Dataset for CDS BAD of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

117 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


C1C3S9_BAD-01          --------------------------------------------------
F6Z067_BAD-01          --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A3B1IH05_BAD-01      atgtccacagcggcgagagcggcggcggggacctgcgactccactgctgt
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      atgtcg--------------------------------------------
A0A1W4YVX7_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-02      atgtcgaagaagacaaggaataaagcgctggaggggggagtaa-------
E7FBJ6_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
A0A2D0SYM2_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
G3VRY4_BAD-02          --------------------------------------------------
G3VRY4_BAD-01          --------------------------------------------------
Q61337_BAD-02          atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggctt
Q61337_BAD-01          atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggctt
Q61337_BAD-03          --------------------------------------------------
O35147_BAD-01          atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggctt
Q6P7C5_BAD-01          atgggaaccccaaagcagccctcgctggctcctgcacacgccctaggctt
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          ---ggacccccagagaatccctcaccggcttccacacacgcccaaggcgt
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
I3MBM5_BAD-02          atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgc
I3MBM5_BAD-01          atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgc
A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      atgggcatcccagaaaatccctcatctgcttccacacacacccaaggaat
G1MI17_BAD-01          gtggggaccccagagaatccctcatctgctcccacacatggcccaggcaa
M3YNE7_BAD-01          --------------------------------------------------
A0A337SAW2_BAD-01      atggggaccccagagaatcccttatctgctcccacacacgtcccaggccc
F1PK10_BAD-01          ------accccagagaatccctcatctgctcccgcgcaggacccaggcac
Q45KI9_BAD-01          --------------------------------------------------
F7DN67_BAD-01          atggggaccccagagaacccctcccctgctcccacacacgcccagggcac
A0A2I2Z8C7_BAD-03      --------------------------------------------------
A0A2R8Z697_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-03      --------------------------------------------------
A0A2K5VCD8_BAD-02      --------------------------------------------------
F7GVS7_BAD-02          --------------------------------------------------
A0A2K6E7J3_BAD-02      --------------------------------------------------
A0A2K5M0C1_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
A0A2K5E6K7_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2R8Z697_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K5M0C1_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2I3MCN5_BAD-02      --------------------------------------------------
A0A2K5VCD8_BAD-03      --------------------------------------------------
F7GVS7_BAD-03          --------------------------------------------------
A0A2K6E7J3_BAD-03      --------------------------------------------------
A0A2K5HKW9_BAD-02      --------------------------------------------------
A0A2K6N1A1_BAD-02      --------------------------------------------------
A0A2K6PUM5_BAD-02      --------------------------------------------------
A0A2K5HKW9_BAD-01      --------------------------------------------------
A0A2K6N1A1_BAD-01      --------------------------------------------------
A0A2K6PUM5_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-04      --------------------------------------------------
A0A2I3MCN5_BAD-01      --------------------------------------------------
A0A2K5M0C1_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5VCD8_BAD-01      --------------------------------------------------
F7GVS7_BAD-01          --------------------------------------------------
A0A2K6E7J3_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
A0A2K5E6K7_BAD-01      --------------------------------------------------
F6SJL0_BAD-01          --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6K7_BAD-03      --------------------------------------------------
F6SJL0_BAD-02          --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3B5K831_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
F6Z067_BAD-01          --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A3B1IH05_BAD-01      cagccagccgtccaaactcgatttcaca----------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      -------------------ggtgtcacc----------------------
A0A1W4YVX7_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-02      -----ggaaggacgcagccgatgtcacc----------------------
E7FBJ6_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
A0A2D0SYM2_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
G3VRY4_BAD-02          --------------------------------------------------
G3VRY4_BAD-01          --------------------------------------------------
Q61337_BAD-02          gaggaagtccgatcccggaatccggagcctggggagcgacgcgggaggaa
Q61337_BAD-01          gaggaagtccgatcccggaatccggagcctggggagcgacgcgggaggaa
Q61337_BAD-03          --------------------------------------------------
O35147_BAD-01          gaggaagtccgatcccggaatccggagcctggggagcgacgcgggaggaa
Q6P7C5_BAD-01          gaggaagtccgatcccggaatccggagcctggggagcgacgcgggaggaa
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          gaggatgtcgggagctgaacatccggagaagaagaagggacgcaggagat
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
I3MBM5_BAD-02          gaggaagtcagggaaggagggaccggggaggaaggcggtaggacccgcag
I3MBM5_BAD-01          gaggaagtcagggaaggagggaccggggaggaaggcggtaggacccgcag
A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      aaggaagtccggagctgaaccagggaccccggaggaaggcggtgggcggg
G1MI17_BAD-01          aaggaagtcgggaactgatcggcgggagacgaggaagggacccaggacga
M3YNE7_BAD-01          --------------------------------------------------
A0A337SAW2_BAD-01      agggatgtcgggaactgagcagcgggaggcgaggaagggacccaggacga
F1PK10_BAD-01          aaggaagtcaggaaccgagcggcgggagaagag-----------------
Q45KI9_BAD-01          --------------------------------------------------
F7DN67_BAD-01          gaggaagtcgacagccgagcatccggagacgaggaggggacccaggaagg
A0A2I2Z8C7_BAD-03      --------------------------------------------------
A0A2R8Z697_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-03      --------------------------------------------------
A0A2K5VCD8_BAD-02      --------------------------------------------------
F7GVS7_BAD-02          --------------------------------------------------
A0A2K6E7J3_BAD-02      --------------------------------------------------
A0A2K5M0C1_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
A0A2K5E6K7_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2R8Z697_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K5M0C1_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2I3MCN5_BAD-02      --------------------------------------------------
A0A2K5VCD8_BAD-03      --------------------------------------------------
F7GVS7_BAD-03          --------------------------------------------------
A0A2K6E7J3_BAD-03      --------------------------------------------------
A0A2K5HKW9_BAD-02      --------------------------------------------------
A0A2K6N1A1_BAD-02      --------------------------------------------------
A0A2K6PUM5_BAD-02      --------------------------------------------------
A0A2K5HKW9_BAD-01      --------------------------------------------------
A0A2K6N1A1_BAD-01      --------------------------------------------------
A0A2K6PUM5_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-04      --------------------------------------------------
A0A2I3MCN5_BAD-01      --------------------------------------------------
A0A2K5M0C1_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5VCD8_BAD-01      --------------------------------------------------
F7GVS7_BAD-01          --------------------------------------------------
A0A2K6E7J3_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
A0A2K5E6K7_BAD-01      --------------------------------------------------
F6SJL0_BAD-01          --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6K7_BAD-03      --------------------------------------------------
F6SJL0_BAD-02          --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3B5K831_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
F6Z067_BAD-01          --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-02      --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
A0A2D0SYM2_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
G3VRY4_BAD-02          --------------------------------------------------
G3VRY4_BAD-01          --------------------------------------------------
Q61337_BAD-02          ggcggtggaga---------------------------------------
Q61337_BAD-01          ggcggtggaga---------------------------------------
Q61337_BAD-03          --------------------------------------------------
O35147_BAD-01          ggcggtggaga---------------------------------------
Q6P7C5_BAD-01          ggcggtggaga---------------------------------------
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          catcgggcggg---------------------------------------
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
I3MBM5_BAD-02          gtcggcggcgagggtggcacccggcctgg---------------------
I3MBM5_BAD-01          gtcggcggcgagggtggcacccggcctgg---------------------
A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      gccggagccgtagcggccccgcctcccagagc------------------
G1MI17_BAD-01          ccgcg---------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A337SAW2_BAD-01      aggcggtaggcagggagcaagtcccgcggcgggggcggagactgggtcgg
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
F7DN67_BAD-01          aaggcggggggcggagagccggtccggcg---------------------
A0A2I2Z8C7_BAD-03      --------------------------------------------------
A0A2R8Z697_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-03      --------------------------------------------------
A0A2K5VCD8_BAD-02      --------------------------------------------------
F7GVS7_BAD-02          --------------------------------------------------
A0A2K6E7J3_BAD-02      --------------------------------------------------
A0A2K5M0C1_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
A0A2K5E6K7_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2R8Z697_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K5M0C1_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2I3MCN5_BAD-02      --------------------------------------------------
A0A2K5VCD8_BAD-03      --------------------------------------------------
F7GVS7_BAD-03          --------------------------------------------------
A0A2K6E7J3_BAD-03      --------------------------------------------------
A0A2K5HKW9_BAD-02      --------------------------------------------------
A0A2K6N1A1_BAD-02      --------------------------------------------------
A0A2K6PUM5_BAD-02      --------------------------------------------------
A0A2K5HKW9_BAD-01      --------------------------------------------------
A0A2K6N1A1_BAD-01      --------------------------------------------------
A0A2K6PUM5_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-04      --------------------------------------------------
A0A2I3MCN5_BAD-01      --------------------------------------------------
A0A2K5M0C1_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5VCD8_BAD-01      --------------------------------------------------
F7GVS7_BAD-01          --------------------------------------------------
A0A2K6E7J3_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
A0A2K5E6K7_BAD-01      --------------------------------------------------
F6SJL0_BAD-01          --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6K7_BAD-03      --------------------------------------------------
F6SJL0_BAD-02          --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3B5K831_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
F6Z067_BAD-01          --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-02      --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
A0A2D0SYM2_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
G3VRY4_BAD-02          --------------------------------------------------
G3VRY4_BAD-01          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
O35147_BAD-01          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
I3MBM5_BAD-02          --------------------------------------------------
I3MBM5_BAD-01          --------------------------------------------------
A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
G1MI17_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A337SAW2_BAD-01      aagcggccacgccccctggccagccctggtgacatttcaaaagctgattg
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
A0A2I2Z8C7_BAD-03      --------------------------------------------------
A0A2R8Z697_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-03      --------------------------------------------------
A0A2K5VCD8_BAD-02      --------------------------------------------------
F7GVS7_BAD-02          --------------------------------------------------
A0A2K6E7J3_BAD-02      --------------------------------------------------
A0A2K5M0C1_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
A0A2K5E6K7_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2R8Z697_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K5M0C1_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2I3MCN5_BAD-02      --------------------------------------------------
A0A2K5VCD8_BAD-03      --------------------------------------------------
F7GVS7_BAD-03          --------------------------------------------------
A0A2K6E7J3_BAD-03      --------------------------------------------------
A0A2K5HKW9_BAD-02      --------------------------------------------------
A0A2K6N1A1_BAD-02      --------------------------------------------------
A0A2K6PUM5_BAD-02      --------------------------------------------------
A0A2K5HKW9_BAD-01      --------------------------------------------------
A0A2K6N1A1_BAD-01      --------------------------------------------------
A0A2K6PUM5_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-04      --------------------------------------------------
A0A2I3MCN5_BAD-01      --------------------------------------------------
A0A2K5M0C1_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5VCD8_BAD-01      --------------------------------------------------
F7GVS7_BAD-01          --------------------------------------------------
A0A2K6E7J3_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
A0A2K5E6K7_BAD-01      --------------------------------------------------
F6SJL0_BAD-01          --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6K7_BAD-03      --------------------------------------------------
F6SJL0_BAD-02          --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3B5K831_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
F6Z067_BAD-01          --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-02      --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
A0A2D0SYM2_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
G3VRY4_BAD-02          --------------------------------------------------
G3VRY4_BAD-01          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
O35147_BAD-01          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
I3MBM5_BAD-02          --------------------------------------------------
I3MBM5_BAD-01          --------------------------------------------------
A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
G1MI17_BAD-01          ------------------------------------------cttgcccc
M3YNE7_BAD-01          --------------------------------------------------
A0A337SAW2_BAD-01      ggccgggtcggtgacagttcccgttgcccaggcaactagggccgggctcc
F1PK10_BAD-01          --------------------ctgtgccctaactacctgctgtcttgcccc
Q45KI9_BAD-01          --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
A0A2I2Z8C7_BAD-03      --------------------------------------------------
A0A2R8Z697_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-03      --------------------------------------------------
A0A2K5VCD8_BAD-02      --------------------------------------------------
F7GVS7_BAD-02          --------------------------------------------------
A0A2K6E7J3_BAD-02      --------------------------------------------------
A0A2K5M0C1_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
A0A2K5E6K7_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2R8Z697_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K5M0C1_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2I3MCN5_BAD-02      --------------------------------------------------
A0A2K5VCD8_BAD-03      --------------------------------------------------
F7GVS7_BAD-03          --------------------------------------------------
A0A2K6E7J3_BAD-03      --------------------------------------------------
A0A2K5HKW9_BAD-02      --------------------------------------------------
A0A2K6N1A1_BAD-02      --------------------------------------------------
A0A2K6PUM5_BAD-02      --------------------------------------------------
A0A2K5HKW9_BAD-01      --------------------------------------------------
A0A2K6N1A1_BAD-01      --------------------------------------------------
A0A2K6PUM5_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-04      --------------------------------------------------
A0A2I3MCN5_BAD-01      --------------------------------------------------
A0A2K5M0C1_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5VCD8_BAD-01      --------------------------------------------------
F7GVS7_BAD-01          --------------------------------------------------
A0A2K6E7J3_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
A0A2K5E6K7_BAD-01      --------------------------------------------------
F6SJL0_BAD-01          --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6K7_BAD-03      --------------------------------------------------
F6SJL0_BAD-02          --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3B5K831_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
F6Z067_BAD-01          --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-02      --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
A0A2D0SYM2_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
G3VRY4_BAD-02          --------------------------------------------------
G3VRY4_BAD-01          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
O35147_BAD-01          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------caggggcctcgttatcgg
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
I3MBM5_BAD-02          --------------------------------------------------
I3MBM5_BAD-01          --------------------------------------------------
A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
G1MI17_BAD-01          caca----------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A337SAW2_BAD-01      ctcagtactggagggaggcggcaggcccgggtcaggggcctcgagatcgg
F1PK10_BAD-01          caca----------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
A0A2I2Z8C7_BAD-03      --------------------------------------------------
A0A2R8Z697_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-03      --------------------------------------------------
A0A2K5VCD8_BAD-02      --------------------------------------------------
F7GVS7_BAD-02          --------------------------------------------------
A0A2K6E7J3_BAD-02      --------------------------------------------------
A0A2K5M0C1_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
A0A2K5E6K7_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2R8Z697_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K5M0C1_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2I3MCN5_BAD-02      --------------------------------------------------
A0A2K5VCD8_BAD-03      --------------------------------------------------
F7GVS7_BAD-03          --------------------------------------------------
A0A2K6E7J3_BAD-03      --------------------------------------------------
A0A2K5HKW9_BAD-02      --------------------------------------------------
A0A2K6N1A1_BAD-02      --------------------------------------------------
A0A2K6PUM5_BAD-02      --------------------------------------------------
