Dataset for CDS BBC3 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

33 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gttaggttgggggaggctccggggaagcccctctcgccaggttgcggcag
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          ------caggccccagggagcgcc--------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      atgaaatttggcatggggtctgcc--------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      ataaaatttggcgtggggtctgcc--------------------------
A0A2K5P2T8_BBC3-03      ataaaatttggcgtggggtctgcc--------------------------
A0A2K5V8J3_BBC3-03      ataaaatttggcgtggggtctgcc--------------------------
F7FFP6_BBC3-03          ataaaatttggcgtggggtctgcc--------------------------
A0A2K6ASP2_BBC3-03      ataaaatttggcgtggggtctgcc--------------------------
A0A2I3N2Z9_BBC3-03      ataaaatttggcgtggggtctgcc--------------------------
A0A2I3HWI8_BBC3-03      atgaaatttggcatggggtctgcc--------------------------
A0A2R9BZA9_BBC3-01      atgaaatttggcatggggtctgcc--------------------------
A0A2I3RGH5_BBC3-03      atgaaatttggcatggggtctgcc--------------------------
A0A2K6FQZ3_BBC3-04      atgaaatttggtgcggggtctgcc--------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          ------atggccccagggagcgcc--------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      ------caggccccagggagcgcc--------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      atgaaatgtggcatggggtctgcc--------------------------
A0A2K5F6X4_BBC3-02      ---aaatgtggcgtggggtctgcc--------------------------
A0A2R8MW85_BBC3-03      atgaaatgtggcgtggggtctgcc--------------------------
A0A2R8MW85_BBC3-01      atgaaatgtggcgtggggtctgcc--------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          cggccagcggggtccgggcggggcggggtcgggcggggcggggcggggcg
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gtgggagccgcagcaggcgccgcagcctcagcagcccggcgctggcaagt
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          cccaactgcctcggcgcagacggctgcaggagggcgggagcggggggcgg
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gagcggggcggggcggtcggtgacgtcacgcgggagccggggcgcgcggc
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          tgcagcgcgaggcggcggcggcggcggccgcggcagaaccagcctgggag
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          ccggcggcgcaagacacatgcgtgcggcccgcgggagccacagcaggagc
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gggagcgggagcagtggcgagcggcggcggcgacagaggtggcggcagca
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gcagcagcagcagcagcagcagcagcagcagcagcagcagaggcagcagc
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          agaggcagcggtggagagcaggcagcgcggagccaggcgcccccgggccg
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gcccggaccccgcctgacagcccctcaggcccgcccccgaaggcgcgttc
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          atgcccccggggggctcggcgtgggcctccgcagtggtgagtgtgcgccg
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          cggctgggggtgcgcgtgccgtgccgtgagcgggggccgctgtcaccgcg
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          ctgctgctgccgctgtgagtgcggggccggactggggaaactgaggcggg
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          gccgggcccgaggggtggcaccgccgctcacctgctccgcccacctgtct
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      --------------------------------------------------
                                                                          

G3T2N1_BBC3-01          ---------------------------------atggcccgcgcacgcca
K7E5Y2_BBC3-01          gtgtccctccgcaggctccctccccactggggcatggccagagcccagca
K7E5Y2_BBC3-02          ---------------------------------atggccagagcccagca
M3Y0R3_BBC3-01          ---------------------------------atggcccgagcacgcca
A0A1U7R5N5_BBC3-01      ---------------------------------atggcccgcgcacgcca
Q99ML1_BBC3-02          ---------------------------------atggcccgcgcacgcca
Q80ZG6_BBC3-01          ---------------------------------atggcccgcgcacgcca
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          ---------------------------------atggcccgagcacgcca
F1RM01_BBC3-01          ---------------------------------atggcccgagcacgcca
H0XQ00_BBC3-01          ---------------------------------atggcccgcgcacgcca
A0A2R9BZA9_BBC3-02      ---------------------------------caggcatgtccatgcca
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      ---------------------------------cgggcatgtccatgcca
A0A2K5P2T8_BBC3-03      ---------------------------------cgggcatgtccatgcca
A0A2K5V8J3_BBC3-03      ---------------------------------cgggcatgtccatgcca
F7FFP6_BBC3-03          ---------------------------------cgggcatgtccatgcca
A0A2K6ASP2_BBC3-03      ---------------------------------cgggcatgtccatgcca
A0A2I3N2Z9_BBC3-03      ---------------------------------cgggcatgtccatgcca
A0A2I3HWI8_BBC3-03      ---------------------------------cgggcatgtccatgcca
A0A2R9BZA9_BBC3-01      ---------------------------------caggcatgtccatgcca
A0A2I3RGH5_BBC3-03      ---------------------------------caggcatgtccatgcca
A0A2K6FQZ3_BBC3-04      ---------------------------------cgggcatgtccctgcca
A0A2K6FQZ3_BBC3-01      ---------------------------------atggcccgcgcacgcca
H2NZD3_BBC3-01          ---------------------------------atggcccgcgcacggca
B4DQK3_BBC3-01          ---------------------------------atggcccgcgcacgcca
A0A2I3RIG5_BBC3-02      ---------------------------------atggcccgcgcacgcca
A0A0D9S2H2_BBC3-01      ---------------------------------atggcccgcgcacgcca
A0A2K6QZU4_BBC3-01      ---------------------------------atggcccgcgcacgcca
A0A2K6STD6_BBC3-02      ---------------------------------tgggcatgtccatgcca
A0A2K5F6X4_BBC3-02      ---------------------------------tgggcatgtccatgcca
A0A2R8MW85_BBC3-03      ---------------------------------tgggcatgtccatgcca
A0A2R8MW85_BBC3-01      ---------------------------------tgggcatgtccatgcca
                                                                          

