacgagcggc---ggagacaaga
B4DQK3_BBC3-01          ggatggcg-gacgacctcaacgcacagtacgagcggc---ggagacaaga
Q9BXH1_BBC3-06          ggatggcg-gacgacctcaacgcacagtacgagcggc---ggagacaaga
A0A0D9S2H2_BBC3-01      ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
A0A2K6QZU4_BBC3-01      ggatggcg-gacgacctcaacgcgcagtacgagcggc---ggagacaaga
                                                                 *****  **

G3T2N1_BBC3-01          ggagcagcaccggcaccgtccctcgccctggagggtcctgtacaatctca
K7E5Y2_BBC3-01          ggaggagcagaggcgccacctgtcgccctggaggctgctgtacaatctca
K7E5Y2_BBC3-02          ggaggagcagaggcgccacctgtcgccctggaggctgctgtacaatctca
Q99ML1_BBC3-02          agagcagcatcgacaccgaccctcaccctggagggtcatgtacaatctct
Q80ZG6_BBC3-01          agagcaacatcgacaccgaccctcgccctggagggtcatgtataatctct
M3Y0R3_BBC3-01          agagcagcagcgacaccgcccctccccctggagggtcctgtacaatctca
F1RM01_BBC3-01          ggagcagcagcgacaccgcccctcgccctggagggttctgtacaatctca
A0A337SQV0_BBC3-03      ggagcagcagcgacaccgcccctcaccctggagggtcctgtacaatctca
A0A3Q1LXZ6_BBC3-01      ggagcggcagcgacaccgcccctcaccctggagggtcctgtacaatctca
A0A452E3G1_BBC3-01      ggagcggcaacgacaccgcccctcgccctggagggtcctgtacaatctca
A0A3Q2GWE8_BBC3-01      ggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctca
J9NTK9_BBC3-01          ggagcagcagcgacaccgcccctcaccctggagggtcctgtacaatctca
A0A337SQV0_BBC3-02      ggagcagcagcgacaccgcccctcaccctggagggtcctgtacaatctca
H0XQ00_BBC3-01          ggagcagcagcgacaccgcccctcaccctggagagtcctgtacaatctca
A0A2K6STD6_BBC3-02      agagcagccgcaacaccgcccctcaccctggagggtcctgtacaatctca
A0A2K5F6X4_BBC3-02      ggagcagccgcagcaccgcccctcaccctggagggtcctgtacaatctca
A0A2R8MW85_BBC3-03      ggagcagccgcagcaccgcccctcgccctggagggtcctgtacaatctca
A0A2K6KS56_BBC3-02      ggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctca
A0A2K6FQZ3_BBC3-04      ggagcagcagagacaccgcccctcaccctggagggtcctgtacaatctca
A0A2K6FQZ3_BBC3-01      ggagcagcagagacaccgcccctcaccctggagggtcctgtacaatctca
A0A2K6QZU4_BBC3-04      ggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctca
A0A2K5P2T8_BBC3-03      ggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctca
A0A2K5V8J3_BBC3-03      ggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctca
F7FFP6_BBC3-03          ggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctca
A0A2K6ASP2_BBC3-03      ggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctca
A0A2I3N2Z9_BBC3-03      ggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctca
A0A2I3HWI8_BBC3-03      ggagcaacagcggcaccgcccctcgccctggagggtcctgtacaatctca
A0A2R9BZA9_BBC3-01      ggagcagcagcggcaccgcccctcgccctggagggtcctgtacaatctca
A0A2I3RGH5_BBC3-03      ggagcagcagcggcaccgcccctcgccctggagggtcctgtacaatctca
H2NZD3_BBC3-01          ggagcagcagcggcaccgcccctcgccctggagggtcctgtacaatctca
A0A2I3RGH5_BBC3-01      ggagcagcagcggcaccgcccctcgccctggagggtcctgtacaatctca
Q9BXH1_BBC3-04          ggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctca
Q9BXH1_BBC3-05          ggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctca
Q9BXH1_BBC3-03          ggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctca
B4DQK3_BBC3-01          ggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctca
Q9BXH1_BBC3-06          ggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctca
A0A0D9S2H2_BBC3-01      ggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctca
A0A2K6QZU4_BBC3-01      ggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctca
                         ***   *     * **  *  ** ********  *  **** ****** 