A0A2K5HKW9_BAD-01      --------------------------------------------------
A0A2K6N1A1_BAD-01      --------------------------------------------------
A0A2K6PUM5_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-04      --------------------------------------------------
A0A2I3MCN5_BAD-01      --------------------------------------------------
A0A2K5M0C1_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5VCD8_BAD-01      --------------------------------------------------
F7GVS7_BAD-01          --------------------------------------------------
A0A2K6E7J3_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
A0A2K5E6K7_BAD-01      --------------------------------------------------
F6SJL0_BAD-01          --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6K7_BAD-03      --------------------------------------------------
F6SJL0_BAD-02          --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3B5K831_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          ---------------atgggggattctcctcataagtc---------tat
F6Z067_BAD-01          ---------------atggcagattcatccc---cttcagcagttttcaa
A7MCM4_BAD-01          ---------------atggcacatatgtttaatatctccgatgattcaga
Q4V925_BAD-03          ---------------atggcacatatgtttaatatctctgatgattcaga
Q4V925_BAD-02          ---------------atggcacatatgtttaatatctctgatgattcaga
Q4V925_BAD-01          ---------------atggcacatatgtttaatatctctgatgattcaga
Q4V925_BAD-04          ---------------atggcacatatgtttaatatctctgatgattcaga
A0A3B1IH05_BAD-01      ---------------atggatcacatgttcacaatatctg---at---ga
A0A3B4CPH6_BAD-01      ---------------atggctcatatgttcacattatcgg---ac---ga
A0A3B3QX41_BAD-01      ---------------atggcgcacatgtttaccatctccggcaat---ga
A0A1W4YVX7_BAD-01      ---------------atggatcgcatgttcagtatctcagacaat---ga
A0A1W4YVX7_BAD-02      ---------------atggatcgcatgttcagtatctcagacaat---ga
E7FBJ6_BAD-01          ---------------atg-----gagaacacctcg---------------
B5X1T1_BAD-01          ---------------atg-----gaccacacacat---------------
B5XEF1_BAD-01          ---------------atg-----gactacacacat---------------
A0A2D0SYM2_BAD-01      ---------------atg-----agcaatcaataccta--------ctga
A0A3B1JLM2_BAD-01      ---------------atg-----agcaatcagtatctg--------ctaa
A0A3B4DUY7_BAD-01      ---------------atg-----agcaatcaatatctg--------caga
H3ANP3_BAD-03          ---------------atg---------ttccagatttc---------aga
H3ANP3_BAD-02          ---------------atg---------ttccagatttc---------aga
H3ANP3_BAD-01          ---------------atg---------ttccagatttc---------aga
H3ANP3_BAD-04          ---------------atg---------ttccagatttc---------aga
G3VRY4_BAD-02          ---------------atg---------ttccagatatc---------cga
G3VRY4_BAD-01          ---------------atg---------ttccagatatc---------cga
Q61337_BAD-02          ccagcagcccagagtatg---------ttccagatccc---------aga
Q61337_BAD-01          ccagcagcccagagtatg---------ttccagatccc---------aga
Q61337_BAD-03          ---------------atg---------ttccagatccc---------aga
O35147_BAD-01          ccagcagcccagagtatg---------ttccagatccc---------aga
Q6P7C5_BAD-01          ccagcagcccagagtatg---------ttccagatccc---------aga
G1SS60_BAD-01          -----------------------------ccgcgcccc---------aaa
G3TP47_BAD-01          ------ctgcagagtatg---------ttccagatccc---------aga
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          ---------------atg---------ttccagatccc---------aga
H0WVR2_BAD-01          ---------------atg---------ttccagatccc---------aga
A0A2K6GWV0_BAD-01      ---------------atg---------ttccagatccc---------aga
W5P8G9_BAD-01          gcttgggcccagagcatg---------ttccagatccc---------aga
F1MUT9_BAD-01          ---------------atg---------ttccagatccc---------aga
Q3SYZ0_BAD-01          ---------------atg---------ttccagatccc---------aga
G1P8C5_BAD-01          cctacagcccagagcatg---------ttccagatccc---------aga
I3MBM5_BAD-02          ------acccagagcatg---------ttccagatccc---------aga
I3MBM5_BAD-01          ------acccagagcatg---------ttccagatccc---------aga
A0A287AEF3_BAD-02      ---------------atg---------ttccagatccc---------aga
A0A287AEF3_BAD-01      ---------------atg---------ttccagatccc---------aga
G1MI17_BAD-01          ------gcccagagcatg---------ttccagatccc---------aga
M3YNE7_BAD-01          ---------------atg---------ttccagatccc---------aga
A0A337SAW2_BAD-01      gcttgggcccagagcatg---------ttccagatccc---------aga
F1PK10_BAD-01          ------gcccagagcatg---------ttccagatccc---------aga
Q45KI9_BAD-01          ---------------atg---------ttccagatccc---------aga
F7DN67_BAD-01          ------gcggggagcatg---------ttccagatccc---------aga
A0A2I2Z8C7_BAD-03      ---------------atg---------ttccagatccc---------aga
A0A2R8Z697_BAD-02      ---------------atg---------ttccagatccc---------aga
Q92934_BAD-03          ---------------atg---------ttccagatccc---------aga
A0A2I3TBK7_BAD-01      ---------------atg---------ttccagatccc---------aga
A0A2I3MCN5_BAD-03      ---------------atg---------ttccagatccc---------aga
A0A2K5VCD8_BAD-02      ---------------atg---------ttccagatccc---------aga
F7GVS7_BAD-02          ---------------atg---------ttccagatccc---------aga
A0A2K6E7J3_BAD-02      ---------------atg---------ttccagatccc---------aga
A0A2K5M0C1_BAD-02      ---------------atg---------ttccagatccc---------aga
A0A2K5XJR2_BAD-02      ---------------atg---------ttccagatccc---------aga
A0A2K5E6K7_BAD-02      ---------------atg---------ttccagatccc---------aga
A0A2K6TG62_BAD-02      ---------------atg---------ttccagatccc---------aga
A0A2R8Z697_BAD-03      ---------------atg---------ttccagatccc---------aga
A0A2I2Z8C7_BAD-04      ---------------atg---------ttccagatccc---------aga
Q92934_BAD-04          ---------------atg---------ttccagatccc---------aga
A0A2I3TBK7_BAD-03      ---------------atg---------ttccagatccc---------aga
A0A2K5M0C1_BAD-03      ---------------atg---------ttccagatccc---------aga
A0A2K5XJR2_BAD-03      ---------------atg---------ttccagatccc---------aga
A0A2I3MCN5_BAD-02      ---------------atg---------ttccagatccc---------aga
A0A2K5VCD8_BAD-03      ---------------atg---------ttccagatccc---------aga
F7GVS7_BAD-03          ---------------atg---------ttccagatccc---------aga
A0A2K6E7J3_BAD-03      ---------------atg---------ttccagatccc---------aga
A0A2K5HKW9_BAD-02      ---------------atg---------ttccagatccc---------aga
A0A2K6N1A1_BAD-02      ---------------atg---------ttccagatccc---------aga
A0A2K6PUM5_BAD-02      ---------------atg---------ttccagatccc---------aga
A0A2K5HKW9_BAD-01      ---------------atg---------ttccagatccc---------aga
A0A2K6N1A1_BAD-01      ---------------atg---------ttccagatccc---------aga
A0A2K6PUM5_BAD-01      ---------------atg---------ttccagatccc---------aga
A0A0D9R491_BAD-01      ---------------atg---------ttccagatccc---------aga
A0A2I3MCN5_BAD-04      ---------------atg---------ttccagatccc---------aga
A0A2I3MCN5_BAD-01      ---------------atg---------ttccagatccc---------aga
A0A2K5M0C1_BAD-01      ---------------atg---------ttccagatccc---------aga
A0A2K5XJR2_BAD-01      ---------------atg---------ttccagatccc---------aga
A0A2K5VCD8_BAD-01      ---------------atg---------ttccagatccc---------aga
F7GVS7_BAD-01          ---------------atg---------ttccagatccc---------aga
A0A2K6E7J3_BAD-01      ---------------atg---------ttccagatccc---------aga
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      ---------------atg---------ttccagatccc---------aga
B4DZQ9_BAD-01          ---------------atg---------ttccagatccc---------aga
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      ---------------atg---------ttccagatccc---------aga
A0A2I3TBK7_BAD-02      ---------------atg---------ttccagatccc---------aga
A0A2I2Z8C7_BAD-02      ---------------atg---------ttccagatccc---------aga
A0A2I2Z8C7_BAD-01      ---------------atg---------ttccagatccc---------aga
Q92934_BAD-02          ---------------atg---------ttccagatccc---------aga
Q92934_BAD-01          ---------------atg---------ttccagatccc---------aga
A0A2K5E6K7_BAD-01      ---------------atg---------ttccagatccc---------aga
F6SJL0_BAD-01          ---------------atg---------ttccagatccc---------aga
A0A2K6TG62_BAD-01      ---------------atg---------ttccagatccc---------aga
A0A2K5E6K7_BAD-03      ---------------atg---------ttccagatccc---------aga
F6SJL0_BAD-02          ---------------atg---------ttccagatccc---------aga
A0A2K6TG62_BAD-03      ---------------atg---------ttccagatccc---------aga
A0A3B3HDU2_BAD-01      ---------------atggcagcaaagttcaccatctc---ag---acga
A0A3B3BQF7_BAD-01      ---------------atggcagcaaagttctccatctc---agacaacga
A0A3B3YFR1_BAD-01      ---------------atggacgcaaaatttacaatttc---agacagcga
A0A087X8P8_BAD-01      ---------------atggacgcaaaatttacaatttc---agacagcga
A0A3B3UA11_BAD-01      ---------------atggacgcaaaatttacaatttc---agacagcga
A0A3B5L9R9_BAD-01      ---------------atggacacaaaatttacaatttc---agacggtga
A0A3B5Q2N7_BAD-01      ---------------atggacacaaaatttacaatttc---agacggtga
I3K7B6_BAD-01          ---------------atggctgcaaacttcacaatttc---agacagtga
A0A3B4GXJ6_BAD-01      ---------------atggctgcaaacttcaaaatttc---agacagtga
A0A3B5K831_BAD-01      ---------------atggcgacgaggttcagcatttccagcgacagcga
H3D8J8_BAD-01          ---------------atggctgcaaagttcagtctgtgcagcgacagcga
G3Q8B3_BAD-01          ---------------atggctgcacatttcaccatttc---cgacagcga
A0A3B5BAL2_BAD-01      ---------------atggctgcacaattctctattag---tggcagcga
A0A2U9BAC9_BAD-01      ---------------atggcggcaaacttcacaatatc---agacagtga
A0A3B4VFC5_BAD-01      ---------------atggctgcaaacttcaccatttc---agacagtga
A0A3B4W9T1_BAD-01      ---------------atggctgcaaacttcaccatttc---agacagtga
                                                                         

C1C3S9_BAD-01          gtt-----------------------------------------------
F6Z067_BAD-01          gttagag-------------------------------------------
A7MCM4_BAD-01          gacagaaaca----------------------------------------
Q4V925_BAD-03          gacagaaaca----------------------------------------
Q4V925_BAD-02          gacagaaaca----------------------------------------
Q4V925_BAD-01          gacagaaaca----------------------------------------
Q4V925_BAD-04          gacagaaaca----------------------------------------
A0A3B1IH05_BAD-01      gtcagatgca----------------------------------------
A0A3B4CPH6_BAD-01      ctcagacaca----------------------------------------
A0A3B3QX41_BAD-01      gtcggacact----------------------------------------
A0A1W4YVX7_BAD-01      atctgaaacc----------------------------------------
A0A1W4YVX7_BAD-02      atctgaaacc----------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
A0A2D0SYM2_BAD-01      gactgaggaaagctcgttttaatttcgataaggaggaatatacaaaagta
A0A3B1JLM2_BAD-01      aactgaggagagctcgttttaattgcgacgaggagggatatagccaagca
A0A3B4DUY7_BAD-01      aactgaggagagctcgttttaattgcgaagaggagcgatataagaaagta
H3ANP3_BAD-03          ctccgac-------------------------------------------
H3ANP3_BAD-02          ctccgac-------------------------------------------
H3ANP3_BAD-01          ctccgac-------------------------------------------
H3ANP3_BAD-04          ctccgac-------------------------------------------
G3VRY4_BAD-02          gtttgag-------------------------------------------
G3VRY4_BAD-01          gtttgag-------------------------------------------
Q61337_BAD-02          gtttgag-------------------------------------------
Q61337_BAD-01          gtttgag-------------------------------------------
Q61337_BAD-03          gtttgag-------------------------------------------
O35147_BAD-01          gtttgag-------------------------------------------
Q6P7C5_BAD-01          gtttgag-------------------------------------------
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          gtttgag-------------------------------------------
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          gtttgag-------------------------------------------
H0WVR2_BAD-01          gtttgag-------------------------------------------
A0A2K6GWV0_BAD-01      gtttgag-------------------------------------------
W5P8G9_BAD-01          gtttgag-------------------------------------------
F1MUT9_BAD-01          gtttgag-------------------------------------------
Q3SYZ0_BAD-01          gtttgag-------------------------------------------
G1P8C5_BAD-01          gtttgag-------------------------------------------
I3MBM5_BAD-02          gtttgag-------------------------------------------
I3MBM5_BAD-01          gtttgag-------------------------------------------
A0A287AEF3_BAD-02      gtttgag-------------------------------------------
A0A287AEF3_BAD-01      gtttgag-------------------------------------------
G1MI17_BAD-01          gtttgag-------------------------------------------
M3YNE7_BAD-01          gtttgag-------------------------------------------
A0A337SAW2_BAD-01      gtttgag-------------------------------------------
F1PK10_BAD-01          gtttgag-------------------------------------------
Q45KI9_BAD-01          gtttgag-------------------------------------------
F7DN67_BAD-01          gtttgag-------------------------------------------
A0A2I2Z8C7_BAD-03      gtttgag-------------------------------------------
A0A2R8Z697_BAD-02      gtttgag-------------------------------------------
Q92934_BAD-03          gtttgag-------------------------------------------
A0A2I3TBK7_BAD-01      gtttgag-------------------------------------------
A0A2I3MCN5_BAD-03      gtttgag-------------------------------------------
A0A2K5VCD8_BAD-02      gtttgag-------------------------------------------
F7GVS7_BAD-02          gtttgag-------------------------------------------
A0A2K6E7J3_BAD-02      gtttgag-------------------------------------------
A0A2K5M0C1_BAD-02      gtttgag-------------------------------------------
A0A2K5XJR2_BAD-02      gtttgag-------------------------------------------
A0A2K5E6K7_BAD-02      gtttgag-------------------------------------------
A0A2K6TG62_BAD-02      gtttgag-------------------------------------------
A0A2R8Z697_BAD-03      gtttgag-------------------------------------------
A0A2I2Z8C7_BAD-04      gtttgag-------------------------------------------
Q92934_BAD-04          gtttgag-------------------------------------------
A0A2I3TBK7_BAD-03      gtttgag-------------------------------------------
A0A2K5M0C1_BAD-03      gtttgag-------------------------------------------
A0A2K5XJR2_BAD-03      gtttgag-------------------------------------------
A0A2I3MCN5_BAD-02      gtttgag-------------------------------------------
A0A2K5VCD8_BAD-03      gtttgag-------------------------------------------
F7GVS7_BAD-03          gtttgag-------------------------------------------
A0A2K6E7J3_BAD-03      gtttgag-------------------------------------------
A0A2K5HKW9_BAD-02      gtttgag-------------------------------------------
A0A2K6N1A1_BAD-02      gtttgag-------------------------------------------
A0A2K6PUM5_BAD-02      gtttgag-------------------------------------------
A0A2K5HKW9_BAD-01      gtttgag-------------------------------------------
A0A2K6N1A1_BAD-01      gtttgag-------------------------------------------
A0A2K6PUM5_BAD-01      gtttgag-------------------------------------------
A0A0D9R491_BAD-01      gtttgag-------------------------------------------
A0A2I3MCN5_BAD-04      gtttgag-------------------------------------------
A0A2I3MCN5_BAD-01      gtttgag-------------------------------------------
A0A2K5M0C1_BAD-01      gtttgag-------------------------------------------
A0A2K5XJR2_BAD-01      gtttgag-------------------------------------------
A0A2K5VCD8_BAD-01      gtttgag-------------------------------------------
F7GVS7_BAD-01          gtttgag-------------------------------------------
A0A2K6E7J3_BAD-01      gtttgag-------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      gtttgag-------------------------------------------
B4DZQ9_BAD-01          gtttgag-------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      gtttgag-------------------------------------------
A0A2I3TBK7_BAD-02      gtttgag-------------------------------------------
A0A2I2Z8C7_BAD-02      gtttgag-------------------------------------------
A0A2I2Z8C7_BAD-01      gtttgag-------------------------------------------
Q92934_BAD-02          gtttgag-------------------------------------------
Q92934_BAD-01          gtttgag-------------------------------------------
A0A2K5E6K7_BAD-01      gtttgag-------------------------------------------
F6SJL0_BAD-01          gtttgag-------------------------------------------
A0A2K6TG62_BAD-01      gtttgag-------------------------------------------
A0A2K5E6K7_BAD-03      gtttgag-------------------------------------------
F6SJL0_BAD-02          gtttgag-------------------------------------------
A0A2K6TG62_BAD-03      gtttgag-------------------------------------------
A0A3B3HDU2_BAD-01      ttcggag-------------------------------------------
A0A3B3BQF7_BAD-01      ttcggag-------------------------------------------
A0A3B3YFR1_BAD-01      ctcggag-------------------------------------------
A0A087X8P8_BAD-01      ctcggag-------------------------------------------
A0A3B3UA11_BAD-01      ctcggag-------------------------------------------
A0A3B5L9R9_BAD-01      gtcggac-------------------------------------------
A0A3B5Q2N7_BAD-01      gtcggac-------------------------------------------
I3K7B6_BAD-01          atcggag-------------------------------------------
A0A3B4GXJ6_BAD-01      ttcagag-------------------------------------------
A0A3B5K831_BAD-01      ctcggat-------------------------------------------
H3D8J8_BAD-01          ctcagag-------------------------------------------
G3Q8B3_BAD-01          gtcagag-------------------------------------------
A0A3B5BAL2_BAD-01      gtccgac-------------------------------------------
A0A2U9BAC9_BAD-01      gtcagag-------------------------------------------
A0A3B4VFC5_BAD-01      gtcagag-------------------------------------------
A0A3B4W9T1_BAD-01      gtcagag-------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
F6Z067_BAD-01          --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-02      --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
A0A2D0SYM2_BAD-01      ataaacaccagaataggaagt------gaaggaggaggaaccattctgaa
A0A3B1JLM2_BAD-01      cttaacagcagaacatcgactgaaggaggggggagagatacgcttttcag
A0A3B4DUY7_BAD-01      attaa------aacactgact------ggagagaaaggaacgccttttaa
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
G3VRY4_BAD-02          --------------------------------------------------
G3VRY4_BAD-01          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
O35147_BAD-01          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
I3MBM5_BAD-02          --------------------------------------------------
I3MBM5_BAD-01          --------------------------------------------------
A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
G1MI17_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
A0A2I2Z8C7_BAD-03      --------------------------------------------------
A0A2R8Z697_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-03      --------------------------------------------------
A0A2K5VCD8_BAD-02      --------------------------------------------------
F7GVS7_BAD-02          --------------------------------------------------
A0A2K6E7J3_BAD-02      --------------------------------------------------
A0A2K5M0C1_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
A0A2K5E6K7_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2R8Z697_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K5M0C1_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2I3MCN5_BAD-02      --------------------------------------------------
A0A2K5VCD8_BAD-03      --------------------------------------------------
F7GVS7_BAD-03          --------------------------------------------------
A0A2K6E7J3_BAD-03      --------------------------------------------------
A0A2K5HKW9_BAD-02      --------------------------------------------------
A0A2K6N1A1_BAD-02      --------------------------------------------------
A0A2K6PUM5_BAD-02      --------------------------------------------------
A0A2K5HKW9_BAD-01      --------------------------------------------------
A0A2K6N1A1_BAD-01      --------------------------------------------------
A0A2K6PUM5_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-04      --------------------------------------------------