G3T2N1_BBC3-01          gg-----agggcagctccc------ccgagcccgtagagggtctgg----
K7E5Y2_BBC3-01          gg-----atggcagctctc------cggagccggtggaggggctgc----
K7E5Y2_BBC3-02          gg-----atggcagctctc------cggagccggtggaggggctgc----
M3Y0R3_BBC3-01          gg-----agggcagctccc------cggagcccgtagagggcctgt----
A0A1U7R5N5_BBC3-01      gg-----agggcagctctc------cggagcccgtagagggcttgg----
Q99ML1_BBC3-02          gg-----agggcagctctc------cggagcccgtagagggtctag----
Q80ZG6_BBC3-01          gg-----agggcagctctc------cggagcccgtagagggcctag----
F7CQN5_BBC3-01          -----gctggacaaagttctcg---------ccctcgcggccctgc----
J9NTK9_BBC3-01          gg-----agggcagctccc------cggagcccgtagagggcctgg----
F1RM01_BBC3-01          gg-----agggcagctccc------cggagcccgtagagggcctgg----
H0XQ00_BBC3-01          ag-----agggcagctccc------cggagcccgtagagggcctgg----
A0A2R9BZA9_BBC3-02      ggtgcccagggctgcttccgtgacgtgggtcccctgccagatttgt----
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      ggtgcccagggcttcttctgcgacgtgggtcccctgccagatttgt----
A0A2K5P2T8_BBC3-03      ggtgcccagggctgcttctgcgacgtgggtcctctgccagatttgt----
A0A2K5V8J3_BBC3-03      ggtgcccagggcttcttctgcgacgtgggtcccctgccagatttgt----
F7FFP6_BBC3-03          ggtgcccagggcttcttctgcgacgtgggtcccctgccagatttgt----
A0A2K6ASP2_BBC3-03      ggtgcccagggcttcttctgcgacgtgggtcccctgccagatttgt----
A0A2I3N2Z9_BBC3-03      ggtgcccagggcttcttctgcgacgtgggtcccctgccagatttgt----
A0A2I3HWI8_BBC3-03      ggtgcccagggcttcttccgtgacgtgggtcccctgccagatttgt----
A0A2R9BZA9_BBC3-01      ggtgcccagggctgcttccgtgacgtgggtcccctgccagatttgt----
A0A2I3RGH5_BBC3-03      ggtgcccagggctgcttccgcgacgtgggtcccctgccagatttgt----
A0A2K6FQZ3_BBC3-04      ggtgcccgggacttccttctcatggtgggtcctgggccatattcct----
A0A2K6FQZ3_BBC3-01      gg-----agggcagctccc------cggagcccgtagagggcctgg----
H2NZD3_BBC3-01          gg-----agggcagctccc------cggagcccgtagagggcctgg----
B4DQK3_BBC3-01          gg-----agggcagctccc------cggagcccgtagagggcctgg----
A0A2I3RIG5_BBC3-02      gg-----agggcagctccc------cggagcccgtagagggcctgg----
A0A0D9S2H2_BBC3-01      gg-----agggcagctccc------cggagcccgtagagggcctgg----
A0A2K6QZU4_BBC3-01      gg-----agggcagctccc------cggagcccgtagagggcctgg----
A0A2K6STD6_BBC3-02      agtgcccagggcttcttccttgacgtgggtcccctgccagatgtgt----
A0A2K5F6X4_BBC3-02      agtgcctagggcttcttcctcgacgtgggtcccctgccagatgtgt----
A0A2R8MW85_BBC3-03      agtgcccagggcttcttcctcggtgtgggtcccctgccagatgtgt----
A0A2R8MW85_BBC3-01      agtgcccagggcttcttcctcggtgtgggtcccctgccagatgtgtggcc
                                                                          

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      ccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcc
                                                                          

G3T2N1_BBC3-01          --------------cccgcgagagcccgcgccccttcccactcggcagcc
K7E5Y2_BBC3-01          --------------cccgggagagccccaggaccttccccctgggccggc
K7E5Y2_BBC3-02          --------------cccgggagagccccaggaccttccccctgggccggc
M3Y0R3_BBC3-01          --------------cccgcgacggcccgcgcccctttcccctcagccgcc
A0A1U7R5N5_BBC3-01      --------------cccgcgacagtccgcgccccttcccgctcggccgcc
Q99ML1_BBC3-02          --------------cccgcgacagtccgcgccccttcccgctcggccgcc
Q80ZG6_BBC3-01          --------------cccgcgacagcccgcgtcctttcccgctcggccgcc
F7CQN5_BBC3-01          --------------accgcga-----------------------------
J9NTK9_BBC3-01          --------------cccgcgacggtccgcgcccgtttcccctcagccgcc
F1RM01_BBC3-01          --------------cccgcgacggcccgcgtcccttccccctcagccgcc
H0XQ00_BBC3-01          --------------ctcgcgacggtccgcgccccttcccgctcggccgcc
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------cccgcgacggcccgcgccccttcccgctcggccgcc
H2NZD3_BBC3-01          --------------cccgcgacggcccgcgccccttcccgctcggccgcc
B4DQK3_BBC3-01          --------------cccgcgacggcccgcgccccttcccgctcggccgcc
A0A2I3RIG5_BBC3-02      --------------cccgcgacggcccgcgccccttcccgctcggccgcc
A0A0D9S2H2_BBC3-01      --------------cccgcgacggcccgcgccccttcccgctcggccgcc
A0A2K6QZU4_BBC3-01      --------------cccgcgacggcccgcgccccttcccgctcggccgcc
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      cgtagagggcttggcccgcgacggcccgcgccccttcccgcttggccgcc
                                                                          