G3T2N1_BBC3-01          tcatgggactactgcccttaccaagggaccatggcgcccccgagatggag
K7E5Y2_BBC3-01          tctcggggctcctggccccccagcgaaggaaccggatgccggacgtggag
K7E5Y2_BBC3-02          tctcggggctcctggccccccagcgaaggaaccggatgccggacgtggag
Q99ML1_BBC3-02          tcatgggactcctccccttacccagggatcctggagccccagaaatggag
Q80ZG6_BBC3-01          tcatgggactcctccccttacccagggatcctggagccccagaaatggag
M3Y0R3_BBC3-01          tcatgggactcctgcccttacccaggggccgtggagccccagagatggag
F1RM01_BBC3-01          tcatgggacttctgcccttacccaggggccgtggagcccccgagatggag
A0A337SQV0_BBC3-03      tcatgggactcctgcccttacccagggcccgcggggccccggagatggag
A0A3Q1LXZ6_BBC3-01      tcatgggactcctgccctttcccgggggccgcggagcccccgaggtggag
A0A452E3G1_BBC3-01      tcttgggactcctgcccttccccgggggccgcggagcccccgaggtggag
A0A3Q2GWE8_BBC3-01      tcatgggactcctgcccctacccaggggccgagcggccccggagatggag
J9NTK9_BBC3-01          tcatgggactcctgcccttacccaggggccgtggagccccggagatggag
A0A337SQV0_BBC3-02      tcatgggactcctgcccttacccagggcccgcggggccccggagatggag
H0XQ00_BBC3-01          tcatgggactcctgcccttacccaggggccacagagcccctgagatggag
A0A2K6STD6_BBC3-02      tcatgggactcctgccctttcccaggggccacagagccccagagatggag
A0A2K5F6X4_BBC3-02      tcatgggactcctgccctttcccaggggccacagagcccccgagatggag
A0A2R8MW85_BBC3-03      tcatgggactcctgccctttcccaggggccacagagccccggagatggag
A0A2K6KS56_BBC3-02      ttatgggactcctgcccttacccaggggccacagagcccccgaaatggag
A0A2K6FQZ3_BBC3-04      tcatgggactcctgcccttacccaggggccacagagcccctgagatggag
A0A2K6FQZ3_BBC3-01      tcatgggactcctgcccttacccaggggccacagagcccctgagatggag
A0A2K6QZU4_BBC3-04      ttatgggactcctgcccttacccaggggccacagagcccccgaaatggag
A0A2K5P2T8_BBC3-03      tcatgggactcctgcccttacccaggggccacagagcccccgaaatggag
A0A2K5V8J3_BBC3-03      tcatgggactcctgcccttacccaggggccacagagcccccgaaatggag
F7FFP6_BBC3-03          tcatgggactcctgcccttacccaggggccacagagcccccgaaatggag
A0A2K6ASP2_BBC3-03      tcatgggactcctgcccttacccaggggccacagagcccccgaaatggag
A0A2I3N2Z9_BBC3-03      tcatgggactcctgcccttacccaggggccacagagcccccgaaatggag
A0A2I3HWI8_BBC3-03      tcatgggactcctgcccttacccaggggccacagagcccccgagatggag
A0A2R9BZA9_BBC3-01      tcatgggactcctgcccttacccaggggccacagagcccccgagatggag
A0A2I3RGH5_BBC3-03      tcatgggactcctgcccttacccaggggccacagagcccccgagatggag
H2NZD3_BBC3-01          tcatgggactcctgcccttacccaggggccacagagcccccgagatggag
A0A2I3RGH5_BBC3-01      tcatgggactcctgcccttacccaggggccacagagcccccgagatggag
Q9BXH1_BBC3-04          tcatgggactcctgcccttacccaggggccacagagcccccgagatggag
Q9BXH1_BBC3-05          tcatgggactcctgcccttacccaggggccacagagcccccgagatggag
Q9BXH1_BBC3-03          tcatgggactcctgcccttacccaggggccacagagcccccgagatggag
B4DQK3_BBC3-01          tcatgggactcctgcccttacccaggggccacagagcccccgagatggag
Q9BXH1_BBC3-06          tcatgggactcctgcccttacccaggggccacagagcccccgagatggag
A0A0D9S2H2_BBC3-01      tcatgggactcctgcccttacccaggggccacagagcccccgaaatggag
A0A2K6QZU4_BBC3-01      ttatgggactcctgcccttacccaggggccacagagcccccgaaatggag
                        *   *** ** **  **   *   *             ** **  *****