A0A2I3MCN5_BAD-01      --------------------------------------------------
A0A2K5M0C1_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5VCD8_BAD-01      --------------------------------------------------
F7GVS7_BAD-01          --------------------------------------------------
A0A2K6E7J3_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
A0A2K5E6K7_BAD-01      --------------------------------------------------
F6SJL0_BAD-01          --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6K7_BAD-03      --------------------------------------------------
F6SJL0_BAD-02          --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3B5K831_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
F6Z067_BAD-01          --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-02      --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
A0A2D0SYM2_BAD-01      tcacttcttcgggaattcatcaagaattacagctttcacaatggatgaga
A0A3B1JLM2_BAD-01      gccattgtgctggaattcatctggaagcacagttttcacaatggaaaaga
A0A3B4DUY7_BAD-01      cccattgtgctggaattcattaagaaccacagcttgcgcaatggaaaag-
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
G3VRY4_BAD-02          --------------------------------------------------
G3VRY4_BAD-01          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
O35147_BAD-01          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
I3MBM5_BAD-02          --------------------------------------------------
I3MBM5_BAD-01          --------------------------------------------------
A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
G1MI17_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
A0A2I2Z8C7_BAD-03      --------------------------------------------------
A0A2R8Z697_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-03      --------------------------------------------------
A0A2K5VCD8_BAD-02      --------------------------------------------------
F7GVS7_BAD-02          --------------------------------------------------
A0A2K6E7J3_BAD-02      --------------------------------------------------
A0A2K5M0C1_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
A0A2K5E6K7_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2R8Z697_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K5M0C1_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2I3MCN5_BAD-02      --------------------------------------------------
A0A2K5VCD8_BAD-03      --------------------------------------------------
F7GVS7_BAD-03          --------------------------------------------------
A0A2K6E7J3_BAD-03      --------------------------------------------------
A0A2K5HKW9_BAD-02      --------------------------------------------------
A0A2K6N1A1_BAD-02      --------------------------------------------------
A0A2K6PUM5_BAD-02      --------------------------------------------------
A0A2K5HKW9_BAD-01      --------------------------------------------------
A0A2K6N1A1_BAD-01      --------------------------------------------------
A0A2K6PUM5_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-04      --------------------------------------------------
A0A2I3MCN5_BAD-01      --------------------------------------------------
A0A2K5M0C1_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5VCD8_BAD-01      --------------------------------------------------
F7GVS7_BAD-01          --------------------------------------------------
A0A2K6E7J3_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
A0A2K5E6K7_BAD-01      --------------------------------------------------
F6SJL0_BAD-01          --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6K7_BAD-03      --------------------------------------------------
F6SJL0_BAD-02          --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3B5K831_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          ----------------tagtattgaagagtttccaccgacagaaaggggg
F6Z067_BAD-01          --------gaatt---cgataatgagga----------acagggattacc
A7MCM4_BAD-01          --------atgga---agacagtgaagcctcaagcctg-----gataaac
Q4V925_BAD-03          --------atgga---agacagtgaagactcaagcctg-----gataaac
Q4V925_BAD-02          --------atgga---agacagtgaagactcaagcctg-----gataaac
Q4V925_BAD-01          --------atgga---agacagtgaagactcaagcctg-----gataaac
Q4V925_BAD-04          --------atgga---agacagtgaagactcaagcctg-----gataaac
A0A3B1IH05_BAD-01      --------tctga---agagctaggagactcagaccagccagaggtcagt
A0A3B4CPH6_BAD-01      --------tctga---agatctaggagacgcagaccagccagaagccagt
A0A3B3QX41_BAD-01      --------tctgaatccgacacaccaga---------------------t
A0A1W4YVX7_BAD-01      --------tcaga---tgaaacagcagactcgga----------ggccgt
A0A1W4YVX7_BAD-02      --------tcaga---tgaaacagcagactcgga----------ggccgt
E7FBJ6_BAD-01          --------catga---ccatcaagatgattccagcaccttggatgaaaaa
B5X1T1_BAD-01          --------gattg---tgtggatgacaacccagaaaccatgaatgaacat
B5XEF1_BAD-01          --------gattg---tgtggatga-----------------------at
A0A2D0SYM2_BAD-01      cacca---caaag---cgtaagaggagatgccggtcctgtggatgacaaa
A0A3B1JLM2_BAD-01      caccaccacacag---taaagaagatgacatcagtcccatagatgaccac
A0A3B4DUY7_BAD-01      --------cacag---t---gaagatggcataagtaccatggatgaccaa
H3ANP3_BAD-03          --------tcaga---cgcgtacgaaga--------tgatagaacgggcc
H3ANP3_BAD-02          --------tcaga---cgcgtacgaaga--------tgatagaacgggcc
H3ANP3_BAD-01          --------tcaga---cgcgtacgaaga--------tgatagaacgggcc
H3ANP3_BAD-04          --------tcaga---cgcgtacgaaga--------tgatagaacgggcc
G3VRY4_BAD-02          --------cccag---tgagcccggagaagacccttctgcctccactgcc
G3VRY4_BAD-01          --------cccag---tgagcccggagaagacccttctgcctccactgcc
Q61337_BAD-02          --------ccgag---tgagcaggaagacgctagtgctacagataggggc
Q61337_BAD-01          --------ccgag---tgagcaggaagacgctagtgctacagataggggc
Q61337_BAD-03          --------ccgag---tgagcaggaagacgctagtgctacagataggggc
O35147_BAD-01          --------ccgag---tgagcaggaagacgctagtactacagataggggc
Q6P7C5_BAD-01          --------ccgag---tgagcaggaagacgctagtactacagataggggc
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          --------cagag---tgaccgggaagactccacccctgcagacaggggc
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --------ccaag---tgagcaggaagactccagctctgaagagaggggc
H0WVR2_BAD-01          --------ccgag---tgagcaggaagactccagctcctcagataggggc
A0A2K6GWV0_BAD-01      --------ccaag---tgagcaggaagactccagctctgcaggtaggggc
W5P8G9_BAD-01          --------cagag---tgagcaggaagactccagccctgcagataggggc
F1MUT9_BAD-01          --------cagag---tgagcaggaagactccagccctgcagataggggc
Q3SYZ0_BAD-01          --------cagag---tgagcaggaagactccagccgtgcagataggggc
G1P8C5_BAD-01          --------cacag---tgagcaggaagactccagccctgcagataggggc
I3MBM5_BAD-02          --------cccag---tgagcaggaagactccagctccgcagaagggggc
I3MBM5_BAD-01          --------cccag---tgagcaggaagactccagctccgcagaagggggc
A0A287AEF3_BAD-02      --------cagag---tgagcaggaagactccagccctgcagacaggggc
A0A287AEF3_BAD-01      --------cagag---tgagcaggaagactccagccctgcagacaggggc
G1MI17_BAD-01          --------cccag---tgagcaggaagactccagccctgcagataggggc
M3YNE7_BAD-01          --------cccag---tgagcaggaagactccagccctgcagataggggc
A0A337SAW2_BAD-01      --------cccag---tgagcaggaagactccagccctacggataggggc
F1PK10_BAD-01          --------cccag---tgagcaggaagactccagccctgcaaataggggc
Q45KI9_BAD-01          --------cccag---tgagcaggaagactccagccctgcaaataggggc
F7DN67_BAD-01          --------cagag---tgagccagaagactccagccctgcagataggggc
A0A2I2Z8C7_BAD-03      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2R8Z697_BAD-02      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
Q92934_BAD-03          --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2I3TBK7_BAD-01      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2I3MCN5_BAD-03      --------cctag---tgagcaggaagactccagatctgcagagaggggc
A0A2K5VCD8_BAD-02      --------cctag---tgagcaggaagactccagctctgcagagaggggc
F7GVS7_BAD-02          --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K6E7J3_BAD-02      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K5M0C1_BAD-02      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K5XJR2_BAD-02      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K5E6K7_BAD-02      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2K6TG62_BAD-02      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2R8Z697_BAD-03      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2I2Z8C7_BAD-04      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
Q92934_BAD-04          --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2I3TBK7_BAD-03      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2K5M0C1_BAD-03      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K5XJR2_BAD-03      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2I3MCN5_BAD-02      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K5VCD8_BAD-03      --------cctag---tgagcaggaagactccagctctgcagagaggggc
F7GVS7_BAD-03          --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K6E7J3_BAD-03      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K5HKW9_BAD-02      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K6N1A1_BAD-02      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K6PUM5_BAD-02      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K5HKW9_BAD-01      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K6N1A1_BAD-01      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K6PUM5_BAD-01      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A0D9R491_BAD-01      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2I3MCN5_BAD-04      --------cctag---tgagcaggaagactccagatctgcagagaggggc
A0A2I3MCN5_BAD-01      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K5M0C1_BAD-01      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K5XJR2_BAD-01      --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K5VCD8_BAD-01      --------cctag---tgagcaggaagactccagctctgcagagaggggc
F7GVS7_BAD-01          --------cctag---tgagcaggaagactccagctctgcagagaggggc
A0A2K6E7J3_BAD-01      --------cctag---tgagcaggaagactccagctctgcagagaggggc
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
B4DZQ9_BAD-01          --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2I3TBK7_BAD-02      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2I2Z8C7_BAD-02      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2I2Z8C7_BAD-01      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
Q92934_BAD-02          --------ccgag---tgagcaggaagactccagctctgcagagaggggc
Q92934_BAD-01          --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2K5E6K7_BAD-01      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
F6SJL0_BAD-01          --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2K6TG62_BAD-01      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2K5E6K7_BAD-03      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
F6SJL0_BAD-02          --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A2K6TG62_BAD-03      --------ccgag---tgagcaggaagactccagctctgcagagaggggc
A0A3B3HDU2_BAD-01      --------tcatc---cgaggaggtaga------------gggaggaaaa
A0A3B3BQF7_BAD-01      --------tcatc---cgaggaggtaga------------gggaggaaga
A0A3B3YFR1_BAD-01      --------ccatc---ggaagacgtaga------------ggaaagagga
A0A087X8P8_BAD-01      --------ccatc---ggaagacgtaga------------ggaaagagga
A0A3B3UA11_BAD-01      --------ccatc---ggaagacgtaga------------ggaaagagga
A0A3B5L9R9_BAD-01      --------ccatc---ggaagacgtaga------------ggaaagagga
A0A3B5Q2N7_BAD-01      --------ccatc---ggaagacgtaga------------ggaaagagga
I3K7B6_BAD-01          --------acatc---agaggaggtagg------------ggaagaagaa
A0A3B4GXJ6_BAD-01      --------gcatc---agaggaggtagg------------ggaaggagaa
A0A3B5K831_BAD-01      --------ccctc---ggaggaggtgga------------cgaaggagag
H3D8J8_BAD-01          --------ccatc---agaggaggtgga------------agaaggagag
G3Q8B3_BAD-01          --------ccctc---ggatggggtaga------------ggaaagagaa
A0A3B5BAL2_BAD-01      --------c---c---ggaggaggtaga------------agagggagaa
A0A2U9BAC9_BAD-01      --------ccatc---ggaggaggtgga------------ggaaggagaa
A0A3B4VFC5_BAD-01      --------ccatc---ggaggaggtaga------------cgaaggagaa
A0A3B4W9T1_BAD-01      --------ccatc---ggaggaggtaga------------cgaaggagaa
                                                                         

C1C3S9_BAD-01          tctgcattt------------------------tctggaacaaatcct--
F6Z067_BAD-01          tttgccttt------------tgtggatccccctcgtggggcaggcgt--
A7MCM4_BAD-01          acaagag-t------------------gggtcggcacagaa---------
Q4V925_BAD-03          acaagag-t------------------gggtcggcacagaa---------
Q4V925_BAD-02          acaagag-t------------------gggtcggcacagaa---------
Q4V925_BAD-01          acaagag-t------------------gggtcggcacagaa---------
Q4V925_BAD-04          acaagag-t------------------gggtcggcacagaa---------
A0A3B1IH05_BAD-01      aagacagct------------------gagccatcgcggtc---------
A0A3B4CPH6_BAD-01      aagagagct------------------gagctgtcacagtc---------
A0A3B3QX41_BAD-01      gtcacag-c------------------aaat--tcacagct---------
A0A1W4YVX7_BAD-01      gtcacagcc------------------agct--tcgcagct---------
A0A1W4YVX7_BAD-02      gtcacagcc------------------agct--tcgcagct---------
E7FBJ6_BAD-01          gagagatca------------------catctgaaag-------ggacaa
B5X1T1_BAD-01          gatgagtct------------------gaccactcaggaaccacacacta
B5XEF1_BAD-01          g-tgagtct------------------gatcactcaggaaccacacgcaa
A0A2D0SYM2_BAD-01      ---gaatca------------------agatggtcag-------agacag
A0A3B1JLM2_BAD-01      gatgaatca------------------aggtggtcag-------aggcag
A0A3B4DUY7_BAD-01      gatgaatcc------------------aattggtcag-------agacgg
H3ANP3_BAD-03          ccttgccac---------------tgcagtctggaggaggaagaggcgag
H3ANP3_BAD-02          ccttgccac---------------tgcagtctggaggaggaagaggcgag
H3ANP3_BAD-01          ccttgccac---------------tgcagtctggaggaggaagaggcgag
H3ANP3_BAD-04          ccttgccac---------------tgcagtctggaggaggaagaggcgag
G3VRY4_BAD-02          cccagcctc-------------------gccccgctcaggccaggacc--
G3VRY4_BAD-01          cccagcctc-------------------gccccgctcaggccaggacc--
Q61337_BAD-02          ctgggccct------------------agcctcactgaggaccagcc---
Q61337_BAD-01          ctgggccct------------------agcctcactgaggaccagcc---
Q61337_BAD-03          ctgggccct------------------agcctcactgaggaccagcc---
O35147_BAD-01          ctgggccct------------------agcctcactgaggaccagcc---
Q6P7C5_BAD-01          ctgggccct------------------agcctcactgaggaccagcc---
G1SS60_BAD-01          ------ccc------------------ctctccgca--------------
G3TP47_BAD-01          ctgggcccc------------------agccccgaagggtactggcct--
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          ctgggcccc------------------agccccacaggggacgagct---
H0WVR2_BAD-01          ctgggcccc------------------agcccctcaggggaccagccc--
A0A2K6GWV0_BAD-01      ctgggcccc------------------agcccctcaggggaccggccc--
W5P8G9_BAD-01          ctgggcccc------------------agccccacaggggacaggccc--
F1MUT9_BAD-01          ctgggcccc------------------agccccacaggggacaggccc--
Q3SYZ0_BAD-01          ctgggcccc------------------agccccacaggggacaggccc--
G1P8C5_BAD-01          ctgggcccc------------------tgccccacaggggaccagccc--
I3MBM5_BAD-02          ctgggcccc------------------agccccgcaggggaccggcc---
I3MBM5_BAD-01          ctgggcccc------------------agccccgcaggggaccggcc---
A0A287AEF3_BAD-02      ctgggcccc------------------agccccacaggg-acagaccc--
A0A287AEF3_BAD-01      ctgggcccc------------------agccccacaggg-acagaccc--
G1MI17_BAD-01          ctgggcccc------------------agccccacaggggaccagccc--
M3YNE7_BAD-01          ctgggcccc------------------agccccacaggggatcaaccc--
A0A337SAW2_BAD-01      ctgggcccc------------------agccccacaggggaccggccc--
F1PK10_BAD-01          ttgggcccc------------------agccccacaggggaccggccc--
Q45KI9_BAD-01          ttgggcccc------------------agccccacaggggaccggccc--
F7DN67_BAD-01          ctgggcccc------------------agccctacgggggactggccc--
A0A2I2Z8C7_BAD-03      ctgggcccc------------------agccccgcaggggacgggccc--
A0A2R8Z697_BAD-02      ctgggcccc------------------agccccgcaggggacgggccc--
Q92934_BAD-03          ctgggcccc------------------agccccgcaggggacgggccc--
A0A2I3TBK7_BAD-01      ctgggcccc------------------agccccgcaggggacgggccc--
A0A2I3MCN5_BAD-03      ctgggcccc------------------agccccgcgggggacaagccc--
A0A2K5VCD8_BAD-02      ctgggcccc------------------agccccgcgggggacaggccc--
F7GVS7_BAD-02          ctgggcccc------------------agccccgcgggggacaggccc--
A0A2K6E7J3_BAD-02      ctgggcccc------------------agccccgcgggggacaggccc--
A0A2K5M0C1_BAD-02      ctgggcccc------------------agtctcgcgggggacaggccc--
A0A2K5XJR2_BAD-02      ctgggcccc------------------agcctcgcgggggacaggccc--
A0A2K5E6K7_BAD-02      ctgagcccc------------------agcaccgcaggggacaggccc--
A0A2K6TG62_BAD-02      ctgagcccc------------------agcaccgcaggggacagcccc--
A0A2R8Z697_BAD-03      ctgggcccc------------------agccccgcaggggacgggccc--
A0A2I2Z8C7_BAD-04      ctgggcccc------------------agccccgcaggggacgggccc--
Q92934_BAD-04          ctgggcccc------------------agccccgcaggggacgggccc--
A0A2I3TBK7_BAD-03      ctgggcccc------------------agccccgcaggggacgggccc--
A0A2K5M0C1_BAD-03      ctgggcccc------------------agtctcgcgggggacaggccc--
A0A2K5XJR2_BAD-03      ctgggcccc------------------agcctcgcgggggacaggccc--
A0A2I3MCN5_BAD-02      ctgggcccc------------------agccccgcgggggacaagccc--
A0A2K5VCD8_BAD-03      ctgggcccc------------------agccccgcgggggacaggccc--
F7GVS7_BAD-03          ctgggcccc------------------agccccgcgggggacaggccc--
A0A2K6E7J3_BAD-03      ctgggcccc------------------agccccgcgggggacaggccc--
A0A2K5HKW9_BAD-02      ctgggcccc------------------agcccggcaggggacaggccc--
A0A2K6N1A1_BAD-02      ctgggcccc------------------agcccggcaggggacaggccc--
A0A2K6PUM5_BAD-02      ctgggcccc------------------agcccggcaggggacaggccc--
A0A2K5HKW9_BAD-01      ctgggcccc------------------agcccggcaggggacaggccc--
A0A2K6N1A1_BAD-01      ctgggcccc------------------agcccggcaggggacaggccc--
A0A2K6PUM5_BAD-01      ctgggcccc------------------agcccggcaggggacaggccc--
A0A0D9R491_BAD-01      ctgggcccc------------------agccccgcagggaacaggccc--
A0A2I3MCN5_BAD-04      ctgggcccc------------------agccccgcgggggacaagccc--
A0A2I3MCN5_BAD-01      ctgggcccc------------------agccccgcgggggacaagccc--
A0A2K5M0C1_BAD-01      ctgggcccc------------------agtctcgcgggggacaggccc--
A0A2K5XJR2_BAD-01      ctgggcccc------------------agcctcgcgggggacaggccc--
A0A2K5VCD8_BAD-01      ctgggcccc------------------agccccgcgggggacaggccc--
F7GVS7_BAD-01          ctgggcccc------------------agccccgcgggggacaggccc--
A0A2K6E7J3_BAD-01      ctgggcccc------------------agccccgcgggggacaggccc--
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      ctgggcccc------------------agccccgcaggggacaggccc--
B4DZQ9_BAD-01          ctgggcccc------------------agccccgcaggggacgggccc--
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      ctgggcccc------------------agccccgcaggggacgggccc--
A0A2I3TBK7_BAD-02      ctgggcccc------------------agccccgcaggggacgggccc--
A0A2I2Z8C7_BAD-02      ctgggcccc------------------agccccgcaggggacgggccc--
A0A2I2Z8C7_BAD-01      ctgggcccc------------------agccccgcaggggacgggccc--
Q92934_BAD-02          ctgggcccc------------------agccccgcaggggacgggccc--
Q92934_BAD-01          ctgggcccc------------------agccccgcaggggacgggccc--
A0A2K5E6K7_BAD-01      ctgagcccc------------------agcaccgcaggggacaggccc--
F6SJL0_BAD-01          ctgagcccc------------------agcaccgcaggggacaggccc--
A0A2K6TG62_BAD-01      ctgagcccc------------------agcaccgcaggggacagcccc--
A0A2K5E6K7_BAD-03      ctgagcccc------------------agcaccgcaggggacaggccc--
F6SJL0_BAD-02          ctgagcccc------------------agcaccgcaggggacaggccc--
A0A2K6TG62_BAD-03      ctgagcccc------------------agcaccgcaggggacagcccc--
A0A3B3HDU2_BAD-01      cttgacctg------------ggagcggcagcaggaggagaaggggag--
A0A3B3BQF7_BAD-01      cttgacctggcagcatcaggaggagaaggaggaggaggaggagggggg--
A0A3B3YFR1_BAD-01      aacttgcag------------------ctaatgcaagtaaaggagagg--
A0A087X8P8_BAD-01      aacttgcag------------------ctaatgcaagtaaaggagagg--
A0A3B3UA11_BAD-01      aacttgcag------------------ctaatgcaagtaaaggagagg--
A0A3B5L9R9_BAD-01      gacttgcag------------------ctaatgcaagaaaaggagaag--
A0A3B5Q2N7_BAD-01      gacttgcag------------------ctaatgcaagaaaaggagaag--
I3K7B6_BAD-01          a---accaa------------------cagccagcaggacaagatcaa--
A0A3B4GXJ6_BAD-01      a---accaa------------------cagtcagcaggacaagctcaa--
A0A3B5K831_BAD-01      aggaatagt------------------tctctaagtgagcaggagagg--