G3T2N1_BBC3-01          tggtgccctcggccgtgtcctgtggcctctgcgagcccggcct-------
K7E5Y2_BBC3-01          tcatgccctctgcggtctcctgcagcctctgtgaggccggcttgaacccc
K7E5Y2_BBC3-02          tcatgccctctgcggtctcctgcagcctctgtgaggccggcttgaacccc
M3Y0R3_BBC3-01          tggtgccctcggccgtgtcctgtggcctctgggaatctgactgc------
A0A1U7R5N5_BBC3-01      tggtgccctccgctgtgtcctgcggcctctgcgagcccggcctg------
Q99ML1_BBC3-02          tgatgccctccgctgtatcctgcagcctttgcgagcccggcctg------
Q80ZG6_BBC3-01          tgatgccctccgctgtatcctgcggcctctgcgagcccggcctg------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          tggtgccctcggccgtgtcctgcggcctctgcgagcccggcctg------
F1RM01_BBC3-01          tggtgccctccgccgtgtcctgcggcctctgcgaacccggtctg------
H0XQ00_BBC3-01          tagtgccctcggccgtgtcctgcggcctctgcgagcccggcctg------
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      tggtgccctcggccgtgtcctgcggcctctgcgagcccggcctg------
H2NZD3_BBC3-01          tggtgccctcggcagtgtcctgcggcctctgcgagcccggcctg------
B4DQK3_BBC3-01          tggtgccctcggcagtgtcctgcggcctctgcgagcccggcctg------
A0A2I3RIG5_BBC3-02      tggtgccctcggcagtgtcctgcggcctctgcgagcccggcctg------
A0A0D9S2H2_BBC3-01      tggtgccctcggcagtgtcctgcggcctctgcgagcccggcctg------
A0A2K6QZU4_BBC3-01      tggtgccctcggcagtgtcctgcggcctctgcgagcccggcctg------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      tggtgccctcggccgtgtcctgcggcctctgcgagtccggcctg------
                                                                          

G3T2N1_BBC3-01          tcctcgagttgcagggccacggctccttccggggcctcggacacagctgt
K7E5Y2_BBC3-01          tctggcgactccatgtgcccagccccggggccagcgctggcaccctcttc
K7E5Y2_BBC3-02          tctggcgactccatgtgcccagccccggggccagcgctggcaccctcttc
M3Y0R3_BBC3-01          agtccccgagttgcagcccacggccttttccgggccggggcagcagctgt
A0A1U7R5N5_BBC3-01      cccgccgcccctgctgcccccgccctgctgccggccg--------cctac
Q99ML1_BBC3-02          cccgccgcccctgctgcccctgccttgctgccggccg--------cctac
Q80ZG6_BBC3-01          cccgctgcccctgctgcccctgccttgctgccggccg--------cctac
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          cccgccgcccctgctgcccctgccctgctgcccgctg--------cctac
F1RM01_BBC3-01          cctgccgcccccgccgcccccaccctgctgcccgctg--------cctac
H0XQ00_BBC3-01          cccgccgcccctgccgccccggctctgctgcccgccg--------cctac
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      cccgctgcccccgccgcccccgccctgctacccgctg--------cctac
H2NZD3_BBC3-01          gccgccgcccccgccgcccccgccctgctgcccgctg--------cctac
B4DQK3_BBC3-01          gctgccgcccccgccgcccccaccctgctgcccgctg--------cctac
A0A2I3RIG5_BBC3-02      gctgccgcccccgccgcccccaccctgctgcccgctg--------cctac
A0A0D9S2H2_BBC3-01      gctgccgcccccgccgcccccgccctgctgcccgctg--------cctac
A0A2K6QZU4_BBC3-01      gctgccacccccgctgcccccgccctgctgcccgctg--------cctac
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      cccgccacccccgccgcccccgccttgctgcccgctg--------cctac
                                                                          

G3T2N1_BBC3-01          ttcccagcccctc----------tccagtctgggtctctgatctctcggg
K7E5Y2_BBC3-01          cctcctgcccctcgcttacttctgcacgcgacagccccgtgcctatgggg
K7E5Y2_BBC3-02          cctcctgcccctcgcttacttctgcacgcgacagccccgtgcctatgggg
M3Y0R3_BBC3-01          ttcccagcccccacctcccccagtctgggtctccttaa-cctcccagagg
A0A1U7R5N5_BBC3-01      ctctgcgcccccaccgcccc---gcccgccgtcaccgc-cgccctggggg
Q99ML1_BBC3-02          ctctgcgcccccaccgctcc---acctgccgtcaccgc-cgccctggggg
Q80ZG6_BBC3-01          ctctgcgcccccaccgcccc---gcctgccgtcaccgc-cgccctggggg
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          ctctgcgcccccaccgcccc---gcccgccgtcaccgc-cgccctggggg
F1RM01_BBC3-01          ctctgcgcccccaccgcccc---gcccgccgtcaccgc-cgccctggggg
H0XQ00_BBC3-01          ctctgcgcccccaccgcccc---gcccgccgtcactgc-caccctagggg
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      ctctgcgcccccaccgcccc---gcccgccgtcaccgc-cgccctggggg
H2NZD3_BBC3-01          ctctgcgcccccaccgcccc---acccgccgtcaccgc-cgccctggggg
B4DQK3_BBC3-01          ctctgcgcccccaccgcccc---acccgccgtcaccgc-cgccctggggg
A0A2I3RIG5_BBC3-02      ctctgcgcccccaccgcccc---acccgccgtcaccgc-cgccctggggg
A0A0D9S2H2_BBC3-01      ctctgcgcccccaccgcccc---acccgccgtcaccgc-cgccctggggg
A0A2K6QZU4_BBC3-01      ctctgcgcccccaccgcccc---acccgccgtcaccgc-cgccctggggg
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      ctctgcgcccccgccgcccc---acccgccgtcaccgc-cgccctggggg
                                                                          