G3T2N1_BBC3-01          cccaattag-----------------------------------------
K7E5Y2_BBC3-01          cccaactag-----------------------------------------
K7E5Y2_BBC3-02          cccaactag-----------------------------------------
Q99ML1_BBC3-02          cccaactag-----------------------------------------
Q80ZG6_BBC3-01          cccaactag-----------------------------------------
M3Y0R3_BBC3-01          cccaattag-----------------------------------------
F1RM01_BBC3-01          cctaattag-----------------------------------------
A0A337SQV0_BBC3-03      cccaattag-----------------------------------------
A0A3Q1LXZ6_BBC3-01      cccaattag-----------------------------------------
A0A452E3G1_BBC3-01      cccaattag-----------------------------------------
A0A3Q2GWE8_BBC3-01      cccaactag-----------------------------------------
J9NTK9_BBC3-01          cccaattag-----------------------------------------
A0A337SQV0_BBC3-02      cccaattag-----------------------------------------
H0XQ00_BBC3-01          cccaattag-----------------------------------------
A0A2K6STD6_BBC3-02      cccaattag-----------------------------------------
A0A2K5F6X4_BBC3-02      cccaattag-----------------------------------------
A0A2R8MW85_BBC3-03      cccaattag-----------------------------------------
A0A2K6KS56_BBC3-02      cccaattag-----------------------------------------
A0A2K6FQZ3_BBC3-04      cccaattag-----------------------------------------
A0A2K6FQZ3_BBC3-01      cccaattag-----------------------------------------
A0A2K6QZU4_BBC3-04      cccaattag-----------------------------------------
A0A2K5P2T8_BBC3-03      cccaattag-----------------------------------------
A0A2K5V8J3_BBC3-03      cccaattag-----------------------------------------
F7FFP6_BBC3-03          cccaattag-----------------------------------------
A0A2K6ASP2_BBC3-03      cccaattag-----------------------------------------
A0A2I3N2Z9_BBC3-03      cccaattag-----------------------------------------
A0A2I3HWI8_BBC3-03      cccaattag-----------------------------------------
A0A2R9BZA9_BBC3-01      cccaattag-----------------------------------------
A0A2I3RGH5_BBC3-03      cccaattag-----------------------------------------
H2NZD3_BBC3-01          cccaattag-----------------------------------------
A0A2I3RGH5_BBC3-01      cccaattag-----------------------------------------
Q9BXH1_BBC3-04          cccaattaggtgcctgcacccgcccggtggacgtcagggactcggggggc
Q9BXH1_BBC3-05          cccaattag-----------------------------------------
Q9BXH1_BBC3-03          cccaattaggtgcctgcacccgcccggtggacgtcagggactcggggggc
B4DQK3_BBC3-01          cccaattag-----------------------------------------
Q9BXH1_BBC3-06          cccaattag-----------------------------------------
A0A0D9S2H2_BBC3-01      cccaattag-----------------------------------------
A0A2K6QZU4_BBC3-01      cccaattag-----------------------------------------
                        ** ** ***                                         

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-03      --------------------------------------------------
A0A3Q1LXZ6_BBC3-01      --------------------------------------------------
A0A452E3G1_BBC3-01      --------------------------------------------------
A0A3Q2GWE8_BBC3-01      --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
A0A337SQV0_BBC3-02      --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
A0A2I3RGH5_BBC3-01      --------------------------------------------------
Q9BXH1_BBC3-04          aggcccctcccacctcctgacaccctggccagcgcgggggactttctctg
Q9BXH1_BBC3-05          --------------------------------------------------
Q9BXH1_BBC3-03          aggcccctcccacctcctgacaccctggccagcgcgggggactttctctg
B4DQK3_BBC3-01          --------------------------------------------------
Q9BXH1_BBC3-06          --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          ----------
K7E5Y2_BBC3-01          ----------
K7E5Y2_BBC3-02          ----------
Q99ML1_BBC3-02          ----------
Q80ZG6_BBC3-01          ----------
M3Y0R3_BBC3-01          ----------
F1RM01_BBC3-01          ----------
A0A337SQV0_BBC3-03      ----------
A0A3Q1LXZ6_BBC3-01      ----------
A0A452E3G1_BBC3-01      ----------
A0A3Q2GWE8_BBC3-01      ----------
J9NTK9_BBC3-01          ----------
A0A337SQV0_BBC3-02      ----------
H0XQ00_BBC3-01          ----------
A0A2K6STD6_BBC3-02      ----------
A0A2K5F6X4_BBC3-02      ----------
A0A2R8MW85_BBC3-03      ----------
A0A2K6KS56_BBC3-02      ----------
A0A2K6FQZ3_BBC3-04      ----------
A0A2K6FQZ3_BBC3-01      ----------
A0A2K6QZU4_BBC3-04      ----------
A0A2K5P2T8_BBC3-03      ----------
A0A2K5V8J3_BBC3-03      ----------
F7FFP6_BBC3-03          ----------
A0A2K6ASP2_BBC3-03      ----------
A0A2I3N2Z9_BBC3-03      ----------
A0A2I3HWI8_BBC3-03      ----------
A0A2R9BZA9_BBC3-01      ----------
A0A2I3RGH5_BBC3-03      ----------
H2NZD3_BBC3-01          ----------
A0A2I3RGH5_BBC3-01      ----------
Q9BXH1_BBC3-04          caccatgtag
Q9BXH1_BBC3-05          ----------
Q9BXH1_BBC3-03          caccatgtag
B4DQK3_BBC3-01          ----------
Q9BXH1_BBC3-06          ----------
A0A0D9S2H2_BBC3-01      ----------
A0A2K6QZU4_BBC3-01      ----------
                                  

© 1998-2019