H3D8J8_BAD-01          aggggcagt------------------ttttca-----------------
G3Q8B3_BAD-01          gatggccag------------------ttatcatcggggcaagagcag--
A0A3B5BAL2_BAD-01      aacaaccat------------------ccaccagcagaacagccgatg--
A0A2U9BAC9_BAD-01      gtgagccaa------------------ccgtggaccgggccaggggag--
A0A3B4VFC5_BAD-01      atgagccaa------------------tcactaactgggcaagagcag--
A0A3B4W9T1_BAD-01      atgagccaa------------------tcactaactgggcaagagcag--
                                                                         

C1C3S9_BAD-01          ------------------------ccaggttttgg----------aggag
F6Z067_BAD-01          -------------------------------tcga--------caacctg
A7MCM4_BAD-01          -------------------------------------------aaagcag
Q4V925_BAD-03          -------------------------------------------aaagcag
Q4V925_BAD-02          -------------------------------------------aaagcag
Q4V925_BAD-01          -------------------------------------------aaagcag
Q4V925_BAD-04          -------------------------------------------aaagcag
A0A3B1IH05_BAD-01      -------------------------------------------tgggcag
A0A3B4CPH6_BAD-01      -------------------------------------------tgggcag
A0A3B3QX41_BAD-01      -------------------------------------------tggaaat
A0A1W4YVX7_BAD-01      -------------------------------------------tgagcat
A0A1W4YVX7_BAD-02      -------------------------------------------tgagcat
E7FBJ6_BAD-01          tcaagaaccatgga----------caacatcaggatcgaacatcggccaa
B5X1T1_BAD-01          cccagaatttcagcgccattatgtctccactagga--------cgggcat
B5XEF1_BAD-01          ctcagaattccagctcc---atgtctcaactacaa--------tgagcaa
A0A2D0SYM2_BAD-01      tcgagaatactgactct-------cca-----------------------
A0A3B1JLM2_BAD-01      tcaagagtgtcgactcc-------ccacagacgga--------cagcggg
A0A3B4DUY7_BAD-01      tcaagaatggtgactct-------ccacagctgga--------cagtcag
H3ANP3_BAD-03          ggatcagagccaagtgaaaaaacagcgggtttaaa--------gaaacac
H3ANP3_BAD-02          ggatcagagccaagtgaaaaaacagcgggtttaaa--------gaaacac
H3ANP3_BAD-01          ggatcagagccaagtgaaaaaacagcgggtttaaa--------gaaacac
H3ANP3_BAD-04          ggatcagagccaagtgaaaaaacagcgggtttaaa--------gaaacac
G3VRY4_BAD-02          ------------------------ccgag---------------------
G3VRY4_BAD-01          ------------------------ccgag---------------------
Q61337_BAD-02          --------------------------aggtccc-----------------
Q61337_BAD-01          --------------------------aggtccc-----------------
Q61337_BAD-03          --------------------------aggtccc-----------------
O35147_BAD-01          --------------------------aggtccc-----------------
Q6P7C5_BAD-01          --------------------------aggtccc-----------------
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          ------------------------tcaggccccag--------cgaccgc
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------aggcag
H0WVR2_BAD-01          ------------------------ctaggccccgg--------caagaac
A0A2K6GWV0_BAD-01      ------------------------tcaggccccgg--------caagcat
W5P8G9_BAD-01          ------------------------ccaggtctcag--------caagcac
F1MUT9_BAD-01          ------------------------ccaggtctcag--------caagcac
Q3SYZ0_BAD-01          ------------------------ccaggtctcag--------caagcac
G1P8C5_BAD-01          ------------------------ccaggcctcaa--------caagcac
I3MBM5_BAD-02          --------------------------aggctgcgg--------c------
I3MBM5_BAD-01          --------------------------aggctgcgg--------c------
A0A287AEF3_BAD-02      ------------------------ccaggccccag--------caagccc
A0A287AEF3_BAD-01      ------------------------cc-------------------agccc
G1MI17_BAD-01          ------------------------ccaggccctgg--------caagcac
M3YNE7_BAD-01          ------------------------ccaggccttgg--------caagcac
A0A337SAW2_BAD-01      ------------------------cgcggccctgg--------caagcac
F1PK10_BAD-01          ------------------------ccaagccctgg--------caagcac
Q45KI9_BAD-01          ------------------------ccaagccctgg--------caagcac
F7DN67_BAD-01          ------------------------tcagacccggt--------caggcac
A0A2I2Z8C7_BAD-03      ------------------------tcaggctccgg--------caagcat
A0A2R8Z697_BAD-02      ------------------------tcgggctccag--------caagcat
Q92934_BAD-03          ------------------------tcaggctccgg--------caagcat
A0A2I3TBK7_BAD-01      ------------------------tcaggctccgg--------caagcat
A0A2I3MCN5_BAD-03      ------------------------tcagactccgg--------caagcat
A0A2K5VCD8_BAD-02      ------------------------tcagactccgg--------caagcat
F7GVS7_BAD-02          ------------------------tcagactccgg--------caagcat
A0A2K6E7J3_BAD-02      ------------------------tcagactccgg--------caagcat
A0A2K5M0C1_BAD-02      ------------------------tcagactgcgg--------caagcat
A0A2K5XJR2_BAD-02      ------------------------tcagactgcgg--------caagcat
A0A2K5E6K7_BAD-02      ------------------------ccaggctctgg--------caagcat
A0A2K6TG62_BAD-02      ------------------------ccaggctctgg--------caagcat
A0A2R8Z697_BAD-03      ------------------------tcgggctccag--------caagcat
A0A2I2Z8C7_BAD-04      ------------------------tcaggctccgg--------caagcat
Q92934_BAD-04          ------------------------tcaggctccgg--------caagcat
A0A2I3TBK7_BAD-03      ------------------------tcaggctccgg--------caagcat
A0A2K5M0C1_BAD-03      ------------------------tcagactgcgg--------caagcat
A0A2K5XJR2_BAD-03      ------------------------tcagactgcgg--------caagcat
A0A2I3MCN5_BAD-02      ------------------------tcagactccgg--------caagcat
A0A2K5VCD8_BAD-03      ------------------------tcagactccgg--------caagcat
F7GVS7_BAD-03          ------------------------tcagactccgg--------caagcat
A0A2K6E7J3_BAD-03      ------------------------tcagactccgg--------caagcat
A0A2K5HKW9_BAD-02      ------------------------tcagactccgg--------caagcat
A0A2K6N1A1_BAD-02      ------------------------tcagactccgg--------caagcat
A0A2K6PUM5_BAD-02      ------------------------tcagactccgg--------caagcat
A0A2K5HKW9_BAD-01      ------------------------tcagactccgg--------caagcat
A0A2K6N1A1_BAD-01      ------------------------tcagactccgg--------caagcat
A0A2K6PUM5_BAD-01      ------------------------tcagactccgg--------caagcat
A0A0D9R491_BAD-01      ------------------------tcagactccgg--------caagcat
A0A2I3MCN5_BAD-04      ------------------------tcagactccgg--------caagcat
A0A2I3MCN5_BAD-01      ------------------------tcagactccgg--------caagcat
A0A2K5M0C1_BAD-01      ------------------------tcagactgcgg--------caagcat
A0A2K5XJR2_BAD-01      ------------------------tcagactgcgg--------caagcat
A0A2K5VCD8_BAD-01      ------------------------tcagactccgg--------caagcat
F7GVS7_BAD-01          ------------------------tcagactccgg--------caagcat
A0A2K6E7J3_BAD-01      ------------------------tcagactccgg--------caagcat
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      ------------------------tcaggctccag--------caagcat
B4DZQ9_BAD-01          ------------------------tcaggctccgg--------caagcat
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      ------------------------tcgggctccag--------caagcat
A0A2I3TBK7_BAD-02      ------------------------tcaggctccgg--------caagcat
A0A2I2Z8C7_BAD-02      ------------------------tcaggctccgg--------caagcat
A0A2I2Z8C7_BAD-01      ------------------------tcaggctccgg--------caagcat
Q92934_BAD-02          ------------------------tcaggctccgg--------caagcat
Q92934_BAD-01          ------------------------tcaggctccgg--------caagcat
A0A2K5E6K7_BAD-01      ------------------------ccaggctctgg--------caagcat
F6SJL0_BAD-01          ------------------------ccaggctctgg--------caagcat
A0A2K6TG62_BAD-01      ------------------------ccaggctctgg--------caagcat
A0A2K5E6K7_BAD-03      ------------------------ccaggctctgg--------caagcat
F6SJL0_BAD-02          ------------------------ccaggctctgg--------caagcat
A0A2K6TG62_BAD-03      ------------------------ccaggctctgg--------caagcat
A0A3B3HDU2_BAD-01      ------------------------caccttcatga--------tcgacat
A0A3B3BQF7_BAD-01      ------------------------caccttcatga--------tcgacat
A0A3B3YFR1_BAD-01      ------------------------ccgctcagtca--------acgccac
A0A087X8P8_BAD-01      ------------------------ccgctcagtca--------acgccac
A0A3B3UA11_BAD-01      ------------------------ccgctcagtca--------acgccac
A0A3B5L9R9_BAD-01      ------------------------ccgctcagtca--------acgccac
A0A3B5Q2N7_BAD-01      ------------------------ccgctcagtca--------acgccac
I3K7B6_BAD-01          ------------------------gaaag---caa--------gccccag
A0A3B4GXJ6_BAD-01      ------------------------gaaag---caa--------gccccag
A0A3B5K831_BAD-01      ------------------------caggttcttca--------gcggcac
H3D8J8_BAD-01          --------------------------------------------------
G3Q8B3_BAD-01          ------------------------cagcgtcttca--------acgtcac
A0A3B5BAL2_BAD-01      ------------------------catgtcttcga--------gcgccgc
A0A2U9BAC9_BAD-01      ------------------------caggttcctcc--------gcgccac
A0A3B4VFC5_BAD-01      ------------------------gagctttctca--------acgccac
A0A3B4W9T1_BAD-01      ------------------------gagctttctca--------acgccac
                                                                         

C1C3S9_BAD-01          atcctggacacaa--------------gag--------ttcccctaactt
F6Z067_BAD-01          tagctaagagttc----------------------------tcccagcct
A7MCM4_BAD-01          cacctcactgttc--------------ctg-----ataggctgaaaggag
Q4V925_BAD-03          cacctcactgttc--------------ctg-----ataggctgaaaggag
Q4V925_BAD-02          cacctcactgttc--------------ctg-----ataggctgaaaggag
Q4V925_BAD-01          cacctcactgttc--------------ctg-----ataggctgaaaggag
Q4V925_BAD-04          cacctcactgttc--------------ctg-----ataggctgaaaggag
A0A3B1IH05_BAD-01      cacatcactgttc--------------cgg-----agaaactcagagtag
A0A3B4CPH6_BAD-01      cacccacttgttc--------------cag-----agagattcag---ag
A0A3B3QX41_BAD-01      aacctca--------------------aaaatacgaaaaatccaggagag
A0A1W4YVX7_BAD-01      gccctcactgtgc--------------cagacatcaaactctcaggggaa
A0A1W4YVX7_BAD-02      gccctcactgtgc--------------cagacatcaaactctcaggggaa
E7FBJ6_BAD-01          catttctcctcaa-------------------------------------
B5X1T1_BAD-01          cagaccacgacca-------------------------------------
B5XEF1_BAD-01          cagaccaagacca-------------------------------------
A0A2D0SYM2_BAD-01      ---agc--------------------------------------------
A0A3B1JLM2_BAD-01      cccagcatgtacagggacacatca-----------------tcagacgag
A0A3B4DUY7_BAD-01      cacagcatggcaagcaacatatcaccagct--------tccccagacgaa
H3ANP3_BAD-03          agccggacagccc--------------cca--------atctgc---aga
H3ANP3_BAD-02          agccggacagccc--------------cca--------atctgc---aga
H3ANP3_BAD-01          agccggacagccc--------------cca--------atctgc---aga
H3ANP3_BAD-04          agccggacagccc--------------cca--------atctgc---aga
G3VRY4_BAD-02          --------------------------------------------------
G3VRY4_BAD-01          --------------------------------------------------
Q61337_BAD-02          ---tacctggccc--------------cag--------gtctcctgggga
Q61337_BAD-01          ---tacctggccc--------------cag--------gtctcctgggga
Q61337_BAD-03          ---tacctggccc--------------cag--------gtctcctgggga
O35147_BAD-01          ---tacctggccc--------------cag--------gtctcctgggga
Q6P7C5_BAD-01          ---tacctggccc--------------cag--------gtctcctgggga
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          caccgtgtggccc--------------cag--------gcttcctgcggg
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          ca--gcccagcag--------------gag--------gcttcctggggg
H0WVR2_BAD-01          cgctgcacgactc--------------caa--------gtctcctggggg
A0A2K6GWV0_BAD-01      ccctgcacggctc--------------caa--------gcttcctggggg
W5P8G9_BAD-01          tggctaacagccc--------------cgg--------gcctcctggggg
F1MUT9_BAD-01          tggctaacagccc--------------cag--------gcctcctggggg
Q3SYZ0_BAD-01          tggctaacagccc--------------cag--------gcctcctggggg
G1P8C5_BAD-01          tggagtacggtcc--------------cag--------gtctcctggggg
I3MBM5_BAD-02          ------ttggctc--------------cag--------gcctccccaggg
I3MBM5_BAD-01          ------ttggctc--------------cag--------gcctccccaggg
A0A287AEF3_BAD-02      tggcgcacggccc--------------cag--------gccacctggggg
A0A287AEF3_BAD-01      tggcgcacggccc--------------cag--------gccacctggggg
G1MI17_BAD-01          cggcagacagccc--------------cag--------gcctcctagggg
M3YNE7_BAD-01          ctgcagacggccc--------------cag--------gcctcctagggg
A0A337SAW2_BAD-01      cagcggacgaccc--------------cag--------gcctcctcgggg
F1PK10_BAD-01          cagcagacggccc--------------cag--------gcctcctagggg
Q45KI9_BAD-01          cagcagacggccc--------------cag--------gcctcctagggg
F7DN67_BAD-01          cagcggacagccc--------------cag--------gcctcctggggg
A0A2I2Z8C7_BAD-03      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2R8Z697_BAD-02      catcgccaggccc--------------cag--------gcctcctgtggg
Q92934_BAD-03          catcgccaggccc--------------cag--------gcctcctgtggg
A0A2I3TBK7_BAD-01      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2I3MCN5_BAD-03      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K5VCD8_BAD-02      catcgccaggccc--------------cag--------gcctcctgtggg
F7GVS7_BAD-02          catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K6E7J3_BAD-02      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K5M0C1_BAD-02      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K5XJR2_BAD-02      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K5E6K7_BAD-02      ccacgccaggccc--------------cag--------gcctcccagggg
A0A2K6TG62_BAD-02      cgacgccaggccc--------------cag--------gcctcccggggg
A0A2R8Z697_BAD-03      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2I2Z8C7_BAD-04      catcgccaggccc--------------cag--------gcctcctgtggg
Q92934_BAD-04          catcgccaggccc--------------cag--------gcctcctgtggg
A0A2I3TBK7_BAD-03      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K5M0C1_BAD-03      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K5XJR2_BAD-03      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2I3MCN5_BAD-02      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K5VCD8_BAD-03      catcgccaggccc--------------cag--------gcctcctgtggg
F7GVS7_BAD-03          catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K6E7J3_BAD-03      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K5HKW9_BAD-02      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K6N1A1_BAD-02      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K6PUM5_BAD-02      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K5HKW9_BAD-01      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K6N1A1_BAD-01      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K6PUM5_BAD-01      catcgccaggccc--------------cag--------gcctcctgtggg
A0A0D9R491_BAD-01      catcaccaggccc--------------cag--------gcctcctgtggg
A0A2I3MCN5_BAD-04      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2I3MCN5_BAD-01      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K5M0C1_BAD-01      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K5XJR2_BAD-01      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K5VCD8_BAD-01      catcgccaggccc--------------cag--------gcctcctgtggg
F7GVS7_BAD-01          catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K6E7J3_BAD-01      catcgccaggccc--------------cag--------gcctcctgtggg
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      catcgccaggccc--------------cag--------gcctcctgcggg
B4DZQ9_BAD-01          catcgccaggccc--------------cag--------gcctcctgtggg
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2I3TBK7_BAD-02      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2I2Z8C7_BAD-02      catcgccaggccc--------------cag--------gcctcctgtggg
A0A2I2Z8C7_BAD-01      catcgccaggccc--------------cag--------gcctcctgtggg
Q92934_BAD-02          catcgccaggccc--------------cag--------gcctcctgtggg
Q92934_BAD-01          catcgccaggccc--------------cag--------gcctcctgtggg
A0A2K5E6K7_BAD-01      ccacgccaggccc--------------cag--------gcctcccagggg
F6SJL0_BAD-01          cgacgccaggccc--------------cag--------gcctcccggggg
A0A2K6TG62_BAD-01      cgacgccaggccc--------------cag--------gcctcccggggg
A0A2K5E6K7_BAD-03      ccacgccaggccc--------------cag--------gcctcccagggg
F6SJL0_BAD-02          cgacgccaggccc--------------cag--------gcctcccggggg
A0A2K6TG62_BAD-03      cgacgccaggccc--------------cag--------gcctcccggggg
A0A3B3HDU2_BAD-01      tccctcaccctgc--------------cag--------agcttc----ga
A0A3B3BQF7_BAD-01      gccctcaccctgc--------------cag--------agcttc----ga
A0A3B3YFR1_BAD-01      accctcacgcttc--------------ctg--------agctcc----ga
A0A087X8P8_BAD-01      accctcacgcttc--------------ctg--------agctcc----ga
A0A3B3UA11_BAD-01      accctcacgcttc--------------ctg--------agctcc----ga
A0A3B5L9R9_BAD-01      accctcacgcttc--------------ctg--------agctcc----ga
A0A3B5Q2N7_BAD-01      accctcacgcttc--------------ctg--------agctcc----ga
I3K7B6_BAD-01          acacttgcccttc--------------ctg--------taatca----aa
A0A3B4GXJ6_BAD-01      acgctttcccttc--------------ctg--------taatca----aa
A0A3B5K831_BAD-01      accctgactctac--------------ctg--------aactca----ga
H3D8J8_BAD-01          --------------------------------------------------
G3Q8B3_BAD-01          accctcaccttac--------------ctg--------agctca----ga
A0A3B5BAL2_BAD-01      aacctcgccttac--------------ctg--------aactca----ga
A0A2U9BAC9_BAD-01      accctcgccctcc--------------ctg--------agctgc----ga
A0A3B4VFC5_BAD-01      accctcaccttgc--------------ctg--------aactcc----ga
A0A3B4W9T1_BAD-01      accctcaccttgc--------------ctg--------aactcc----ga
                                                                         

C1C3S9_BAD-01          gagacgaataaaaggaaaagaaactcggcaacggacagaa----------
F6Z067_BAD-01          gcgaagatacccagggaaggagtcacgtttacgcactgag----------
A7MCM4_BAD-01          agcaactgggcagaca---gag---------------gaa----------
Q4V925_BAD-03          agcaactgggcagaca---gag---------------gaa----------
Q4V925_BAD-02          agcaactgggcagaca---gag---------------gaa----------
Q4V925_BAD-01          agcaactgggcagaca---gag---------------gaa----------
Q4V925_BAD-04          agcaactgggcagaca---gag---------------gaa----------
A0A3B1IH05_BAD-01      agc------ccaggca---aag---------------gaa----------
A0A3B4CPH6_BAD-01      agt------caaggca---gag---------------gaa----------
A0A3B3QX41_BAD-01      gct------ggaggtc---gtgtac-ggatgcggtccgaa----------
A0A1W4YVX7_BAD-01      ccg------ggcagcc---gagtga-gggtgctgtctgaa----------
A0A1W4YVX7_BAD-02      ccg------ggcagcc---gagtga-gggtgctgtctgaa----------
E7FBJ6_BAD-01          ---------------gggcgtgtgc-ggctctattcggaa----------
B5X1T1_BAD-01          ------------ggtgggcgagtgc-ggctctactccgag----------
B5XEF1_BAD-01          ------------ggtgagcgagtcc-ggctctactcagag----------
A0A2D0SYM2_BAD-01      ---------gtcggaggtcgagtac-gactctactctgag----------
A0A3B1JLM2_BAD-01      ctgttggaggtggggggtcgagtga-ggctctactcagag----------
A0A3B4DUY7_BAD-01      ctgtcagaggttgggtgtcgtgttc-ggctgtactctgag----------
H3ANP3_BAD-03          acccgggacctcacca---gagcca-ccccccttctcacacaggtgtata
H3ANP3_BAD-02          acccgggacctcacca---gagcca-ccccccttctcac-----------
H3ANP3_BAD-01          acccgggacctcacca---gagcca-ccccccttctcac-----------
H3ANP3_BAD-04          acccgggacctcacca---gagcca-ccccccttctcacacagttttttg
G3VRY4_BAD-02          -----------cagcacctggagc--------------------------
G3VRY4_BAD-01          -----------cagcacctggagc--------------------------
Q61337_BAD-02          gcaacattcatcagca---gggacg-ggc---agccacca----------
Q61337_BAD-01          gcaacattcatcagca---gggacg-ggc---agccacca----------
Q61337_BAD-03          gcaacattcatcagca---gggacg-ggc---agccacca----------
O35147_BAD-01          gcatcgttcagcagcagccgggaca-ggc---agccaata----------
Q6P7C5_BAD-01          gcatcgttcagcagcagccgggaca-ggc---agccaata----------
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          actccagtcaccagca---ggggca-gcc---gaccagca----------
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          acaccagtcaccagca---gaggca-gctgagaagcagca----------
H0WVR2_BAD-01          acgccagtcacctgca---ggggca-gcc---ggccagca----------
A0A2K6GWV0_BAD-01      acgccagtcaccagca---ggggca-gcc---cagcagca----------
W5P8G9_BAD-01          aagctggtcaccagca---ggggca-gcc---ggccggca----------
F1MUT9_BAD-01          aagctggtcaccagca---ggggca-gcc---ggccggca----------