G3T2N1_BBC3-01          actgcagttggagagaggtggggccgagtg-ggaggacagggcccctcgt
K7E5Y2_BBC3-01          gcccccgctgggcacgggcggccaggagcccggcggccggcaaccagggc
K7E5Y2_BBC3-02          gcccccgctgggcacgggcggccaggagcccggcggccggcaaccagggc
M3Y0R3_BBC3-01          acgatagttggagggagtgt-----gggca---gagcgagaggactgctt
A0A1U7R5N5_BBC3-01      gcccccgctggcctgggggtccccgcagcc---gaccccgaggcccacgc
Q99ML1_BBC3-02          gcccccgctggcctgggggtcaccgcagcc---ggcccagaggcccgcgc
Q80ZG6_BBC3-01          gcccccgctggcctgggggtcaccgcagcc---ggccccgaggcccgcgc
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          gcccccgctggcctgggggtccccgcagcc---ggccccgaggcccgcgc
F1RM01_BBC3-01          gcccccgctggcctgggggtccccgcagcc---ggccccgaggcccgcgc
H0XQ00_BBC3-01          gcccccgctggcctgggggtccccgcagcc---ggccccgaggcccgcgc
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      gcccccgctggcctgggggtccccgcagcc---gaccccgaggcccgcgc
H2NZD3_BBC3-01          gcccccgctggcctgggggtccccgcagcc---ggccccgaggcccgcgc
B4DQK3_BBC3-01          gttcccgctggcctgggggtccccgcagcc---ggccccgaggcccgcgc
A0A2I3RIG5_BBC3-02      gtccccgctggcctgggggtccccgcagcc---ggccccgaggcccgcgc
A0A0D9S2H2_BBC3-01      gcccccgctggcctgggggtccccgcagcc---ggccccgaggcccacgc
A0A2K6QZU4_BBC3-01      gcccccgctggcctgggggtccccgcagcc---ggccccgaggcccacgc
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      gcccccgctggcctgggggcccccgcagcc---gcccccgaggcccgcgc
                                                                          

G3T2N1_BBC3-01          cctctctcaggtcctcagccctcact------ctcgccggcggagcagca
K7E5Y2_BBC3-01          caaagc---ggttccctgccctccctgggccccaggtctgcccaggagga
K7E5Y2_BBC3-02          caaagc---ggttccctgccctccctgggccccaggtctgcccaggagga
M3Y0R3_BBC3-01          ttccca---ggtcctcagccctcact------ctcgccggcggagccgca
A0A1U7R5N5_BBC3-01      ccggac---ggtcctcagccctcgct------gtcaccggcccagcagca
Q99ML1_BBC3-02          ccggac---ggtcctcagccctccct------gtcaccagcccagcagca
Q80ZG6_BBC3-01          ccggac---ggtcctcagccctcgct------gtcaccagcccagcagca
F7CQN5_BBC3-01          ---------ggtccacagccctcact------cttgccggccgagcagca
J9NTK9_BBC3-01          cccgac---ggtcctcagccctcact------gtcgccggcggaacagca
F1RM01_BBC3-01          cccgac---ggtcctcagccctcact------ctcgccggcggagcagca
H0XQ00_BBC3-01          ctggat---ggtcctcagccatcact------cttgccggccgagcagca
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      ------------------------------------ctggcggagc-gca
A0A2K6QZU4_BBC3-04      ---------ggtcctcagccctcgct------ctcgctggcggagcagca
A0A2K5P2T8_BBC3-03      ---------ggtcctcagccctcgct------cttgctggcggagcagca
A0A2K5V8J3_BBC3-03      ---------ggtcctcagccctcgct------cttgctggcggagcagca
F7FFP6_BBC3-03          ---------ggtcctcagccctcgct------cttgctggcggagcagca
A0A2K6ASP2_BBC3-03      ---------ggtcctcagccctcgct------cttgctggcggagcagca
A0A2I3N2Z9_BBC3-03      ---------ggtcctcagccctcgct------cttgctggcggagcagca
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      ---------ggtcctcagccctcgct------ctcgctggcggagcagca
A0A2I3RGH5_BBC3-03      ---------ggtcctcagccctcgct------ctcgctggcggagcagca
A0A2K6FQZ3_BBC3-04      ---------ggtcctcagccatcact------ctcgctggcagagcagca
A0A2K6FQZ3_BBC3-01      ccggac---ggtcctcagccatcact------ctcgctggcagagcagca
H2NZD3_BBC3-01          ccggac---ggtcctcagccctcgct------ctcgctggcggagcagca
B4DQK3_BBC3-01          ccggac---ggtcctcagccctcgct------ctcgctggcggagcagca
A0A2I3RIG5_BBC3-02      ccggac---ggtcctcagccctcgct------ctcgctggcggagcagca
A0A0D9S2H2_BBC3-01      ccggac---ggtcctcagccctcgct------ttcgctggcggagcagca
A0A2K6QZU4_BBC3-01      ccggac---ggtcctcagccctcgct------ctcgctggcggagcagca
A0A2K6STD6_BBC3-02      ---------ggttctcagccctcgct------ctcgctggcggagcagca
A0A2K5F6X4_BBC3-02      ---------ggtcctcagccctcgct------ctcgctggcggagcagca
A0A2R8MW85_BBC3-03      ---------ggtcctcagccctcgct------ctcgctggcggagcagca
A0A2R8MW85_BBC3-01      ccggac---ggtcctcagccctcgct------ctcgctggcggagcagca
                                                                          