Q3SYZ0_BAD-01          aagctggtcaccagca---ggggca-gcc---ggccggca----------
G1P8C5_BAD-01          aagctggtcaccagca---gggcca-gcc---ggccagca----------
I3MBM5_BAD-02          acacgggtcaccagca---gtggca-ggc---aaccagca----------
I3MBM5_BAD-01          acacgggtcaccagca---gtggca-ggc---aaccagca----------
A0A287AEF3_BAD-02      aagctggtcaccagca---ggggca-gcc---ggccagca----------
A0A287AEF3_BAD-01      aagctggtcaccagca---ggggca-gcc---ggccagca----------
G1MI17_BAD-01          aagctgctcaccccca---ggggca-gcc---ggccagca----------
M3YNE7_BAD-01          aagctggtcaccagca---ggggca-gcc---ggccagca----------
A0A337SAW2_BAD-01      aagctggtcaccagca---ggggca-gcc---cgccagca----------
F1PK10_BAD-01          aagctggtcaccagca---ggggca-gcc---agccagcc----------
Q45KI9_BAD-01          aagctggtcaccagca---ggggca-gcc---agccagcc----------
F7DN67_BAD-01          aagctggtcaccagca---ggggca-gcc---ggccagca----------
A0A2I2Z8C7_BAD-03      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2R8Z697_BAD-02      acgccagtcaccagca---ggagca-gcc---aaccagca----------
Q92934_BAD-03          acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2I3TBK7_BAD-01      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2I3MCN5_BAD-03      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K5VCD8_BAD-02      acgccagtcaccagca---ggagca-gcc---aaccagca----------
F7GVS7_BAD-02          acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K6E7J3_BAD-02      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K5M0C1_BAD-02      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K5XJR2_BAD-02      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K5E6K7_BAD-02      acgccagtcaccagca---gggaca-gcc---aaccagca----------
A0A2K6TG62_BAD-02      acgccagtcaccagca---gggaca-gcc---aaccagca----------
A0A2R8Z697_BAD-03      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2I2Z8C7_BAD-04      acgccagtcaccagca---ggagca-gcc---aaccagca----------
Q92934_BAD-04          acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2I3TBK7_BAD-03      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K5M0C1_BAD-03      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K5XJR2_BAD-03      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2I3MCN5_BAD-02      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K5VCD8_BAD-03      acgccagtcaccagca---ggagca-gcc---aaccagca----------
F7GVS7_BAD-03          acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K6E7J3_BAD-03      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K5HKW9_BAD-02      acgccagtcaccagca---ggagca-ggc---aaccagca----------
A0A2K6N1A1_BAD-02      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K6PUM5_BAD-02      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K5HKW9_BAD-01      acgccagtcaccagca---ggagca-ggc---aaccagca----------
A0A2K6N1A1_BAD-01      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K6PUM5_BAD-01      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A0D9R491_BAD-01      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2I3MCN5_BAD-04      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2I3MCN5_BAD-01      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K5M0C1_BAD-01      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K5XJR2_BAD-01      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K5VCD8_BAD-01      acgccagtcaccagca---ggagca-gcc---aaccagca----------
F7GVS7_BAD-01          acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K6E7J3_BAD-01      acgccagtcaccagca---ggagca-gcc---aaccagca----------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      acgccagtcaccagca---ggagca-gcc---aaccagca----------
B4DZQ9_BAD-01          acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2I3TBK7_BAD-02      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2I2Z8C7_BAD-02      acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2I2Z8C7_BAD-01      acgccagtcaccagca---ggagca-gcc---aaccagca----------
Q92934_BAD-02          acgccagtcaccagca---ggagca-gcc---aaccagca----------
Q92934_BAD-01          acgccagtcaccagca---ggagca-gcc---aaccagca----------
A0A2K5E6K7_BAD-01      acgccagtcaccagca---gggaca-gcc---aaccagca----------
F6SJL0_BAD-01          acgccagtcaccagca---gggaca-gtc---aaccagca----------
A0A2K6TG62_BAD-01      acgccagtcaccagca---gggaca-gcc---aaccagca----------
A0A2K5E6K7_BAD-03      acgccagtcaccagca---gggaca-gcc---aaccagca----------
F6SJL0_BAD-02          acgccagtcaccagca---gggaca-gtc---aaccagca----------
A0A2K6TG62_BAD-03      acgccagtcaccagca---gggaca-gcc---aaccagca----------
A0A3B3HDU2_BAD-01      ctcacaagtaacgggc---gtacca-ggctgaattcagag----------
A0A3B3BQF7_BAD-01      cttacaagtaacgggc---gtacca-ggctgaattcagag----------
A0A3B3YFR1_BAD-01      tctaca---acaggtc---gggtga-gactgaactcggag----------
A0A087X8P8_BAD-01      tctaca---acaggtc---gggtga-gactgaactcggag----------
A0A3B3UA11_BAD-01      tctaca---acaggtc---gggtga-gactgaactcggag----------
A0A3B5L9R9_BAD-01      tctaca---a----------------------------------------
A0A3B5Q2N7_BAD-01      tctaca---acaggtc---gggtga-gactgaactcggag----------
I3K7B6_BAD-01          acgacagt------ac---aaccca-a-------ccagtg----------
A0A3B4GXJ6_BAD-01      acgacagctgctggaa---ggctca-gggtgaactcagag----------
A0A3B5K831_BAD-01      ctgacaggtaccagtc---ggacca-gggtcagctcggag----------
H3D8J8_BAD-01          ---acaag---cggtc---ggatca-gggtcaactcggaa----------
G3Q8B3_BAD-01          ttgtca------ggta---gga--------aatctcaaag----------
A0A3B5BAL2_BAD-01      accccagccgccggcc---ggatca-ggctgaactcagag----------
A0A2U9BAC9_BAD-01      atggcagcaaccggtc---gaatcc-ggctgaactcggag----------
A0A3B4VFC5_BAD-01      ggggcagcgaccggtc---gaacga-ggctgaactcagag----------
A0A3B4W9T1_BAD-01      ggggcagcgaccggtc---gaacga-ggctgaactcagag----------
                                                                         

C1C3S9_BAD-01          -------tc-----------------------------------------
F6Z067_BAD-01          -------tc-----------------------------------------
A7MCM4_BAD-01          -------cc-----------------tctcgatg----------------
Q4V925_BAD-03          -------cc-----------------tctcgatg----------------
Q4V925_BAD-02          -------cc-----------------tctcgatg----------------
Q4V925_BAD-01          -------cc-----------------tctcgatg----------------
Q4V925_BAD-04          -------cc-----------------tctcgatg----------------
A0A3B1IH05_BAD-01      -------tt-----------------tttctatg----------------
A0A3B4CPH6_BAD-01      -------tc-----------------actctatg----------------
A0A3B3QX41_BAD-01      -------tccca------------ggtttcttcgat--------------
A0A1W4YVX7_BAD-01      -------tctga------------ggtctctctggg--------------
A0A1W4YVX7_BAD-02      -------tctga------------ggtctctctggg--------------
E7FBJ6_BAD-01          -------tctcaagtgtatac---agtcagc-------------------
B5X1T1_BAD-01          -------tcccaggtgtgctcccaggttggc-------------------
B5XEF1_BAD-01          -------tcccaggtgcgctcccaggttggc-------------------
A0A2D0SYM2_BAD-01      -------tcccaggtgcacac---ggtgagc-------------------
A0A3B1JLM2_BAD-01      -------tcccaagtgtacaa---catcaac-------------------
A0A3B4DUY7_BAD-01      -------tcccaggtgtacac---ggtcagc-------------------
H3ANP3_BAD-03          cggttgggtaaaacttaggaagcgaaataacatgga--------------
H3ANP3_BAD-02          -------ac---------------agataacatgga--------------
H3ANP3_BAD-01          -------ac---------------agataacatgga--------------
H3ANP3_BAD-04          gggatttac---------------agataacatgga--------------
G3VRY4_BAD-02          --------c---------------caccaccatgag--------------
G3VRY4_BAD-01          --------c---------------caccaccatgag--------------
Q61337_BAD-02          -------ac---------------agtcatcatgga--------------
Q61337_BAD-01          -------ac---------------agtcatcatgga--------------
Q61337_BAD-03          -------ac---------------agtcatcatgga--------------
O35147_BAD-01          -------ac---------------agtcatcatgga--------------
Q6P7C5_BAD-01          -------ac---------------agtcatcatgga--------------
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          -------gc---------------ggccaccatgga--------------
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          -------gg---------------agccaccatgga--------------
H0WVR2_BAD-01          -------ac---------------acccaccatgga--------------
A0A2K6GWV0_BAD-01      -------gc---------------agccaccatgg---------------
W5P8G9_BAD-01          -------gc---------------agccaccatgga--------------
F1MUT9_BAD-01          -------gc---------------agccaccatgga--------------
Q3SYZ0_BAD-01          -------gc---------------agccaccatgga--------------
G1P8C5_BAD-01          -------gc---------------agccaccatgac--------------
I3MBM5_BAD-02          -------gc---------------agcaaccatgga--------------
I3MBM5_BAD-01          -------gc---------------agcaaccatgga--------------
A0A287AEF3_BAD-02      -------gc---------------agccaccatgga--------------
A0A287AEF3_BAD-01      -------gc---------------agccaccatgga--------------
G1MI17_BAD-01          -------gc---------------aaccaccatgga--------------
M3YNE7_BAD-01          -------gc---------------agccaccatgga--------------
A0A337SAW2_BAD-01      -------gc---------------aaccaccatgga--------------
F1PK10_BAD-01          -------gc---------------aaacaccatgga--------------
Q45KI9_BAD-01          -------gc---------------aaacaccatgga--------------
F7DN67_BAD-01          -------gc---------------agccaccatgga--------------
A0A2I2Z8C7_BAD-03      -------gc---------------agccatcatgga--------------
A0A2R8Z697_BAD-02      -------gc---------------agccatcatgga--------------
Q92934_BAD-03          -------gc---------------agccatcatgga--------------
A0A2I3TBK7_BAD-01      -------gc---------------agccatcatgga--------------
A0A2I3MCN5_BAD-03      -------gc---------------agccatcatgg---------------
A0A2K5VCD8_BAD-02      -------gc---------------agccatcatgg---------------
F7GVS7_BAD-02          -------gc---------------agccatcatgg---------------
A0A2K6E7J3_BAD-02      -------gc---------------agccatcatgg---------------
A0A2K5M0C1_BAD-02      -------gc---------------agccatcatgg---------------
A0A2K5XJR2_BAD-02      -------gc---------------agccatcatgg---------------
A0A2K5E6K7_BAD-02      -------gc---------------agccaccatgga--------------
A0A2K6TG62_BAD-02      -------gc---------------agccaccatgga--------------
A0A2R8Z697_BAD-03      -------gc---------------agccatcatggagggagaacttcgta
A0A2I2Z8C7_BAD-04      -------gc---------------agccatcatggagggagaacttcgta
Q92934_BAD-04          -------gc---------------agccatcatggagggagaacttcgta
A0A2I3TBK7_BAD-03      -------gc---------------agccatcatggagggagaacttcgta
A0A2K5M0C1_BAD-03      -------gc---------------agccatcatggagggggagcttggta
A0A2K5XJR2_BAD-03      -------gc---------------agccatcatggagggggagcttggta
A0A2I3MCN5_BAD-02      -------gc---------------agccatcatggagggagagcttggta
A0A2K5VCD8_BAD-03      -------gc---------------agccatcatggagggagagcttggta
F7GVS7_BAD-03          -------gc---------------agccatcatggagggagagcttggta
A0A2K6E7J3_BAD-03      -------gc---------------agccatcatggagggagagcttggta
A0A2K5HKW9_BAD-02      -------gc---------------agccatcatggagggagagcttggta
A0A2K6N1A1_BAD-02      -------gc---------------agccatcatggagggagagcttggta
A0A2K6PUM5_BAD-02      -------gc---------------agccatcatggagggagagcttggta
A0A2K5HKW9_BAD-01      -------gc---------------agccatcatgga--------------
A0A2K6N1A1_BAD-01      -------gc---------------agccatcatgga--------------
A0A2K6PUM5_BAD-01      -------gc---------------agccatcatgga--------------
A0A0D9R491_BAD-01      -------gc---------------agccatcatgga--------------
A0A2I3MCN5_BAD-04      -------gc---------------agccatcatgga--------------
A0A2I3MCN5_BAD-01      -------gc---------------agccatcatgga--------------
A0A2K5M0C1_BAD-01      -------gc---------------agccatcatgga--------------
A0A2K5XJR2_BAD-01      -------gc---------------agccatcatgga--------------
A0A2K5VCD8_BAD-01      -------gc---------------agccatcatgga--------------
F7GVS7_BAD-01          -------gc---------------agccatcatgga--------------
A0A2K6E7J3_BAD-01      -------gc---------------agccatcatgga--------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      -------gc---------------agccatcatgga--------------
B4DZQ9_BAD-01          -------gc---------------agccatcatgga--------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      -------gc---------------agccatcatgga--------------
A0A2I3TBK7_BAD-02      -------gc---------------agccatcatgga--------------
A0A2I2Z8C7_BAD-02      -------gc---------------agccatcatgga--------------
A0A2I2Z8C7_BAD-01      -------gc---------------agccatcatgga--------------
Q92934_BAD-02          -------gc---------------agccatcatgga--------------
Q92934_BAD-01          -------gc---------------agccatcatgga--------------
A0A2K5E6K7_BAD-01      -------gc---------------agccaccatgga--------------
F6SJL0_BAD-01          -------gc---------------agccaccatgga--------------
A0A2K6TG62_BAD-01      -------gc---------------agccaccatgga--------------
A0A2K5E6K7_BAD-03      -------gc---------------agccaccatggaggtgagtactccac
F6SJL0_BAD-02          -------gc---------------agccaccatgga--------------
A0A2K6TG62_BAD-03      -------gc---------------agccaccatgga--------------
A0A3B3HDU2_BAD-01      -------tc---------------caccgcttccac--------------
A0A3B3BQF7_BAD-01      -------tc---------------caccgtttcgac--------------
A0A3B3YFR1_BAD-01      -------tc---------------catcgcttccac--------------
A0A087X8P8_BAD-01      -------tc---------------catcgcttccac--------------
A0A3B3UA11_BAD-01      -------tc---------------catcgcttccac--------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      -------tc---------------catcgcttccac--------------
I3K7B6_BAD-01          -------ga---------------acgcactt------------------
A0A3B4GXJ6_BAD-01      -------tc---------------ccacacttcctc--------------
A0A3B5K831_BAD-01      -------tc---------------ccaggcgtccac--------------
H3D8J8_BAD-01          -------tc---------------ccaagcatccgc--------------
G3Q8B3_BAD-01          ---------------------------------aat--------------
A0A3B5BAL2_BAD-01      -------tc---------------ccacgcgaccac--------------
A0A2U9BAC9_BAD-01      -------tc---------------caacgcttccac--------------
A0A3B4VFC5_BAD-01      -------tc---------------ccacacttccac--------------
A0A3B4W9T1_BAD-01      -------tc---------------ccacacttccac--------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
F6Z067_BAD-01          --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-02      --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
A0A2D0SYM2_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
G3VRY4_BAD-02          --------------------------------------------------
G3VRY4_BAD-01          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
O35147_BAD-01          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
I3MBM5_BAD-02          --------------------------------------------------
I3MBM5_BAD-01          --------------------------------------------------
A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
G1MI17_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
A0A2I2Z8C7_BAD-03      --------------------------------------------------
A0A2R8Z697_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-03      --------------------------------------------------
A0A2K5VCD8_BAD-02      --------------------------------------------------
F7GVS7_BAD-02          --------------------------------------------------
A0A2K6E7J3_BAD-02      --------------------------------------------------
A0A2K5M0C1_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
A0A2K5E6K7_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2R8Z697_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcagggatgc
A0A2I2Z8C7_BAD-04      ttctccttcttgggaatctgaggactctgaaaatcccagtgcagggatgc
Q92934_BAD-04          ttctccttcttgggaatctgaggactctgaaaatcccagtgcagggatgc
A0A2I3TBK7_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcagggatgc
A0A2K5M0C1_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc
A0A2K5XJR2_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc
A0A2I3MCN5_BAD-02      ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc
A0A2K5VCD8_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc
F7GVS7_BAD-03          ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc
A0A2K6E7J3_BAD-03      ttctccttcttgggaatctgaggactctgaaaatcccagtgcaaggatgc
A0A2K5HKW9_BAD-02      ttctccttct---gaatctgaggactctgaaaatcccagtgcaaggatgc
A0A2K6N1A1_BAD-02      ttatcctgct---gaatctgaggactctgaaaatcccagtgcaaggatgc
A0A2K6PUM5_BAD-02      ttatcctgct---gaatctgaggactctgaaaatcccagtgcaaggatgc
A0A2K5HKW9_BAD-01      --------------------------------------------------
A0A2K6N1A1_BAD-01      --------------------------------------------------
A0A2K6PUM5_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-04      --------------------------------------------------
A0A2I3MCN5_BAD-01      --------------------------------------------------
A0A2K5M0C1_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5VCD8_BAD-01      --------------------------------------------------
F7GVS7_BAD-01          --------------------------------------------------
A0A2K6E7J3_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
A0A2K5E6K7_BAD-01      --------------------------------------------------
F6SJL0_BAD-01          --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6K7_BAD-03      ttgtgcctct------gcttcctcatctgagaatcccagtgcaaggatgc
F6SJL0_BAD-02          ----------------------------gagaatcccagtgtaaggatgt
A0A2K6TG62_BAD-03      ----------------------------gagaatcccagtgcaaagatgc
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3B5K831_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
F6Z067_BAD-01          --------------------------------------------------
A7MCM4_BAD-01          --------------------------------------------------
Q4V925_BAD-03          --------------------------------------------------
Q4V925_BAD-02          --------------------------------------------------
Q4V925_BAD-01          --------------------------------------------------
Q4V925_BAD-04          --------------------------------------------------
A0A3B1IH05_BAD-01      --------------------------------------------------
A0A3B4CPH6_BAD-01      --------------------------------------------------
A0A3B3QX41_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-01      --------------------------------------------------
A0A1W4YVX7_BAD-02      --------------------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
A0A2D0SYM2_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
G3VRY4_BAD-02          --------------------------------------------------
G3VRY4_BAD-01          --------------------------------------------------
Q61337_BAD-02          --------------------------------------------------
Q61337_BAD-01          --------------------------------------------------
Q61337_BAD-03          --------------------------------------------------
O35147_BAD-01          --------------------------------------------------
Q6P7C5_BAD-01          --------------------------------------------------
G1SS60_BAD-01          --------------------------------------------------
G3TP47_BAD-01          --------------------------------------------------
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --------------------------------------------------
H0WVR2_BAD-01          --------------------------------------------------
A0A2K6GWV0_BAD-01      --------------------------------------------------
W5P8G9_BAD-01          --------------------------------------------------
F1MUT9_BAD-01          --------------------------------------------------
Q3SYZ0_BAD-01          --------------------------------------------------
G1P8C5_BAD-01          --------------------------------------------------
I3MBM5_BAD-02          --------------------------------------------------
I3MBM5_BAD-01          --------------------------------------------------
A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      --------------------------------------------------
G1MI17_BAD-01          --------------------------------------------------
M3YNE7_BAD-01          --------------------------------------------------
A0A337SAW2_BAD-01      --------------------------------------------------
F1PK10_BAD-01          --------------------------------------------------
Q45KI9_BAD-01          --------------------------------------------------
F7DN67_BAD-01          --------------------------------------------------
A0A2I2Z8C7_BAD-03      ----------------------------------------gaagggactt
A0A2R8Z697_BAD-02      ----------------------------------------gaagggactt
Q92934_BAD-03          ----------------------------------------gaagggactt
A0A2I3TBK7_BAD-01      ----------------------------------------gaagggactt
A0A2I3MCN5_BAD-03      ------------------------------------------agggactt
A0A2K5VCD8_BAD-02      ------------------------------------------agggactt
F7GVS7_BAD-02          ------------------------------------------agggactt
A0A2K6E7J3_BAD-02      ------------------------------------------agggactt
A0A2K5M0C1_BAD-02      ------------------------------------------agggactt
A0A2K5XJR2_BAD-02      ------------------------------------------agggactt
A0A2K5E6K7_BAD-02      -------------------------------------------gggactt
A0A2K6TG62_BAD-02      -------------------------------------------gggactt
A0A2R8Z697_BAD-03      tcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcc
A0A2I2Z8C7_BAD-04      tcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcc
Q92934_BAD-04          tcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcc
A0A2I3TBK7_BAD-03      ttgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcc
A0A2K5M0C1_BAD-03      tcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcc
A0A2K5XJR2_BAD-03      tcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcc
A0A2I3MCN5_BAD-02      tcgcggaagcatcagcaccgatgtctgccccagccactgactcagaagcc
A0A2K5VCD8_BAD-03      tcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcc
F7GVS7_BAD-03          tcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcc
A0A2K6E7J3_BAD-03      tcgcggaagcatcagcacggatgtctgccccagccactgactcagaagcc
A0A2K5HKW9_BAD-02      tcacggaagcatcagcagggatgtctgccccagccactgactcagaagcc
A0A2K6N1A1_BAD-02      tcgcggaagcatcagcagggatgtctgccccagccactgactcagaagcc
A0A2K6PUM5_BAD-02      tcgcggaagcatcagcagggatgtctgccccagccactgactcagaagcc
A0A2K5HKW9_BAD-01      --------------------------------------------------
A0A2K6N1A1_BAD-01      --------------------------------------------------
A0A2K6PUM5_BAD-01      --------------------------------------------------
A0A0D9R491_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-04      --------------------------------------------------
A0A2I3MCN5_BAD-01      --------------------------------------------------
A0A2K5M0C1_BAD-01      --------------------------------------------------
A0A2K5XJR2_BAD-01      --------------------------------------------------
A0A2K5VCD8_BAD-01      --------------------------------------------------
F7GVS7_BAD-01          --------------------------------------------------
A0A2K6E7J3_BAD-01      --------------------------------------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------------------------------
B4DZQ9_BAD-01          --------------------------------------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      --------------------------------------------------
A0A2I3TBK7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-02      --------------------------------------------------
A0A2I2Z8C7_BAD-01      --------------------------------------------------
Q92934_BAD-02          --------------------------------------------------
Q92934_BAD-01          --------------------------------------------------
A0A2K5E6K7_BAD-01      --------------------------------------------------
F6SJL0_BAD-01          --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K5E6K7_BAD-03      tctcgaaagcatcagcagggatgtccgccccagccactgactcagaa---
F6SJL0_BAD-02          tctcgaaagcatcagcagggatgtccgccccagccactgactcagaagcc
A0A2K6TG62_BAD-03      tctcgaaagcatcagcagggatgtctgccccagccactgactcagaagcc
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      --------------------------------------------------
A0A087X8P8_BAD-01      --------------------------------------------------
A0A3B3UA11_BAD-01      --------------------------------------------------
A0A3B5L9R9_BAD-01      --------------------------------------------------
A0A3B5Q2N7_BAD-01      --------------------------------------------------
I3K7B6_BAD-01          --------------------------------------------------
A0A3B4GXJ6_BAD-01      --------------------------------------------------
A0A3B5K831_BAD-01      --------------------------------------------------
H3D8J8_BAD-01          --------------------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3B5BAL2_BAD-01      --------------------------------------------------
A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A3B4VFC5_BAD-01      --------------------------------------------------
A0A3B4W9T1_BAD-01      --------------------------------------------------
                                                                         

C1C3S9_BAD-01          -------------------------tgcttcagaagcctcagagac----
F6Z067_BAD-01          ----------------------------------tgcttcagagtcc---
A7MCM4_BAD-01          -----------------------------------aatgaggaggacttg
Q4V925_BAD-03          -----------------------------------aatgaggaggacttg
Q4V925_BAD-02          -----------------------------------aatgaggaggacttg
Q4V925_BAD-01          -----------------------------------aatgaggaggacttg
Q4V925_BAD-04          -----------------------------------aatgaggaggacttg
A0A3B1IH05_BAD-01      -----------------------------------aatgaagaggctctg
A0A3B4CPH6_BAD-01      -----------------------------------aatgaggatgccctt
A0A3B3QX41_BAD-01      -------------------------------tcgaagcgaggatctcgat
A0A1W4YVX7_BAD-01      -------------------------------tcgaagtgaagagcccgat
A0A1W4YVX7_BAD-02      -------------------------------tcgaagtgaagagcccgat
E7FBJ6_BAD-01          --------------------------cgctggcaggacacagagacccag
B5X1T1_BAD-01          --------------------------agaagggacaacacagagtttcag
B5XEF1_BAD-01          --------------------------aaaagggaagacacagagtttcag
A0A2D0SYM2_BAD-01      --------------------------cgctgggaagatgctgagctccag
A0A3B1JLM2_BAD-01      --------------------------cgctgggaggacaatgagaaccag
A0A3B4DUY7_BAD-01      --------------------------cgctggcaggacaatg------ag
H3ANP3_BAD-03          --------------------------gattctggggcgtccaagttccga
H3ANP3_BAD-02          --------------------------gattctggggcgtccaagttccga
H3ANP3_BAD-01          --------------------------gattctggggcgtccaagttccga
H3ANP3_BAD-04          --------------------------gattctggggcgtccaagttccga
G3VRY4_BAD-02          --------------------------aaggggggagcccagaagtcccag
G3VRY4_BAD-01          --------------------------ggcgccggcgcggggaggcctc--
Q61337_BAD-02          --------------------------ggcgcaggggctatggagactcgg
Q61337_BAD-01          --------------------------ggcgcaggggctatggagactcgg
Q61337_BAD-03          --------------------------ggcgcaggggctatggagactcgg
O35147_BAD-01          --------------------------ggcgctgggactatggagacccgg
Q6P7C5_BAD-01          --------------------------ggt---------------------
G1SS60_BAD-01          --------------------------ggcgccggagctatggaaacccgg
G3TP47_BAD-01          --------------------------ggtgctgcggctgtggagacccgg
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --------------------------ggcactgtggctatggagacccgg
H0WVR2_BAD-01          -----------------------gcaggacctggggcagtggagacccgg
A0A2K6GWV0_BAD-01      -------------------------aggagctgggtctgtggagacccgg
W5P8G9_BAD-01          --------------------------ggcactggggctgtggagacccgg
F1MUT9_BAD-01          --------------------------ggcactggggctgtggagacccgg
Q3SYZ0_BAD-01          --------------------------ggcactggggctgtggagacccgg
G1P8C5_BAD-01          --------------------------ggcgctgggtctgtggagccgcgg
I3MBM5_BAD-02          --------------------------ggcgctggggctacggagacccgg
I3MBM5_BAD-01          --------------------------ggcgctggggctacggagacccgg
A0A287AEF3_BAD-02      --------------------------ggcgctggggctgtggagacccgg
A0A287AEF3_BAD-01      --------------------------ggcgctggggctgtggagacccgg
G1MI17_BAD-01          --------------------------ggcgctggggctgtggagccccgg
M3YNE7_BAD-01          --------------------------ggcgctggggctgtggagacgcgg
A0A337SAW2_BAD-01      --------------------------ggcgctggggctgtggagacccgg
F1PK10_BAD-01          --------------------------ggcgctggggct---gagacccgg
Q45KI9_BAD-01          --------------------------ggcgctggggct---gagacccgg
F7DN67_BAD-01          --------------------------ggcgctggggcggtggagacccgg
A0A2I2Z8C7_BAD-03      cctcgcccgaagagcgcaggcacagcaacgcagatgcggcaaagctccag
A0A2R8Z697_BAD-02      cctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccag
Q92934_BAD-03          cctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccag
A0A2I3TBK7_BAD-01      cctcgcccgaagagcgcgggcacagcaacccagatgcggcaaagctccag
A0A2I3MCN5_BAD-03      cctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctccag
A0A2K5VCD8_BAD-02      cctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctccag
F7GVS7_BAD-02          cctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctccag
A0A2K6E7J3_BAD-02      cctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctccag
A0A2K5M0C1_BAD-02      cctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctccag
A0A2K5XJR2_BAD-02      cctcgcccgaagagcgcgggcacagcgacgcagatgcggcaaagctccag
A0A2K5E6K7_BAD-02      cctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccag
A0A2K6TG62_BAD-02      cctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccag
A0A2R8Z697_BAD-03      caacacgcagagaatgtaaagctagaggcgctggggctgtggagatccgg
A0A2I2Z8C7_BAD-04      caacacgcagagaatgtaaagctagaggcgctggggctgtggagatccgg
Q92934_BAD-04          caacacgcagagaatgtaaagctagaggcgctggggctgtggagatccgg
A0A2I3TBK7_BAD-03      caacacgcagagaatgtaaagctagaggcgctggggctgtggagatccgg
A0A2K5M0C1_BAD-03      caacacgcagagaatgtaaagctgaaggcgctggggctgtggagacccgg
A0A2K5XJR2_BAD-03      caactcgcagagaatgtaaagctgaaggcgctggggctgtggagacccgg
A0A2I3MCN5_BAD-02      caacacgcagagaatgtaaagctgaaggcgctggggctgtggagacgcgg
A0A2K5VCD8_BAD-03      caacacgcagagaatgtaaagctgaaggcgctggggctgtggagacccgg
F7GVS7_BAD-03          caacacgcagagaatgtaaagctgaaggcgctggggctgtggagacccgg
A0A2K6E7J3_BAD-03      caacacgcagagaatgtaaagctgaaggcgctggggctgtggagacccgc
A0A2K5HKW9_BAD-02      caacacgcagagaatgtaaagctggaggcgctggggctgtggagacccgg
A0A2K6N1A1_BAD-02      caactcgcagagaatgtaaagctggaggcgctggggctgtggagacccgg
A0A2K6PUM5_BAD-02      caactcgcagagaatgtaaagctggaggcgctggggctgtggagacccgg
A0A2K5HKW9_BAD-01      --------------------------ggcgctggggctgtggagacccgg
A0A2K6N1A1_BAD-01      --------------------------ggcgctggggctgtggagacccgg
A0A2K6PUM5_BAD-01      --------------------------ggcgctggggctgtggagacccgg
A0A0D9R491_BAD-01      --------------------------ggcgctggggctgtggagacccgg
A0A2I3MCN5_BAD-04      --------------------------ggcgctggggctgtggagacgcgg
A0A2I3MCN5_BAD-01      --------------------------ggcgctggggctgtggagacgcgg
A0A2K5M0C1_BAD-01      --------------------------ggcgctggggctgtggagacccgg
A0A2K5XJR2_BAD-01      --------------------------ggcgctggggctgtggagacccgg
A0A2K5VCD8_BAD-01      --------------------------ggcgctggggctgtggagacccgg
F7GVS7_BAD-01          --------------------------ggcgctggggctgtggagacccgg
A0A2K6E7J3_BAD-01      --------------------------ggcgctggggctgtggagacccgc
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --------------------------ggcgctggggctgtggagatccgg
B4DZQ9_BAD-01          --------------------------ggcgctggggctgtggagatccgg
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      --------------------------ggcgctggggctgtggagatccgg
A0A2I3TBK7_BAD-02      --------------------------ggcgctggggctgtggagatccgg
A0A2I2Z8C7_BAD-02      --------------------------ggcgctggggctgtggagatccgg
A0A2I2Z8C7_BAD-01      --------------------------ggcgctggggctgtggagatccgg
Q92934_BAD-02          --------------------------ggcgctggggctgtggagatccgg
Q92934_BAD-01          --------------------------ggcgctggggctgtggagatccgg
A0A2K5E6K7_BAD-01      --------------------------ggcgctggggctgtggagacccga
F6SJL0_BAD-01          --------------------------ggcgctggggctgtggagacccgg
A0A2K6TG62_BAD-01      --------------------------ggcgctggagccgtggagacacgg
A0A2K5E6K7_BAD-03      ------------aatgtaaagctggaggtgccttg------------ctg
F6SJL0_BAD-02          caacacacagagaatgtaaagctggaggcgctggggctgtggagacccgg
A0A2K6TG62_BAD-03      caacacacagagaatgtaaagctggaggcgctggagccgtggagacacgg
A0A3B3HDU2_BAD-01      -------------------------gtactccagagatgaggacctcgcg
A0A3B3BQF7_BAD-01      -------------------------gtactccagagatgaagacctcccg
A0A3B3YFR1_BAD-01      -------------------------catctccagagaggaggagctgcag
A0A087X8P8_BAD-01      -------------------------catctccagagaggaggagctgcag
A0A3B3UA11_BAD-01      -------------------------catctccagagaggaggagctgcag
A0A3B5L9R9_BAD-01      ------------------------------------aggtggagctgcag
A0A3B5Q2N7_BAD-01      -------------------------catctccagagaggtggagctgcag
I3K7B6_BAD-01          --------------------------ggcatgagggatgaggacctcatg
A0A3B4GXJ6_BAD-01      -------------------------aattgccagggatgaggagctcatg
A0A3B5K831_BAD-01      -------------------------cttctccagagaggaagagcttcag
H3D8J8_BAD-01          -------------------------cgtctccagagacgaggagctccag
G3Q8B3_BAD-01          -------------------------tgtggaaaaagaagaggagct----
A0A3B5BAL2_BAD-01      -------------------------ggtctccagagacgaggagctccag
A0A2U9BAC9_BAD-01      -------------------------tctctcacgagacgaggagctcctg
A0A3B4VFC5_BAD-01      -------------------------tgtctccagagacgaagagttccag
A0A3B4W9T1_BAD-01      -------------------------tgtctccagagatgaggagttccag
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
F6Z067_BAD-01          --------------------------------------------------
A7MCM4_BAD-01          ctggaaactgga--------------------------------------
Q4V925_BAD-03          ctggaaactgga--------------------------------------
Q4V925_BAD-02          ctggaaactgga--------------------------------------
Q4V925_BAD-01          ctggaaactgga--------------------------------------
Q4V925_BAD-04          ctggaaactgga--------------------------------------
A0A3B1IH05_BAD-01      caggagtctggt--------------------------------------
A0A3B4CPH6_BAD-01      caggaatctggg--------------------------------------
A0A3B3QX41_BAD-01      tttggtgaagga--------------------------------------
A0A1W4YVX7_BAD-01      ttaaataacaga--------------------------------------
A0A1W4YVX7_BAD-02      ttaaataacaga--------------------------------------
E7FBJ6_BAD-01          --------------------------------------------------
B5X1T1_BAD-01          --------------------------------------------------
B5XEF1_BAD-01          --------------------------------------------------
A0A2D0SYM2_BAD-01      --------------------------------------------------
A0A3B1JLM2_BAD-01      --------------------------------------------------
A0A3B4DUY7_BAD-01      --------------------------------------------------
H3ANP3_BAD-03          ----gtccca-----gatctcagactca----------------------
H3ANP3_BAD-02          ----gtccca-----gatctcagactca----------------------
H3ANP3_BAD-01          ----gtccca-----gatctcagactca----------------------
H3ANP3_BAD-04          ----gtccca-----gatctcagactca----------------------
G3VRY4_BAD-02          acccatgtctcaaaagagctcaaagcctctgctagtcaagggagattagg
G3VRY4_BAD-01          ------gcct-----gatctcctaccccccgcta----------------
Q61337_BAD-02          --agtcgcca-----cagttcgtaccca----------------------
Q61337_BAD-01          --agtcgcca-----cagttcgtaccca----------------------
Q61337_BAD-03          --agtcgcca-----cagttcgtaccca----------------------
O35147_BAD-01          --agtcgcca-----cagttcgtaccca----------------------
Q6P7C5_BAD-01          --------------------------------------------------
G1SS60_BAD-01          --agccgcca-----cagctcgtaccct----------------------
G3TP47_BAD-01          --agtcgcca-----cagctcatacccc----------------------
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          --agtcgcca-----ccggtcttatcct----------------------
H0WVR2_BAD-01          --agtcgcca-----cagctcgtacccg----------------------
A0A2K6GWV0_BAD-01      --agtcgcca-----cagctcgtacccc----------------------
W5P8G9_BAD-01          --agtcgtca-----cagctcctacccc----------------------
F1MUT9_BAD-01          --agtcgtca-----cagctcctaccgc----------------------
Q3SYZ0_BAD-01          --agtcgtca-----cagctcctaccgc----------------------
G1P8C5_BAD-01          --agtcgcca-----cagctcgtacccc----------------------
I3MBM5_BAD-02          --agtcgcca-----cagctcgtacccc----------------------
I3MBM5_BAD-01          --agtcgcca-----cagctcgtacccc----------------------
A0A287AEF3_BAD-02      --agtcgcca-----cagctcttaccca----------------------
A0A287AEF3_BAD-01      --agtcgcca-----cagctcttaccca----------------------
G1MI17_BAD-01          --agtcgcca-----cagctcgtacccc----------------------
M3YNE7_BAD-01          --agtcgcca-----cagctcgtacccc----------------------
A0A337SAW2_BAD-01      --agtcgcca-----cagctcgtacccc----------------------
F1PK10_BAD-01          --agtcgcca-----cagctcgttcccc----------------------
Q45KI9_BAD-01          --agtcgcca-----cagctcgttcccc----------------------
F7DN67_BAD-01          --agtcgcca-----tagctcgtacccc----------------------
A0A2I2Z8C7_BAD-03      ctggacgcga-----gtcttccagtcct----------------------
A0A2R8Z697_BAD-02      ctggacgcga-----gtcttccagtcct----------------------
Q92934_BAD-03          ctggacgcga-----gtcttccagtcct----------------------
A0A2I3TBK7_BAD-01      ctggacgcga-----gtcttccagtcct----------------------
A0A2I3MCN5_BAD-03      ctggacgcga-----gtcttccagtcct----------------------
A0A2K5VCD8_BAD-02      ctggacgcga-----gtcttccagtcct----------------------
F7GVS7_BAD-02          ctggacgcga-----gtcttccagtcct----------------------
A0A2K6E7J3_BAD-02      ctggacgcga-----gtcttccagtcct----------------------
A0A2K5M0C1_BAD-02      ctggacgcga-----gtcttccagtcct----------------------
A0A2K5XJR2_BAD-02      ctggacgcga-----gtcttccagtcct----------------------
A0A2K5E6K7_BAD-02      ttggacgcaa-----gtcatccagtcct----------------------
A0A2K6TG62_BAD-02      ctggacgcga-----gtcatccagtcct----------------------
A0A2R8Z697_BAD-03      --agtcgcca-----cagctcctacccc----------------------
A0A2I2Z8C7_BAD-04      --agtcgcca-----cagctcctacccc----------------------
Q92934_BAD-04          --agtcgcca-----cagctcctacccc----------------------
A0A2I3TBK7_BAD-03      --agtcgcca-----cagctcctacccc----------------------
A0A2K5M0C1_BAD-03      --agtcgcca-----cagctcctacccc----------------------
A0A2K5XJR2_BAD-03      --agtcgcca-----cagctcctacccc----------------------
A0A2I3MCN5_BAD-02      --agtcgcca-----cagctcctacccc----------------------
A0A2K5VCD8_BAD-03      --agtcgcca-----cagctcctacccc----------------------
F7GVS7_BAD-03          --agtcgcca-----cagctcctacccc----------------------
A0A2K6E7J3_BAD-03      --agtcgcca-----cagctcctacccc----------------------
A0A2K5HKW9_BAD-02      --agtcgcca-----cagctcccacccc----------------------
A0A2K6N1A1_BAD-02      --agtcgcca-----cagctcctacccc----------------------
A0A2K6PUM5_BAD-02      --agtcgcca-----cagctcctacccc----------------------
A0A2K5HKW9_BAD-01      --agtcgcca-----cagctcccacccc----------------------
A0A2K6N1A1_BAD-01      --agtcgcca-----cagctcctacccc----------------------
A0A2K6PUM5_BAD-01      --agtcgcca-----cagctcctacccc----------------------
A0A0D9R491_BAD-01      --agtcgcca-----cagctcctacccc----------------------
A0A2I3MCN5_BAD-04      --agtcgcca-----cagctcctacccc----------------------
A0A2I3MCN5_BAD-01      --agtcgcca-----cagctcctacccc----------------------
A0A2K5M0C1_BAD-01      --agtcgcca-----cagctcctacccc----------------------
A0A2K5XJR2_BAD-01      --agtcgcca-----cagctcctacccc----------------------
A0A2K5VCD8_BAD-01      --agtcgcca-----cagctcctacccc----------------------
F7GVS7_BAD-01          --agtcgcca-----cagctcctacccc----------------------
A0A2K6E7J3_BAD-01      --agtcgcca-----cagctcctacccc----------------------
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      --agtcgcca-----cagctcctacccc----------------------
B4DZQ9_BAD-01          --agtcgcca-----cagctcctacccc----------------------
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      --agtcgcca-----cagctcctacccc----------------------
A0A2I3TBK7_BAD-02      --agtcgcca-----cagctcctacccc----------------------
A0A2I2Z8C7_BAD-02      --agtcgcca-----cagctcctacccc----------------------
A0A2I2Z8C7_BAD-01      --agtcgcca-----cagctcctacccc----------------------
Q92934_BAD-02          --agtcgcca-----cagctcctacccc----------------------