G3T2N1_BBC3-01          cctggagtcgccggtg----------------------------------
K7E5Y2_BBC3-01          ----ggggggacaggagggagagccccagggagcgtcccccatgtctggc
K7E5Y2_BBC3-02          ----ggggggacaggagggagagccccagggagcgtcccccatgtctggc
M3Y0R3_BBC3-01          cctggaatcgccggtgcccagtgccccggggg-------ccctggcgggc
A0A1U7R5N5_BBC3-01      cctagagtcgcccgtgcccagcgccccggagg-------ccctggcgggc
Q99ML1_BBC3-02          cttagagtcgcccgtgcccagcgccccggagg-------ccctggcagga
Q80ZG6_BBC3-01          cctagagtcgcccgtgcccagcgccccggagg-------ccctggcggga
F7CQN5_BBC3-01          cctggagtcgccggtgcccagcgccccggggg-------ccctggagggc
J9NTK9_BBC3-01          cctggaatcgccggtgcccagcgccccggggg-------ccctggcgggc
F1RM01_BBC3-01          cctggaatcgccagtgcccagcgctccggggg-------ccctggcgggc
H0XQ00_BBC3-01          cctggagtcgcccgttcccagcaccccggggg-------ccctggcgggc
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      cctggagtcg-cggtgcc---agccccgggg-------------------
A0A2K6QZU4_BBC3-04      cctggagtcgccggtgcccagcgccccggggg-------ccctggcgggc
A0A2K5P2T8_BBC3-03      cctggagtcgcccgtgcccagcgccccggggg-------ccctggcgggc
A0A2K5V8J3_BBC3-03      cctggagtcgcccgtgcccagcgccccggggg-------ccctggcgggc
F7FFP6_BBC3-03          cctggagtcgcccgtgcccagcgccccggggg-------ccctggcgggc
A0A2K6ASP2_BBC3-03      cctggagtcgcccgtgcccagcgccccggggg-------ccctggcgggc
A0A2I3N2Z9_BBC3-03      cctggagtcgcccgtgcccagcgccccggggg-------ccctggcgggc
A0A2I3HWI8_BBC3-03      --------------------------------------------gcaggc
A0A2R9BZA9_BBC3-01      cctggagtcgcccgtgcccagcgccccggggg-------ctctggcgggc
A0A2I3RGH5_BBC3-03      cctggagtcgcccgtgcccagcgccccggggg-------ctctggcgggc
A0A2K6FQZ3_BBC3-04      cctggagtcgcccgtccccagcgccccggggg-------ccctggcgggc
A0A2K6FQZ3_BBC3-01      cctggagtcgcccgtccccagcgccccggggg-------ccctggcgggc
H2NZD3_BBC3-01          cctggagtcgcccgtgcccagcgccccggggg-------ctctggcgggc
B4DQK3_BBC3-01          cctggagtcgcccgtgcccagcgccccggggg-------ctctggcgggc
A0A2I3RIG5_BBC3-02      cctggagtcgcccgtgcccagcgccccggggg-------ctctggcgggc
A0A0D9S2H2_BBC3-01      cctggagtcgcccgtgcccagcgccccggggg-------ccctggcgggc
A0A2K6QZU4_BBC3-01      cctggagtcgccggtgcccagcgccccggggg-------ccctggcgggc
A0A2K6STD6_BBC3-02      cctggagtcgcccgtgcccagcgccccggggg-------ccctggcgggc
A0A2K5F6X4_BBC3-02      cctggagtcgcccgtgcccagcgccccggggg-------ccctggcgggc
A0A2R8MW85_BBC3-03      cctggagtcgcccgtgcccagcgccccagggg-------ccctggcgggc
A0A2R8MW85_BBC3-01      cctggagtcgcccgtgcccagcgccccagggg-------ccctggcgggc
                                                                          

G3T2N1_BBC3-01          ---cccacgcaggcg---gccccgggggtccggggagaggatgagcaatg
K7E5Y2_BBC3-01          ggccccccgggggtgttaggcccggagcacggggaccaaggcgagcagca
K7E5Y2_BBC3-02          ggccccccgggggtgttaggcccggagcacggggaccaaggcgagcagca
M3Y0R3_BBC3-01          ggccccacccaggca---gccccgggagtccggggggaggaggagcagtg
A0A1U7R5N5_BBC3-01      ggccccacccaagca---gccccgggagtgcgcggggaggaggaggagtg
Q99ML1_BBC3-02          ggccccacccaagct---gccccgggagtgcgtgtggaggaggaggagtg
Q80ZG6_BBC3-01          ggccccacccaagct---gccccgggagtgcgtgtggaggaggaggagtg
F7CQN5_BBC3-01          ggccccacccaggca---gccccgggagtccggggggaggaggagcagtg
J9NTK9_BBC3-01          ggtcccacccaagca---gccccgggagtccggggggaggaggagcagtg
F1RM01_BBC3-01          ggccccacccaagca---gccccgggaatccggggggaggaggagcagtg
H0XQ00_BBC3-01          ggtcccacccaggcg---gccccggaggtccggggggaggaggagcagtg
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      -------ccctggcg---gccccgggagt-cgcggggaggaggcgaagtg
A0A2K6QZU4_BBC3-04      ggtcccacccaggcg---gccccgggagtccgcggggaggaggaacagtg
A0A2K5P2T8_BBC3-03      ggtcccacccaggcg---gccccgggagtccgcggggaggaggaacagtg
A0A2K5V8J3_BBC3-03      ggtcccacccaggcg---gccccgggagtccgcggggaggaggaacagtg
F7FFP6_BBC3-03          ggtcccacccaggcg---gccccgggagtccgcggggaggaggaacagtg
A0A2K6ASP2_BBC3-03      ggtcccacccaggcg---gccccgggagtccgcggggaggaggaacagtg
A0A2I3N2Z9_BBC3-03      ggtcccacccaggcg---gccccgggagtccgcggggaggaggaacagtg
A0A2I3HWI8_BBC3-03      ggtcccacccaggcg---gctccgggagtccgcggggaggaggaacagtg
A0A2R9BZA9_BBC3-01      ggtcccacccaggcg---gccccgggagtccgcggggaggaggaacagtg
A0A2I3RGH5_BBC3-03      ggtcccacccaggcg---gccccgggagtccgcggggaggaggaacagtg
A0A2K6FQZ3_BBC3-04      ggtcccacccaggcg---gccccgggagtccggggggaggaggagcagtg
A0A2K6FQZ3_BBC3-01      ggtcccacccaggcg---gccccgggagtccggggggaggaggagcagtg
H2NZD3_BBC3-01          ggtcccacccaggcg---gccccgggagtccgcggggaggaggaacagtg
B4DQK3_BBC3-01          ggtcccacccaggcg---gccccgggagtccgcggggaggaggaacagtg
A0A2I3RIG5_BBC3-02      ggtcccacccaggcg---gccccgggagtccgcggggaggaggaacagtg
A0A0D9S2H2_BBC3-01      ggtcccacccaggcg---gccccgggagtccgcggggaggaggaacagtg
A0A2K6QZU4_BBC3-01      ggtcccacccaggcg---gccccgggagtccgcggggaggaggaacagtg
A0A2K6STD6_BBC3-02      ggtcccacccaggcg---gccccgggagtccgcggggaggaggagcagtg
A0A2K5F6X4_BBC3-02      ggtcccacccaggcg---gccccgggagtccgcggggaggaggagcagtg
A0A2R8MW85_BBC3-03      ggtcccacccaggcg---gcccccggagtccgcggggaggaggagcagtg
A0A2R8MW85_BBC3-01      ggtcccacccaggcg---gcccccggagtccgcggggaggaggagcagtg
                                                                          