Q92934_BAD-01          --agtcgcca-----cagctcctacccc----------------------
A0A2K5E6K7_BAD-01      --agtcgcca-----cagctcctacccc----------------------
F6SJL0_BAD-01          --agtcgcca-----cagctcgtacccc----------------------
A0A2K6TG62_BAD-01      --agtcgcca-----cagctcgtacccc----------------------
A0A2K5E6K7_BAD-03      --ggtcgcca-----cagctcctacccc----------------------
F6SJL0_BAD-02          --agtcgcca-----cagctcgtacccc----------------------
A0A2K6TG62_BAD-03      --agtcgcca-----cagctcgtacccc----------------------
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      ------gcca----------------------------------------
A0A087X8P8_BAD-01      ------gcca----------------------------------------
A0A3B3UA11_BAD-01      ------gcca----------------------------------------
A0A3B5L9R9_BAD-01      ------gcca----------------------------------------
A0A3B5Q2N7_BAD-01      ------gcaa----------------------------------------
I3K7B6_BAD-01          ------gcta----------------------------------------
A0A3B4GXJ6_BAD-01      ------gcta----------------------------------------
A0A3B5K831_BAD-01      ------ggga----------------------------------------
H3D8J8_BAD-01          ------ggca----------------------------------------
G3Q8B3_BAD-01          --------------------------------------------------
A0A3B5BAL2_BAD-01      ------gcca----------------------------------------
A0A2U9BAC9_BAD-01      ------acca----------------------------------------
A0A3B4VFC5_BAD-01      ------gcca----------------------------------------
A0A3B4W9T1_BAD-01      ------gcca----------------------------------------
                                                                         

C1C3S9_BAD-01          --------------------------------------------------
F6Z067_BAD-01          -------------------------------------------------a
A7MCM4_BAD-01          -------------------------------------------------g
Q4V925_BAD-03          -------------------------------------------------g
Q4V925_BAD-02          -------------------------------------------------g
Q4V925_BAD-01          -------------------------------------------------g
Q4V925_BAD-04          -------------------------------------------------g
A0A3B1IH05_BAD-01      -------------------------------------------------g
A0A3B4CPH6_BAD-01      -------------------------------------------------g
A0A3B3QX41_BAD-01      -------------------------------------------------g
A0A1W4YVX7_BAD-01      -------------------------------------------------g
A0A1W4YVX7_BAD-02      -------------------------------------------------g
E7FBJ6_BAD-01          -------------------------------------------------g
B5X1T1_BAD-01          -------------------------------------------------g
B5XEF1_BAD-01          -------------------------------------------------g
A0A2D0SYM2_BAD-01      -------------------------------------------------g
A0A3B1JLM2_BAD-01      -------------------------------------------------g
A0A3B4DUY7_BAD-01      -------------------------------------------------g
H3ANP3_BAD-03          --------------------------------------------------
H3ANP3_BAD-02          --------------------------------------------------
H3ANP3_BAD-01          --------------------------------------------------
H3ANP3_BAD-04          --------------------------------------------------
G3VRY4_BAD-02          aaaaggcagtttcgagggtagggagggctcccgggaggcgagccccgaag
G3VRY4_BAD-01          -------------------agggagggctcccgggaggcgagccccgaag
Q61337_BAD-02          -------------------------------------------------g
Q61337_BAD-01          -------------------------------------------------g
Q61337_BAD-03          -------------------------------------------------g
O35147_BAD-01          -------------------------------------------------g
Q6P7C5_BAD-01          --------------------------------------------------
G1SS60_BAD-01          -------------------------------------------------g
G3TP47_BAD-01          -------------------------------------------------g
F7GVS7_BAD-04          --------------------------------------------------
H0V608_BAD-01          -------------------------------------------------g
H0WVR2_BAD-01          -------------------------------------------------g
A0A2K6GWV0_BAD-01      -------------------------------------------------g
W5P8G9_BAD-01          -------------------------------------------------g
F1MUT9_BAD-01          -------------------------------------------------g
Q3SYZ0_BAD-01          -------------------------------------------------g
G1P8C5_BAD-01          -------------------------------------------------a
I3MBM5_BAD-02          -------------------------------------------------g
I3MBM5_BAD-01          -------------------------------------------------g
A0A287AEF3_BAD-02      -------------------------------------------------g
A0A287AEF3_BAD-01      -------------------------------------------------g
G1MI17_BAD-01          -------------------------------------------------g
M3YNE7_BAD-01          -------------------------------------------------g
A0A337SAW2_BAD-01      -------------------------------------------------g
F1PK10_BAD-01          -------------------------------------------------g
Q45KI9_BAD-01          -------------------------------------------------g
F7DN67_BAD-01          -------------------------------------------------g
A0A2I2Z8C7_BAD-03      -------------------------------------------------g
A0A2R8Z697_BAD-02      -------------------------------------------------g
Q92934_BAD-03          -------------------------------------------------g
A0A2I3TBK7_BAD-01      -------------------------------------------------g
A0A2I3MCN5_BAD-03      -------------------------------------------------g
A0A2K5VCD8_BAD-02      -------------------------------------------------g
F7GVS7_BAD-02          -------------------------------------------------g
A0A2K6E7J3_BAD-02      -------------------------------------------------g
A0A2K5M0C1_BAD-02      -------------------------------------------------g
A0A2K5XJR2_BAD-02      -------------------------------------------------g
A0A2K5E6K7_BAD-02      -------------------------------------------------g
A0A2K6TG62_BAD-02      -------------------------------------------------g
A0A2R8Z697_BAD-03      -------------------------------------------------g
A0A2I2Z8C7_BAD-04      -------------------------------------------------g
Q92934_BAD-04          -------------------------------------------------g
A0A2I3TBK7_BAD-03      -------------------------------------------------g
A0A2K5M0C1_BAD-03      -------------------------------------------------g
A0A2K5XJR2_BAD-03      -------------------------------------------------g
A0A2I3MCN5_BAD-02      -------------------------------------------------g
A0A2K5VCD8_BAD-03      -------------------------------------------------g
F7GVS7_BAD-03          -------------------------------------------------g
A0A2K6E7J3_BAD-03      -------------------------------------------------g
A0A2K5HKW9_BAD-02      -------------------------------------------------g
A0A2K6N1A1_BAD-02      -------------------------------------------------g
A0A2K6PUM5_BAD-02      -------------------------------------------------g
A0A2K5HKW9_BAD-01      -------------------------------------------------g
A0A2K6N1A1_BAD-01      -------------------------------------------------g
A0A2K6PUM5_BAD-01      -------------------------------------------------g
A0A0D9R491_BAD-01      -------------------------------------------------g
A0A2I3MCN5_BAD-04      -------------------------------------------------g
A0A2I3MCN5_BAD-01      -------------------------------------------------g
A0A2K5M0C1_BAD-01      -------------------------------------------------g
A0A2K5XJR2_BAD-01      -------------------------------------------------g
A0A2K5VCD8_BAD-01      -------------------------------------------------g
F7GVS7_BAD-01          -------------------------------------------------g
A0A2K6E7J3_BAD-01      -------------------------------------------------g
Q2PG01_BAD-01          --------------------------------------------------
A0A2J8TYJ3_BAD-01      -------------------------------------------------g
B4DZQ9_BAD-01          -------------------------------------------------g
A0A2I3H4B2_BAD-01      --------------------------------------------------
A0A2R8Z697_BAD-01      -------------------------------------------------g
A0A2I3TBK7_BAD-02      -------------------------------------------------g
A0A2I2Z8C7_BAD-02      -------------------------------------------------g
A0A2I2Z8C7_BAD-01      -------------------------------------------------g
Q92934_BAD-02          -------------------------------------------------g
Q92934_BAD-01          -------------------------------------------------g
A0A2K5E6K7_BAD-01      -------------------------------------------------g
F6SJL0_BAD-01          -------------------------------------------------g
A0A2K6TG62_BAD-01      -------------------------------------------------g
A0A2K5E6K7_BAD-03      -------------------------------------------------g
F6SJL0_BAD-02          -------------------------------------------------g
A0A2K6TG62_BAD-03      -------------------------------------------------g
A0A3B3HDU2_BAD-01      --------------------------------------------------
A0A3B3BQF7_BAD-01      --------------------------------------------------
A0A3B3YFR1_BAD-01      -------------------------------------------------g
A0A087X8P8_BAD-01      -------------------------------------------------g
A0A3B3UA11_BAD-01      -------------------------------------------------g
A0A3B5L9R9_BAD-01      -------------------------------------------------g
A0A3B5Q2N7_BAD-01      -------------------------------------------------g
I3K7B6_BAD-01          -------------------------------------------------g
A0A3B4GXJ6_BAD-01      -------------------------------------------------g
A0A3B5K831_BAD-01      -------------------------------------------------a
H3D8J8_BAD-01          -------------------------------------------------a
G3Q8B3_BAD-01          --------------------------------------------------
A0A3B5BAL2_BAD-01      -------------------------------------------------g
A0A2U9BAC9_BAD-01      -------------------------------------------------g
A0A3B4VFC5_BAD-01      -------------------------------------------------g
A0A3B4W9T1_BAD-01      -------------------------------------------------g
                                                                         

C1C3S9_BAD-01          ----------------ggacagtgttggagagc------ttcaaca----
F6Z067_BAD-01          gtgagac---------agacaaag---------------tgggcga----
A7MCM4_BAD-01          ttgca---------------gaagat-------------cctcatatgct
Q4V925_BAD-03          ttgca---------------gaagat-------------cctcatatgct
Q4V925_BAD-02          ttgca---------------gaagat-------------cctcatatgct
Q4V925_BAD-01          ttgca---------------gaagat-------------cctcatatgct
Q4V925_BAD-04          ttgca---------------gaagat-------------cctcatatgct
A0A3B1IH05_BAD-01      ctgggag---------acacgaagatggag---------ctcgaga----
A0A3B4CPH6_BAD-01      ctgtgag---------acatggagatggag---------ctgcaga----
A0A3B3QX41_BAD-01      gtgcatc---------tgaggagggcggaggcgtgtgccccgggga----
A0A1W4YVX7_BAD-01      ctgtgtc---------tgatgagggtgggggtggtggggctggcga----
A0A1W4YVX7_BAD-02      ctgtgtc---------tgatgagggtgggggtggtggggctggcga----
E7FBJ6_BAD-01          atggagc---atcggtggaggagaacgga---------------ga----
B5X1T1_BAD-01          atgtgatgactcctactgaggagggcggtggc------------ga----
B5XEF1_BAD-01          atgtgatgactcctactgaggagggtgggggt------------ga----
A0A2D0SYM2_BAD-01      atggaat---ttcagctgaagagagcggaggag------cttcaga----
A0A3B1JLM2_BAD-01      atggcgc---ttcagc---agaggacggtggtg------tcggtga----
A0A3B4DUY7_BAD-01      atgggct---tttagc---ggaggacggtggag------cagggga----
H3ANP3_BAD-03          --------------------------gaatcac------tggatga----
H3ANP3_BAD-02          --------------------------gaatcac------tggatga----
H3ANP3_BAD-01          --------------------------gaatcac------tggatga----
H3ANP3_BAD-04          --------------------------gaatcac------tggatga----
G3VRY4_BAD-02          cggaggc---------cgaggcagagcagtccg------aggggga----
G3VRY4_BAD-01          cggaggc---------cgaggcagagcagtccg------aggggga----
Q61337_BAD-02          cggggac---------cgaggaggatgaaggga------tggagga----
Q61337_BAD-01          cggggac---------cgaggaggatgaaggga------tggagga----
Q61337_BAD-03          cggggac---------cgaggaggatgaaggga------tggagga----
O35147_BAD-01          cggggac---------tgaggaagatgaaggga------tggagga----
Q6P7C5_BAD-01          --------------------------------------------------
G1SS60_BAD-01          cggacgc---------ggacgacagcgaagggg------ccgagga----
G3TP47_BAD-01          cagggtc---------tgatgaggctgaagggc------tggagga----
F7GVS7_BAD-04          --------------------------------a------tggagga----
H0V608_BAD-01          cagggac---------tgaggaggaggaaggga------tggagga----
H0WVR2_BAD-01          cagggac---------agaggaggatgaaggga------t---tga----
A0A2K6GWV0_BAD-01      cggggac---------agaagaggatgaaggga------tggagga----
W5P8G9_BAD-01          cggggcc---------agaggatgacgaaggga------cggagga----
F1MUT9_BAD-01          cggggcc---------agaggataatgaagaga------cggagga----
Q3SYZ0_BAD-01          cggggcc---------agaggataatgaagaga------cggagga----
G1P8C5_BAD-01          cggggac---------cgaggaggatgacgaca------ccgagga----
I3MBM5_BAD-02          cagatac---------cgatttggatgaaggga------tggaaga----
I3MBM5_BAD-01          cagatac---------cgatttggatgaaggga------tggaaga----
A0A287AEF3_BAD-02      aggggac---------cgaggaggatgaaggga------ctgagga----
A0A287AEF3_BAD-01      aggggac---------cgaggaggatgaaggga------ctgagga----
G1MI17_BAD-01          cggggac---------cgaagaggatgaagggt------tggagga----
M3YNE7_BAD-01          cggggac---------cgaggaagatgagggga------tggagga----
A0A337SAW2_BAD-01      ccgggac---------cgaggaggatgaaggga------cggagga----
F1PK10_BAD-01          cggggac---------cgacgaggatgaaggaa------tggagga----
Q45KI9_BAD-01          cggggac---------cgacgaggatgaaggaa------tggagga----
F7DN67_BAD-01          aggggac---------cgaggatgaagggatgg------aagggga----
A0A2I2Z8C7_BAD-03      gtgggat---------cg--------gaacttg------ggcaggg----
A0A2R8Z697_BAD-02      gtgggat---------cg--------gaacttg------ggcaggg----
Q92934_BAD-03          gtgggat---------cg--------gaacttg------ggcaggg----
A0A2I3TBK7_BAD-01      gtgggat---------cg--------gaacttg------ggcaggg----
A0A2I3MCN5_BAD-03      gtgggat---------cg--------gaacttg------ggcaggg----
A0A2K5VCD8_BAD-02      gtgggat---------cg--------gaacttg------ggcaggg----
F7GVS7_BAD-02          gtgggat---------cg--------gaacttg------ggcaggg----
A0A2K6E7J3_BAD-02      gtgggat---------cg--------gaacttg------ggcaggg----
A0A2K5M0C1_BAD-02      gtgggat---------cg--------gaacttg------ggcaggg----
A0A2K5XJR2_BAD-02      gtgggat---------cg--------gaacttg------ggcaggg----
A0A2K5E6K7_BAD-02      gtgggat---------cg--------gaacttg------ggcaggg----
A0A2K6TG62_BAD-02      gtgggat---------cg--------gaacttg------ggcaggg----
A0A2R8Z697_BAD-03      cggggac---------ggaggacgacgaaggga------tggggga----
A0A2I2Z8C7_BAD-04      cggggac---------ggaggacgacgaaggga------tggggga----
Q92934_BAD-04          cggggac---------ggaggacgacgaaggga------tggggga----
A0A2I3TBK7_BAD-03      cggggac---------ggaggacgacgaaggga------tggggga----
A0A2K5M0C1_BAD-03      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2K5XJR2_BAD-03      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2I3MCN5_BAD-02      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2K5VCD8_BAD-03      cggggac---------ggaggaggacgaaggga------tggagga----
F7GVS7_BAD-03          cggggac---------ggaggaggacgaaggga------tggagga----
A0A2K6E7J3_BAD-03      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2K5HKW9_BAD-02      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2K6N1A1_BAD-02      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2K6PUM5_BAD-02      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2K5HKW9_BAD-01      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2K6N1A1_BAD-01      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2K6PUM5_BAD-01      cggggac---------ggaggaggacgaaggga------tggagga----
A0A0D9R491_BAD-01      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2I3MCN5_BAD-04      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2I3MCN5_BAD-01      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2K5M0C1_BAD-01      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2K5XJR2_BAD-01      cggggac---------ggaggaggacgaaggga------tggagga----
A0A2K5VCD8_BAD-01      cggggac---------ggaggaggacgaaggga------tggagga----
F7GVS7_BAD-01          cggggac---------ggaggaggacgaaggga------tggagga----
A0A2K6E7J3_BAD-01      cggggac---------ggaggaggacgaaggga------tggagga----
Q2PG01_BAD-01          --------------------------------a------tggagga----
A0A2J8TYJ3_BAD-01      cggggac---------ggaggacgacgaaggga------tggggga----
B4DZQ9_BAD-01          cggggac---------ggaggacgacgaaggga------tggggga----
A0A2I3H4B2_BAD-01      --------------------------------a------tggggga----
A0A2R8Z697_BAD-01      cggggac---------ggaggacgacgaaggga------tggggga----
A0A2I3TBK7_BAD-02      cggggac---------ggaggacgacgaaggga------tggggga----
A0A2I2Z8C7_BAD-02      cggggac---------ggaggacgacgaaggga------tggggga----
A0A2I2Z8C7_BAD-01      cggggac---------ggaggacgacgaaggga------tggggga----
Q92934_BAD-02          cggggac---------ggaggacgacgaaggga------tggggga----
Q92934_BAD-01          cggggac---------ggaggacgacgaaggga------tggggga----
A0A2K5E6K7_BAD-01      cagggac---------ggaggaggacgaaggga------tggagga----
F6SJL0_BAD-01          cagggac---------ggaggaggacgaaggga------tggagga----
A0A2K6TG62_BAD-01      cagggac---------ggagggggacgaaggga------tggagga----
A0A2K5E6K7_BAD-03      cagggac---------ggaggaggacgaaggga------tggagga----
F6SJL0_BAD-02          cagggac---------ggaggaggacgaaggga------tggagga----
A0A2K6TG62_BAD-03      cagggac---------ggagggggacgaaggga------tggagga----
A0A3B3HDU2_BAD-01      -cggga----------agacgaggccggaaccc------ccactga----
A0A3B3BQF7_BAD-01      -cggga----------agacgaggctggaaccc------ccaccga----
A0A3B3YFR1_BAD-01      ggggga----------agaggaggtcgggaccc------ccactga----
A0A087X8P8_BAD-01      ggggga----------agaggaagtcgggaccc------ccactga----
A0A3B3UA11_BAD-01      ggggga----------agaggaagtcgggaccc------ccactga----
A0A3B5L9R9_BAD-01      ggggga----------agaggaggtcgggaccc------ccactga----
A0A3B5Q2N7_BAD-01      ggggga----------agaggaggttgggaccc------ccactga----
I3K7B6_BAD-01          agggga----------ggatgaggtctgtactc------ccacaga----
A0A3B4GXJ6_BAD-01      agggga----------ggatgaggtttgtactc------ccacaga----
A0A3B5K831_BAD-01      cgtgga----------ggatgaggccgggacgc------ccacgga----
H3D8J8_BAD-01          cgggga----------cgacgaggccgggacgc------ccaccga----
G3Q8B3_BAD-01          gtggct----------agacgagaccgggacgc------ccactga----
A0A3B5BAL2_BAD-01      ggggga----------agaggaggccggcacgc------ccactga----
A0A2U9BAC9_BAD-01      gtggga----------cgaggaagccggtacgc------ccaccga----
A0A3B4VFC5_BAD-01      ggggga----------ggaggaagccggcacgc------ccaccga----
A0A3B4W9T1_BAD-01      ggggga----------ggaggaagccggcacgc------ccaccga----
                                                                         

C1C3S9_BAD-01          ----------------tttccgctcacgttcccgctctgctccatcttct
F6Z067_BAD-01          ------gctccat-cctttccgttcccgttcccgttctgctccgtct---
A7MCM4_BAD-01          tgg-------ggatcctttcaggccgagatcccgctcagctcctcctgct
Q4V925_BAD-03          tgg-------ggatcctttcaggccgagatcccgctcagctcctcctgct
Q4V925_BAD-02          tgg-------ggatcctttcaggccgagatcccgctcagctcctcctgct
Q4V925_BAD-01          tgg-------ggatcctttcaggccgagatcccgctcagctcctcctgct
Q4V925_BAD-04          tgg-------ggatcctttcaggccgagatcccgctcagctcctcctgct
A0A3B1IH05_BAD-01      tgg-------agattcattccgacgccgcagccgctcagctcccccttct
A0A3B4CPH6_BAD-01      tgg-------agactctttccgccgtcgctgtcgctcggctccccctgct
A0A3B3QX41_BAD-01      tgg-------cactccttttcgaggacgctcgcggtcagccccgcccgcg
A0A1W4YVX7_BAD-01      tgg-------gacccactttcgcacacgctcacagtcagccccccctgca
A0A1W4YVX7_BAD-02      tgg-------gacccactttcgcacacgctcacagtcagccccccctgca
E7FBJ6_BAD-01          tgg-------acttccattcaggggtcgttctcaatcagcacctgctgca
B5X1T1_BAD-01          tgg-------ggctcctttccgaagccgatcacagtctgctcctcctaca
B5XEF1_BAD-01          tgg-------ggcttcattccgaggtcgatcacagtctgctcctcctgca