G3T2N1_BBC3-01          ggcccgagagatcggggcccagtttcggcggaaggcg-gacgacctctat
K7E5Y2_BBC3-01          ggaccgggagatcggcgcccagctgcgcaggatggcc-gatgacctcaac
K7E5Y2_BBC3-02          ggaccgggagatcggcgcccagctgcgcaggatggcc-gatgacctcaac
M3Y0R3_BBC3-01          ggcccgggagatcggggcccagctgcggaggatggcg-gacgacctcaac
A0A1U7R5N5_BBC3-01      ggcccgggagatcggggctcagctgcggcggatggcg-gacgacctcaac
Q99ML1_BBC3-02          ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
Q80ZG6_BBC3-01          ggcccgggagatcggggcccagctgcggaggatggcg-gacgacctcaac
F7CQN5_BBC3-01          ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctgaac
J9NTK9_BBC3-01          ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
F1RM01_BBC3-01          ggcccgagagatcggggcccagctgcggcggatggct-gacgatctcaac
H0XQ00_BBC3-01          ggccagagagataggggcccagctgcggcggatggcg-gacgacctcaac
A0A2R9BZA9_BBC3-02      --------------------------------------------------
A0A2K6KS56_BBC3-02      ggcc--gggaatcggggcccagctgcggcggatggcgagacga-ctcaac
A0A2K6QZU4_BBC3-04      ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A2K5P2T8_BBC3-03      ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A2K5V8J3_BBC3-03      ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
F7FFP6_BBC3-03          ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A2K6ASP2_BBC3-03      ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A2I3N2Z9_BBC3-03      ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A2I3HWI8_BBC3-03      ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A2R9BZA9_BBC3-01      ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A2I3RGH5_BBC3-03      ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A2K6FQZ3_BBC3-04      ggcccgagagatcggggcccagctgcggcggatggca-gacgacctcaat
A0A2K6FQZ3_BBC3-01      ggcccgagagatcggggcccagctgcggcggatggca-gacgacctcaat
H2NZD3_BBC3-01          ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
B4DQK3_BBC3-01          ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A2I3RIG5_BBC3-02      ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A0D9S2H2_BBC3-01      ggcccaggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A2K6QZU4_BBC3-01      ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A2K6STD6_BBC3-02      ggctcgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A2K5F6X4_BBC3-02      ggcccgggagatcggggcccagctgcggcggatggcg-gacgacctcaac
A0A2R8MW85_BBC3-03      ggcccgggagatcggggcccagctgcgacggatggcg-gacgacctcaac
A0A2R8MW85_BBC3-01      ggcccgggagatcggggcccagctgcgacggatggcg-gacgacctcaac
                                                                          

G3T2N1_BBC3-01          gcgctgtacgagcggtcggtgagacaggaggagcagcaccggcaccgtcc
K7E5Y2_BBC3-01          gccctgtacgagcagc---ggagacgggaggaggagcagaggcgccacct
K7E5Y2_BBC3-02          gccctgtacgagcagc---ggagacgggaggaggagcagaggcgccacct
M3Y0R3_BBC3-01          gcgctgtacgagcggc---ggagacaagaagagcagcagcgacaccgccc
A0A1U7R5N5_BBC3-01      gcgcagtacgagcggc---ggagacaagaagagcaacatcgacaccgccc
Q99ML1_BBC3-02          gcgcagtacgagcggc---ggagacaagaagagcagcatcgacaccgacc
Q80ZG6_BBC3-01          gcgcagtacgagcggc---ggagacaagaagagcaacatcgacaccgacc
F7CQN5_BBC3-01          gcgctgtacgagcggc---ggagacaagaggagcagcagcgacaccgccc
J9NTK9_BBC3-01          gcgctgtacgagcggc---ggagacaagaggagcagcagcgacaccgccc
F1RM01_BBC3-01          gcgctgtacgagcggc---ggagacaagaggagcagcagcgacaccgccc
H0XQ00_BBC3-01          gcgcagtacgagcggc---ggagacaagaggagcagcagcgacaccgccc
A0A2R9BZA9_BBC3-02      --------------------gagacaagaggagcagcagcggcaccgccc
A0A2K6KS56_BBC3-02      gcgcagtacagacggc---ggagacaagaggagcagcagcgacaccgccc
A0A2K6QZU4_BBC3-04      gcgcagtacgagcggc---ggagacaagaggagcagcagcgacaccgccc
A0A2K5P2T8_BBC3-03      gcgcagtacgagcggc---ggagacaagaggagcagcagcgacaccgccc
A0A2K5V8J3_BBC3-03      gcgcaatacgagcggc---ggagacaagaggagcagcagcgacaccgccc
F7FFP6_BBC3-03          gcgcaatacgagcggc---ggagacaagaggagcagcagcgacaccgccc
A0A2K6ASP2_BBC3-03      gcgcaatacgagcggc---ggagacaagaggagcagcagcgacaccgccc
A0A2I3N2Z9_BBC3-03      gcgcagtacgagcggc---ggagacaagaggagcagcagcgacaccgccc
A0A2I3HWI8_BBC3-03      gcgcagtacgagcggc---ggagacaagaggagcaacagcggcaccgccc
A0A2R9BZA9_BBC3-01      gcgcagtacgagcggc---ggagacaagaggagcagcagcggcaccgccc
A0A2I3RGH5_BBC3-03      gcgcagtacgagcggc---ggagacaagaggagcagcagcggcaccgccc
A0A2K6FQZ3_BBC3-04      gcgcagtacgagcggc---ggagacaagaggagcagcagagacaccgccc
A0A2K6FQZ3_BBC3-01      gcgcagtacgagcggc---ggagacaagaggagcagcagagacaccgccc
H2NZD3_BBC3-01          gcgcagtacgagcggc---ggagacaagaggagcagcagcggcaccgccc
B4DQK3_BBC3-01          gcacagtacgagcggc---ggagacaagaggagcagcagcggcaccgccc
A0A2I3RIG5_BBC3-02      gcgcagtacgagcggc---ggagacaagaggagcagcagcggcaccgccc
A0A0D9S2H2_BBC3-01      gcgcagtacgagcggc---ggagacaagaggagcagcagcgacaccgccc
A0A2K6QZU4_BBC3-01      gcgcagtacgagcggc---ggagacaagaggagcagcagcgacaccgccc
A0A2K6STD6_BBC3-02      gcgcagtacgagcggc---ggagacaagaagagcagccgcaacaccgccc
A0A2K5F6X4_BBC3-02      gcgcagtacgagcggc---ggagacaagaggagcagccgcagcaccgccc
A0A2R8MW85_BBC3-03      gcgctgtacgagcggc---ggagacaagaggagcagccgcagcaccgccc
A0A2R8MW85_BBC3-01      gcgctgtacgagcggc---ggagacaagaggagcagccgcagcaccgccc
                                            *****  ** *** * *     * **  * 

G3T2N1_BBC3-01          ctcgccctggagggtcctgtacaatctcatcatgggactactgcccttac
K7E5Y2_BBC3-01          gtcgccctggaggctgctgtacaatctcatctcggggctcctggcccccc
K7E5Y2_BBC3-02          gtcgccctggaggctgctgtacaatctcatctcggggctcctggcccccc
M3Y0R3_BBC3-01          ctccccctggagggtcctgtacaatctcatcatgggactcctgcccttac
A0A1U7R5N5_BBC3-01      gtcgccctggagggtcatgtacaatctcttcatgggactcctccccttac
Q99ML1_BBC3-02          ctcaccctggagggtcatgtacaatctcttcatgggactcctccccttac
Q80ZG6_BBC3-01          ctcgccctggagggtcatgtataatctcttcatgggactcctccccttac
F7CQN5_BBC3-01          ctcgccctggagggtcctgtacaatctcatcatgggactcctgcccctac
J9NTK9_BBC3-01          ctcaccctggagggtcctgtacaatctcatcatgggactcctgcccttac
F1RM01_BBC3-01          ctcgccctggagggttctgtacaatctcatcatgggacttctgcccttac
H0XQ00_BBC3-01          ctcaccctggagagtcctgtacaatctcatcatgggactcctgcccttac
A0A2R9BZA9_BBC3-02      ctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttac
A0A2K6KS56_BBC3-02      ctcgccctggagggtcctgtacaatctcattatgggactcctgcccttac
A0A2K6QZU4_BBC3-04      ctcgccctggagggtcctgtacaatctcattatgggactcctgcccttac
A0A2K5P2T8_BBC3-03      ctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttac
A0A2K5V8J3_BBC3-03      ctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttac
F7FFP6_BBC3-03          ctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttac
A0A2K6ASP2_BBC3-03      ctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttac
A0A2I3N2Z9_BBC3-03      ctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttac
A0A2I3HWI8_BBC3-03      ctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttac
A0A2R9BZA9_BBC3-01      ctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttac
A0A2I3RGH5_BBC3-03      ctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttac
A0A2K6FQZ3_BBC3-04      ctcaccctggagggtcctgtacaatctcatcatgggactcctgcccttac
A0A2K6FQZ3_BBC3-01      ctcaccctggagggtcctgtacaatctcatcatgggactcctgcccttac
H2NZD3_BBC3-01          ctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttac
B4DQK3_BBC3-01          ctcaccctggagggtcctgtacaatctcatcatgggactcctgcccttac
A0A2I3RIG5_BBC3-02      ctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttac
A0A0D9S2H2_BBC3-01      ctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttac
A0A2K6QZU4_BBC3-01      ctcgccctggagggtcctgtacaatctcattatgggactcctgcccttac
A0A2K6STD6_BBC3-02      ctcaccctggagggtcctgtacaatctcatcatgggactcctgccctttc
A0A2K5F6X4_BBC3-02      ctcaccctggagggtcctgtacaatctcatcatgggactcctgccctttc
A0A2R8MW85_BBC3-03      ctcgccctggagggtcctgtacaatctcatcatgggactcctgccctttc
A0A2R8MW85_BBC3-01      ctcgccctggagggtcctgtacaatctcatcatgggactcctgccctttc
                         ** ********  *  **** ****** *   *** ** **  **   *

G3T2N1_BBC3-01          caagggaccatggcgcccccgagatggagcccaattag------------
K7E5Y2_BBC3-01          agcgaaggaaccggatgccggacgtggagcccaactag------------
K7E5Y2_BBC3-02          agcgaaggaaccggatgccggacgtggagcccaactag------------
M3Y0R3_BBC3-01          ccaggggccgtggagccccagagatggagcccaattag------------
A0A1U7R5N5_BBC3-01      ccagggatcctggagccccagaaatggagcccaactag------------
Q99ML1_BBC3-02          ccagggatcctggagccccagaaatggagcccaactag------------
Q80ZG6_BBC3-01          ccagggatcctggagccccagaaatggagcccaactag------------
F7CQN5_BBC3-01          ccaggggccgagcggccccggagatggagcccaactag------------
J9NTK9_BBC3-01          ccaggggccgtggagccccggagatggagcccaattag------------
F1RM01_BBC3-01          ccaggggccgtggagcccccgagatggagcctaattag------------
H0XQ00_BBC3-01          ccaggggccacagagcccctgagatggagcccaattag------------
A0A2R9BZA9_BBC3-02      ccaggggccacagagcccccgagatggagcccaattaggtgcctgcaccc
A0A2K6KS56_BBC3-02      ccaggggccacagagcccccgaaatggagcccaattag------------
A0A2K6QZU4_BBC3-04      ccaggggccacagagcccccgaaatggagcccaattag------------
A0A2K5P2T8_BBC3-03      ccaggggccacagagcccccgaaatggagcccaattag------------
A0A2K5V8J3_BBC3-03      ccaggggccacagagcccccgaaatggagcccaattag------------
F7FFP6_BBC3-03          ccaggggccacagagcccccgaaatggagcccaattag------------
A0A2K6ASP2_BBC3-03      ccaggggccacagagcccccgaaatggagcccaattag------------
A0A2I3N2Z9_BBC3-03      ccaggggccacagagcccccgaaatggagcccaattag------------
A0A2I3HWI8_BBC3-03      ccaggggccacagagcccccgagatggagcccaattag------------
A0A2R9BZA9_BBC3-01      ccaggggccacagagcccccgagatggagcccaattag------------
A0A2I3RGH5_BBC3-03      ccaggggccacagagcccccgagatggagcccaattag------------
A0A2K6FQZ3_BBC3-04      ccaggggccacagagcccctgagatggagcccaattag------------
A0A2K6FQZ3_BBC3-01      ccaggggccacagagcccctgagatggagcccaattag------------
H2NZD3_BBC3-01          ccaggggccacagagcccccgagatggagcccaattag------------
B4DQK3_BBC3-01          ccaggggccacagagcccccgagatggagcccaattag------------
A0A2I3RIG5_BBC3-02      ccaggggccacagagcccccgagatggagcccaattag------------
A0A0D9S2H2_BBC3-01      ccaggggccacagagcccccgaaatggagcccaattag------------
A0A2K6QZU4_BBC3-01      ccaggggccacagagcccccgaaatggagcccaattag------------
A0A2K6STD6_BBC3-02      ccaggggccacagagccccagagatggagcccaattag------------
A0A2K5F6X4_BBC3-02      ccaggggccacagagcccccgagatggagcccaattag------------
A0A2R8MW85_BBC3-03      ccaggggccacagagccccggagatggagcccaattag------------
A0A2R8MW85_BBC3-01      ccaggggccacagagccccggagatggagcccaattaggtgcctgcaccc
                           *             ** **  ******* ** ***            

G3T2N1_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-01          --------------------------------------------------
K7E5Y2_BBC3-02          --------------------------------------------------
M3Y0R3_BBC3-01          --------------------------------------------------
A0A1U7R5N5_BBC3-01      --------------------------------------------------
Q99ML1_BBC3-02          --------------------------------------------------
Q80ZG6_BBC3-01          --------------------------------------------------
F7CQN5_BBC3-01          --------------------------------------------------
J9NTK9_BBC3-01          --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
H0XQ00_BBC3-01          --------------------------------------------------
A0A2R9BZA9_BBC3-02      gcccggtggacgtcagggactcggggggcaggcccctcccacctcctgac
A0A2K6KS56_BBC3-02      --------------------------------------------------
A0A2K6QZU4_BBC3-04      --------------------------------------------------
A0A2K5P2T8_BBC3-03      --------------------------------------------------
A0A2K5V8J3_BBC3-03      --------------------------------------------------
F7FFP6_BBC3-03          --------------------------------------------------
A0A2K6ASP2_BBC3-03      --------------------------------------------------
A0A2I3N2Z9_BBC3-03      --------------------------------------------------
A0A2I3HWI8_BBC3-03      --------------------------------------------------
A0A2R9BZA9_BBC3-01      --------------------------------------------------
A0A2I3RGH5_BBC3-03      --------------------------------------------------
A0A2K6FQZ3_BBC3-04      --------------------------------------------------
A0A2K6FQZ3_BBC3-01      --------------------------------------------------
H2NZD3_BBC3-01          --------------------------------------------------
B4DQK3_BBC3-01          --------------------------------------------------
A0A2I3RIG5_BBC3-02      --------------------------------------------------
A0A0D9S2H2_BBC3-01      --------------------------------------------------
A0A2K6QZU4_BBC3-01      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K5F6X4_BBC3-02      --------------------------------------------------
A0A2R8MW85_BBC3-03      --------------------------------------------------
A0A2R8MW85_BBC3-01      gcccggtggacgtcagggacttggggggcaggcccctcccatctcctgac
                                                                          

G3T2N1_BBC3-01          ---------------------------------------
K7E5Y2_BBC3-01          ---------------------------------------
K7E5Y2_BBC3-02          ---------------------------------------
M3Y0R3_BBC3-01          ---------------------------------------
A0A1U7R5N5_BBC3-01      ---------------------------------------
Q99ML1_BBC3-02          ---------------------------------------
Q80ZG6_BBC3-01          ---------------------------------------
F7CQN5_BBC3-01          ---------------------------------------
J9NTK9_BBC3-01          ---------------------------------------
F1RM01_BBC3-01          ---------------------------------------
H0XQ00_BBC3-01          ---------------------------------------
A0A2R9BZA9_BBC3-02      accctggccagcgcgggggactttctctgcaccatgtag
A0A2K6KS56_BBC3-02      ---------------------------------------
A0A2K6QZU4_BBC3-04      ---------------------------------------
A0A2K5P2T8_BBC3-03      ---------------------------------------
A0A2K5V8J3_BBC3-03      ---------------------------------------
F7FFP6_BBC3-03          ---------------------------------------
A0A2K6ASP2_BBC3-03      ---------------------------------------
A0A2I3N2Z9_BBC3-03      ---------------------------------------
A0A2I3HWI8_BBC3-03      ---------------------------------------
A0A2R9BZA9_BBC3-01      ---------------------------------------
A0A2I3RGH5_BBC3-03      ---------------------------------------
A0A2K6FQZ3_BBC3-04      ---------------------------------------
A0A2K6FQZ3_BBC3-01      ---------------------------------------
H2NZD3_BBC3-01          ---------------------------------------
B4DQK3_BBC3-01          ---------------------------------------
A0A2I3RIG5_BBC3-02      ---------------------------------------
A0A0D9S2H2_BBC3-01      ---------------------------------------
A0A2K6QZU4_BBC3-01      ---------------------------------------
A0A2K6STD6_BBC3-02      ---------------------------------------
A0A2K5F6X4_BBC3-02      ---------------------------------------
A0A2R8MW85_BBC3-03      ---------------------------------------
A0A2R8MW85_BBC3-01      accctggccagcgcgggggactttctctgcaccatgtag
                                                               

© 1998-2018