A0A2D0SYM2_BAD-01      cgg-------agccccattccgaggccgatcccaatctgctcctgctgca
A0A3B1JLM2_BAD-01      cgg-------agcaccattccgaggccgatcccagtcagctcctgctgcg
A0A3B4DUY7_BAD-01      tgg-------agctccattccgaggccgatcccagtcggctcctgctgca
H3ANP3_BAD-03          ------gcttggc-cctttcaggacaaggtctcgttccgcaccacctaac
H3ANP3_BAD-02          ------gcttggc-cctttcaggacaaggtctcgttccgcaccacctaac
H3ANP3_BAD-01          ------gcttggc-cctttcaggacaaggtctcgttccgcaccacctaac
H3ANP3_BAD-04          ------gcttggc-cctttcaggacaaggtctcgttccgcaccacctaac
G3VRY4_BAD-02          ggaagagcgcggc-ctcttccggggccgctccagctcagcgccccctatc
G3VRY4_BAD-01          ggaagagcgcggc-ctcttccggggccgctccagctcagcgccccctatc
Q61337_BAD-02          gga---gcttagc-ccttttcgaggacgctcgcgttcggctccccccaat
Q61337_BAD-01          gga---gcttagc-ccttttcgaggacgctcgcgttcggctccccccaat
Q61337_BAD-03          gga---gcttagc-ccttttcgaggacgctcgcgttcggctccccccaat
O35147_BAD-01          gga---gcttagc-ccttttcgaggacgctcgcgctcggctccccccaat
Q6P7C5_BAD-01          --------------------------------------------------
G1SS60_BAD-01          gga---gcccagc-ccctttcggggccgctcgcgctcggcgccccccaac
G3TP47_BAD-01          gga---tcccagc-ccctttcggggtcgctcgctttcagcgccccccaac
F7GVS7_BAD-04          gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
H0V608_BAD-01          gga---gctcagt-ccattccggggccgctcgcgctcggcgccacccaac
H0WVR2_BAD-01          aga---gcccagc-cccttccggggccgctcacgctcggcgccccccaac
A0A2K6GWV0_BAD-01      aga---gcccagc-cccttccggggccgctcacgctcggcgccccccaac
W5P8G9_BAD-01          ggaggatctcggc-ccctttaggggccgctcgcgttcggcgccccccaac
F1MUT9_BAD-01          ggaggatctcggc-ccctttaggggccgctcgcgttcggcgccccccaac
Q3SYZ0_BAD-01          ggaggatctcggc-ccctttaggggccgctcgcgttcggcgccccccaac
G1P8C5_BAD-01          gggggagcccagc-cccttccgcggccgctcgcgttcagcgcccccaaac
I3MBM5_BAD-02          gga---gcccagc-cccttccgcggccgctcgcgctcggcgccccccaat
I3MBM5_BAD-01          gga---gcccagc-cccttccgcggccgctcgcgctcggcgccccccaat
A0A287AEF3_BAD-02      tgaggagctcagc-cccttccgcggccgatcgctctcggcgccccccatc
A0A287AEF3_BAD-01      tgaggagctcagc-cccttccgcggccgatcgctctcggcgccccccatc
G1MI17_BAD-01          ggaagagctcagc-cctttccgggggcgctcgagctcagcgccccccaac
M3YNE7_BAD-01          agaagagcttagc-cctttccgggggcgctcgcggtcagcgccccccaac
A0A337SAW2_BAD-01      ggaagagcccagc-cctttccggggtcgctcgcgctcagcgccccccaac
F1PK10_BAD-01          agaagagctcagc-cctttccgggggcgctcgagctcagcgccccccaac
Q45KI9_BAD-01          agaagagctcagc-cctttccgggggcgctcgagctcagcgccccccaac
F7DN67_BAD-01          gga---gcccggc-cccttccggggccgctcgcgctcggcgccccccaac
A0A2I2Z8C7_BAD-03      gaa---gctccgccccctcccagtgacctt--cgctgcacatcccgaaac
A0A2R8Z697_BAD-02      gaa---gctccgccccctcccagtgacttt--cgctccacatcccgaaac
Q92934_BAD-03          gaa---gctccgccccctcccagtgacctt--cgctccacatcccgaaac
A0A2I3TBK7_BAD-01      gaa---gctccgccccctcccagtgacctt--cgctccacatcccgaaac
A0A2I3MCN5_BAD-03      gaa---gctccgccccctcccagtgacctt--cgctccacgccccgaaac
A0A2K5VCD8_BAD-02      gaa---gctccgcaccctcccagtgacctt--cgctccacgcccggaaac
F7GVS7_BAD-02          gaa---gctccgcaccctcccagtgacctt--cgctccacgcccggaaac
A0A2K6E7J3_BAD-02      gaa---gctccgcaccctcccagtgacctt--cgctccacgcccggaaac
A0A2K5M0C1_BAD-02      gaa---gctccgccccctcccagtgacctt--cgctccacgccccgaaac
A0A2K5XJR2_BAD-02      gaa---gctccgccccctcccagtgacctt--cgctccacgccccgaaac
A0A2K5E6K7_BAD-02      gag---gctccgctccctcccagtgacctt--cgctccacatcccgaaac
A0A2K6TG62_BAD-02      gag---gctccgctccctcccagtgacctt--cgctccacatcccgaaac
A0A2R8Z697_BAD-03      gga---gcccagc-ccctttcggggccgctcgcgctcggcgccccccaac
A0A2I2Z8C7_BAD-04      gga---gcccagc-ccctttcggggccgctcgcgctcggcgccccccaac
Q92934_BAD-04          gga---gcccagc-ccctttcggggccgctcgcgctcggcgccccccaac
A0A2I3TBK7_BAD-03      gga---gcccagc-ccctttcggggccgctcgcgctcggcgccccccaac
A0A2K5M0C1_BAD-03      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
A0A2K5XJR2_BAD-03      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
A0A2I3MCN5_BAD-02      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
A0A2K5VCD8_BAD-03      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
F7GVS7_BAD-03          gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
A0A2K6E7J3_BAD-03      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
A0A2K5HKW9_BAD-02      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccctaac
A0A2K6N1A1_BAD-02      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccctaac
A0A2K6PUM5_BAD-02      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccctaac
A0A2K5HKW9_BAD-01      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccctaac
A0A2K6N1A1_BAD-01      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccctaac
A0A2K6PUM5_BAD-01      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccctaac
A0A0D9R491_BAD-01      gga---gcccagc-cccttccggggccgctcgcgctccgcgccccccaac
A0A2I3MCN5_BAD-04      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
A0A2I3MCN5_BAD-01      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
A0A2K5M0C1_BAD-01      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
A0A2K5XJR2_BAD-01      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
A0A2K5VCD8_BAD-01      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
F7GVS7_BAD-01          gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
A0A2K6E7J3_BAD-01      gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
Q2PG01_BAD-01          gga---gcccagc-ccctttcggggccgctcgcgctccgcgccccccaac
A0A2J8TYJ3_BAD-01      gga---gcccagc-ccctttcggggccgttcgcgctcggcgccccccaat
B4DZQ9_BAD-01          gga---gcccagc-ccctttcggggccgttcgcgctcggcgccccccaac
A0A2I3H4B2_BAD-01      gga---gcccagc-ccttttcgcggccgctcgcgctcggcgccccccaac
A0A2R8Z697_BAD-01      gga---gcccagc-ccctttcggggccgctcgcgctcggcgccccccaac
A0A2I3TBK7_BAD-02      gga---gcccagc-ccctttcggggccgctcgcgctcggcgccccccaac
A0A2I2Z8C7_BAD-02      gga---gcccagc-ccctttcggggccgctcgcgctcggcgccccccaac
A0A2I2Z8C7_BAD-01      gga---gcccagc-ccctttcggggccgctcgcgctcggcgccccccaac
Q92934_BAD-02          gga---gcccagc-ccctttcggggccgctcgcgctcggcgccccccaac
Q92934_BAD-01          gga---gcccagc-ccctttcggggccgctcgcgctcggcgccccccaac
A0A2K5E6K7_BAD-01      gga---gcccagc-ccctttcggggccgttcgcgctcagcaccccccaac
F6SJL0_BAD-01          gga---gcccagc-ccctttcggggccgttcgcgctcggcaccccccaac
A0A2K6TG62_BAD-01      gga---gcccagc-ccttttcggggccgttcgcgctcggcaccccccaac
A0A2K5E6K7_BAD-03      gga---gcccagc-ccctttcggggccgttcgcgctcagcaccccccaac
F6SJL0_BAD-02          gga---gcccagc-ccctttcggggccgttcgcgctcggcaccccccaac
A0A2K6TG62_BAD-03      gga---gcccagc-ccttttcggggccgttcgcgctcggcaccccccaac
A0A3B3HDU2_BAD-01      tgg-------gttggccttcaggggcagatccaagtcggcccctccggct
A0A3B3BQF7_BAD-01      cgg-------gttggccttcaggggccgatccaagtcagcccctccggcc
A0A3B3YFR1_BAD-01      ggg-------ctttccattcaggggccgatctaattcagctcccccctcc
A0A087X8P8_BAD-01      ggg-------ctttccattcaggggccgatctaattcagctcccccctcc
A0A3B3UA11_BAD-01      ggg-------ctttccattcaggggccgatctaattcagctcccccctcc
A0A3B5L9R9_BAD-01      ggg-------ctttccattcaggggccgatctttatcagctcctccctcc
A0A3B5Q2N7_BAD-01      ggg-------ctttccattcaggggccgatctttatcagctcctccctcc
I3K7B6_BAD-01          ggg-------agacccattcaggcgaaggtcaaagtcagctccccctgct
A0A3B4GXJ6_BAD-01      ggg-------agacccattcaggcgaaggtcaaagtcagctccccctgct
A0A3B5K831_BAD-01      agg-------agccccgttcagaggaaggtccaggtcagcgcctcccgcc
H3D8J8_BAD-01          cgg-------agccccgttcagggggaggtccagatcggctccccccgcc
G3Q8B3_BAD-01          ggg-------ggctccattccgggtacgttccaagtcggctcccccggct
A0A3B5BAL2_BAD-01      cgg-------agctccgttcaggggacggtctaagtcggctccacctgca
A0A2U9BAC9_BAD-01      cgg-------agctccattccgggggaggtccaagtcggctcctcctgcg
A0A3B4VFC5_BAD-01      agg-------agctccattcaggggacggtccaagtcagctccccctgca
A0A3B4W9T1_BAD-01      agg-------agctccattcaggggacggtccaagtcagctccccctgca
                                                                         

C1C3S9_BAD-01          -----------------ctaatggttgcagctc---gatatggacgagag
F6Z067_BAD-01          -----------------tcaatgatcgctacaa---aatatggacgggag
A7MCM4_BAD-01          -----------------ttgtgggcagctaaga---aatacggccaacag
Q4V925_BAD-03          -----------------ttgtgggcagctaaga---aatacggccaacag
Q4V925_BAD-02          -----------------ttgtgggcagctaaga---aatacggccaacag
Q4V925_BAD-01          -----------------ttgtgggcagctaaga---aatacggccaacag
Q4V925_BAD-04          -----------------ttgtgggcagctaaga---aatacggccaacag
A0A3B1IH05_BAD-01      -----------------ctgtgggcagccaaga---aatatggccgacag
A0A3B4CPH6_BAD-01      -----------------ctgtgggcagcaaaga---aatatggcagacag
A0A3B3QX41_BAD-01      -----------------ctgtgggcagcacagc---ggtatggacgacag
A0A1W4YVX7_BAD-01      -----------------ctgtgggcagcgcaac---ggtatggccgacag
A0A1W4YVX7_BAD-02      -----------------ctgtgggcagcgcaac---ggtatggccgacag
E7FBJ6_BAD-01          -----------------ctgtggaaagcaaaaa---agtatggccgtcag
B5X1T1_BAD-01          -----------------ctgtgggctgcaaaga---aatatggccgccag
B5XEF1_BAD-01          -----------------ctatgggctgcaaaga---aatatggctgccag
A0A2D0SYM2_BAD-01      -----------------ctgtggaaagctaaga---agtatggacgacag
A0A3B1JLM2_BAD-01      -----------------ctatggaaagccaaga---aatatggacggcag
A0A3B4DUY7_BAD-01      -----------------ctgtggaaagccaaga---aatatgggcggcag
H3ANP3_BAD-03          -----------------ttctgggccgcaagga---agtacgggcaagaa
H3ANP3_BAD-02          -----------------ttctgggccgcaagga---agtacgggcaagaa
H3ANP3_BAD-01          -----------------ttctgggccgcaagga---agtacgggcaagaa
H3ANP3_BAD-04          -----------------ttctgggccgcaagga---agtacgggcaagaa
G3VRY4_BAD-02          -----------------ctctgggcggcgcggc---attatggcagcgag
G3VRY4_BAD-01          -----------------ctctgggcggcgcggc---attatggcagcgag
Q61337_BAD-02          -----------------ctctgggcagcgcagc---gctacggccgtgag
Q61337_BAD-01          -----------------ctctgggcagcgcagc---gctacggccgtgag
Q61337_BAD-03          -----------------ctctgggcagcgcagc---gctacggccgtgag
O35147_BAD-01          -----------------ctctgggcagcgcagc---gctatggccgtgag
Q6P7C5_BAD-01          --------------------------------------------------
G1SS60_BAD-01          -----------------ctctgggctgcacagc---gctacggccgcgag
G3TP47_BAD-01          -----------------ctctgggctgcacaga---gatatggccgtgag
F7GVS7_BAD-04          -----------------ctctgggcagcacagc---gttatggccgcgag
H0V608_BAD-01          -----------------ctctgggctgcacagc---gctacggccgagag
H0WVR2_BAD-01          -----------------ctctgggctgcacagc---gctatggccgcgaa
A0A2K6GWV0_BAD-01      -----------------ctctgggctgcacagc---gctatggccgcgag
W5P8G9_BAD-01          -----------------ctctgggctgcacagc---gatatggccgcgag
F1MUT9_BAD-01          -----------------ctctgggctgcacagc---gatatggccgcgag
Q3SYZ0_BAD-01          -----------------ctctgggctgcacagc---gatatggccgcgaa
G1P8C5_BAD-01          -----------------ctctgggcagcacagc---gctacggccgcgag
I3MBM5_BAD-02          -----------------ctctgggctgcacagc---gctacggccgcgag
I3MBM5_BAD-01          -----------------ctctgggctgcacagc---gctacggccgcgag
A0A287AEF3_BAD-02      -----------------ctctgggctgcacagc---gttatggccgcgag
A0A287AEF3_BAD-01      -----------------ctctgggctgcacagc---gttatggccgcgag
G1MI17_BAD-01          -----------------ctctgtgctgcactgc---gctatggccgcgag
M3YNE7_BAD-01          -----------------ctctgtgcggcactgc---gttacggccgcgag
A0A337SAW2_BAD-01      -----------------ctctgggctgccctgc---gctacggccgcgag
F1PK10_BAD-01          -----------------ctctgcgcggcacggc---gctacggccgcgag
Q45KI9_BAD-01          -----------------ctctgcgcggcacggc---gctacggccgcgag
F7DN67_BAD-01          -----------------ctctgggctgcacgac---gctacggccgcgag
A0A2I2Z8C7_BAD-03      tccacccgttcccactgccctgggcagc-catcttgaatacgggcggaag
A0A2R8Z697_BAD-02      tccacccgttcccactgccctgggcagc-catcttgaatatgggcggaag
Q92934_BAD-03          tccacccgttcccactgccctgggcagc-catcttgaatatgggcggaag
A0A2I3TBK7_BAD-01      tccacccgttcccactgccctgggcagc-catcttgaatatgggcggaag
A0A2I3MCN5_BAD-03      tccacccgctctcactgtcctggtcggc-catcttggatatgggcggaag
A0A2K5VCD8_BAD-02      tccacccgctctcactgtcctggtcggc-catcttggatatgggcggaag
F7GVS7_BAD-02          tccacccgctctcactgtcctggtcggc-catcttggatatgggcggaag
A0A2K6E7J3_BAD-02      tccacccgctctcactgtcctcgtcggc-catcttggatatgggcggaag
A0A2K5M0C1_BAD-02      tccacccgctctcactgtcctggtcggc-catcttggatatgggcggaag
A0A2K5XJR2_BAD-02      tccacccgctctcaccgtcctggtcggc-catcttggatatgggcggaag
A0A2K5E6K7_BAD-02      tccacccgttcccatcgccttgggcggc-catcttggatatgggcggaag
A0A2K6TG62_BAD-02      tctacccgctcccatcgccctgggcggc-catcttggacatgggcggaag
A0A2R8Z697_BAD-03      -----------------ctctgggcagcacagc---gctatggccgcgag
A0A2I2Z8C7_BAD-04      -----------------ctctgggcagcacagc---gctatggccgcgag
Q92934_BAD-04          -----------------ctctgggcagcacagc---gctatggccgcgag
A0A2I3TBK7_BAD-03      -----------------ctctgggcagcacagc---gctatggccgcgag
A0A2K5M0C1_BAD-03      -----------------ctctgggcagcacagc---gttatggccgcgag
A0A2K5XJR2_BAD-03      -----------------ctctgggcagcacagc---gttatggccgcgag
A0A2I3MCN5_BAD-02      -----------------ctctgggcagcacagc---gttatggccgcgag
A0A2K5VCD8_BAD-03      -----------------ctctgggcagcacagc---gttatggccgcgag
F7GVS7_BAD-03          -----------------ctctgggcagcacagc---gttatggccgcgag
A0A2K6E7J3_BAD-03      -----------------ctctgggcagcacagc---gttatggccgcgag
A0A2K5HKW9_BAD-02      -----------------ctctgggcagcacagc---gatatggccgcgag
A0A2K6N1A1_BAD-02      -----------------ctctgggcagcacagc---gatatggccgcgag
A0A2K6PUM5_BAD-02      -----------------ctctgggcagcacagc---gatatggccgcgag
A0A2K5HKW9_BAD-01      -----------------ctctgggcagcacagc---gatatggccgcgag
A0A2K6N1A1_BAD-01      -----------------ctctgggcagcacagc---gatatggccgcgag
A0A2K6PUM5_BAD-01      -----------------ctctgggcagcacagc---gatatggccgcgag
A0A0D9R491_BAD-01      -----------------ctctgggcagcacagc---gttatggccgcgag
A0A2I3MCN5_BAD-04      -----------------ctctgggcagcacagc---gttatggccgcgag
A0A2I3MCN5_BAD-01      -----------------ctctgggcagcacagc---gttatggccgcgag
A0A2K5M0C1_BAD-01      -----------------ctctgggcagcacagc---gttatggccgcgag
A0A2K5XJR2_BAD-01      -----------------ctctgggcagcacagc---gttatggccgcgag
A0A2K5VCD8_BAD-01      -----------------ctctgggcagcacagc---gttatggccgcgag
F7GVS7_BAD-01          -----------------ctctgggcagcacagc---gttatggccgcgag
A0A2K6E7J3_BAD-01      -----------------ctctgggcagcacagc---gttatggccgcgag
Q2PG01_BAD-01          -----------------ctctgggcagcacagc---gttatggccgcgag
A0A2J8TYJ3_BAD-01      -----------------ctctgggcagcacagc---gctatggccgcgag
B4DZQ9_BAD-01          -----------------ctctgggcagcacagc---gctatggccgcgag
A0A2I3H4B2_BAD-01      -----------------ctctgggcagcacagc---gctatggccgcgag
A0A2R8Z697_BAD-01      -----------------ctctgggcagcacagc---gctatggccgcgag
A0A2I3TBK7_BAD-02      -----------------ctctgggcagcacagc---gctatggccgcgag
A0A2I2Z8C7_BAD-02      -----------------ctctgggcagcacagc---gctatggccgcgag
A0A2I2Z8C7_BAD-01      -----------------ctctgggcagcacagc---gctatggccgcgag
Q92934_BAD-02          -----------------ctctgggcagcacagc---gctatggccgcgag
Q92934_BAD-01          -----------------ctctgggcagcacagc---gctatggccgcgag
A0A2K5E6K7_BAD-01      -----------------ctctgggcagcacagc---gctatggccgcgag
F6SJL0_BAD-01          -----------------ctctgggcagcacagc---gctatggccgcgag
A0A2K6TG62_BAD-01      -----------------ctctgggcagcacagc---gatatggccgcgag
A0A2K5E6K7_BAD-03      -----------------ctctgggcagcacagc---gctatggccgcgag
F6SJL0_BAD-02          -----------------ctctgggcagcacagc---gctatggccgcgag
A0A2K6TG62_BAD-03      -----------------ctctgggcagcacagc---gatatggccgcgag
A0A3B3HDU2_BAD-01      -----------------ctgtgggccgccaaaa---agtacggtcagcag
A0A3B3BQF7_BAD-01      -----------------ttgtgggccgccaaga---agtacggccagcag
A0A3B3YFR1_BAD-01      -----------------ctgtgggccgccaaga---agtatggccggcag
A0A087X8P8_BAD-01      -----------------ctgtgggccgccaaga---agtatggccggcag
A0A3B3UA11_BAD-01      -----------------ctgtgggccgccaaga---agtacggccggcag
A0A3B5L9R9_BAD-01      -----------------ctgtgggctgccaaga---agtacggccggcag
A0A3B5Q2N7_BAD-01      -----------------ttgtgggctgccaaga---agtacggccggcag
I3K7B6_BAD-01          -----------------ctgtgggctgccaaga---agtacggccagaag
A0A3B4GXJ6_BAD-01      -----------------ctgtgggctgccaaga---agtacggcaggcag
A0A3B5K831_BAD-01      -----------------ttgtgggccgcgcaga---gatacggccggcag
H3D8J8_BAD-01          -----------------ttgtgggctgccaaga---aatacggccggcag
G3Q8B3_BAD-01          -----------------ctgtgggcagccaaga---aatacggacggcag
A0A3B5BAL2_BAD-01      -----------------ctgtgggccgccaaga---agtacggccagaag
A0A2U9BAC9_BAD-01      -----------------ctgtgggcggccatga---aatacggccagaag
A0A3B4VFC5_BAD-01      -----------------ctgtgggcggccaaga---aatacggccagaag
A0A3B4W9T1_BAD-01      -----------------ctgtgggcggcgaaga---aatacggccagaag
                                                                         

C1C3S9_BAD-01          ----ctgaggcga----atgagtgatgaattcgaccaaatcttca-----
F6Z067_BAD-01          ----ttaagaaga----atgagtgatgaatttgaaaaaagcttca-----
A7MCM4_BAD-01          ----ctgagaaga----atgagtgatgagtttgata------------aa
Q4V925_BAD-03          ----ctgagaaga----atgagtgatgagtttgata------------aa
Q4V925_BAD-02          ----ctgagaaga----atgagtgatgagtttgata------------aa
Q4V925_BAD-01          ----ctgagaaga----atgagtgatgagtttgata------------aa
Q4V925_BAD-04          ----ctgagaaga----atgagtgatgagtttgata------------aa
A0A3B1IH05_BAD-01      ----ctgaggaag----atgagtgacgagtttgacaaggggctagagcaa
A0A3B4CPH6_BAD-01      ----ctgaggaag----atgagtgacgagttcgacaccttgctggacaaa
A0A3B3QX41_BAD-01      ----ctgcggcgt----atgagtgacgagtttgacaccctgctggacaaa
A0A1W4YVX7_BAD-01      ----ctaaggcgc----atgagtgatgagtttgacaccctgctggacaaa
A0A1W4YVX7_BAD-02      ----ctaaggcgc----atgagtgatgagtttgacaccctgctggacaaa
E7FBJ6_BAD-01          ----ttgaggaga----atgagcgatgaattcgacacatggctcgataaa
B5X1T1_BAD-01          ----ctgaggagg----atgagtgatgaatttgacacctggctcgacaaa
B5XEF1_BAD-01          ----ctgaggagg----atgagtgatgaatttgacacctggctcgacaaa
A0A2D0SYM2_BAD-01      ----ctgaggagg----atgagtgatgaatttgacacctggctggacaga
A0A3B1JLM2_BAD-01      ----ttgaggagg----atgagcgatgagtttgacacctggttggacaaa
A0A3B4DUY7_BAD-01      ----ctgaggagg----atgagtgatgaatttgacacctggctggataaa
H3ANP3_BAD-03          ----ctgcggaga----atgagcgatgaattcgacatgtcctttc-----
H3ANP3_BAD-02          ----ctgcggaga----atgagcgatgaattcgacatgtcctttc-----
H3ANP3_BAD-01          ----ctgcggaga----atgagcgatgaattcgacatgtcctttc-----
H3ANP3_BAD-04          ----ctgcggaga----atgagcgatgaattcgacatgtcctttc-----
G3VRY4_BAD-02          ----ctgcgcagg----atgagcgacgagttccactgcaccttc---aa-
G3VRY4_BAD-01          ----ctgcgcagg----atgagcgacgagttccactgcaccttc---aa-
Q61337_BAD-02          ----ctccgaagg----atgagcgatgagtttgagggttccttc---aa-
Q61337_BAD-01          ----ctccgaagg----atgagcgatgagtttgagggttccttc---aa-
Q61337_BAD-03          ----ctccgaagg----atgagcgatgagtttgagggttccttc---aa-
O35147_BAD-01          ----ctccgaaga----atgagcgatgaatttgagggttccttc---aa-
Q6P7C5_BAD-01          ----------------------------------aggttcctc-------
G1SS60_BAD-01          ----ctccgaagg----atgagcgacgagttcgagggctccgtcaagaa-
G3TP47_BAD-01          ----ctccgcagg----atgagtgatgagttccagggctatttc---aa-
F7GVS7_BAD-04          ----ctccggagg----atgagtgacgagtttgtggactccttt---aa-
H0V608_BAD-01          ----ctccggagg----atgagcgacgagttcgtggactccttc---aa-
H0WVR2_BAD-01          ----ctccggagg----atgagtgacgagttcgaagactccttcaagaa-
A0A2K6GWV0_BAD-01      ----ctccggagg----atgagcgacgagttcgaggactccttcaagaa-
W5P8G9_BAD-01          ----ctccgaagg----atgagcgacgagtttcacgtctccttc---aa-
F1MUT9_BAD-01          ----ctccggagg----atgagcgacgagtttcacgtctccttc---aa-
Q3SYZ0_BAD-01          ----ctccggagg----atgagcgacgagtttcacgtctccttc---aa-
G1P8C5_BAD-01          ----ctccggagg----atgagcgacgagttccagggctcctttaagaa-
I3MBM5_BAD-02          ----ctccggagg----atgagcgacgaattcgagggctccttt---aa-
I3MBM5_BAD-01          ----ctccggagg----atgagcgacgaattcgagggctccttt---aa-
A0A287AEF3_BAD-02      ----ctccggagg----atga-----------------------------
A0A287AEF3_BAD-01      ----ctccggagg----atgagtgacgagttccagggttccttc---aa-
G1MI17_BAD-01          ----ctccggagg----atgagcgacgagttccagggctccttc---aa-
M3YNE7_BAD-01          ----ctccggagg----atgagcgacgagttccagggctccttc---aa-
A0A337SAW2_BAD-01      ----ctccggagg----atgagcgacgagttccagggctccttc---aa-
F1PK10_BAD-01          ----ctccgcagg----atgagcgacgagttccagggctccttc---aa-
Q45KI9_BAD-01          ----ctccgcagg----atgagcgacgagttccagggctccttc---aa-
F7DN67_BAD-01          ----ctccggagg----atgagcgacgagttccaggtctccttc---ca-
A0A2I2Z8C7_BAD-03      tacttccctcaggcct-atgcaaaaagaggatccgtgct-----------
A0A2R8Z697_BAD-02      tacttccctcaggcct-atgcaaaaagaggatccgtgct-----------
Q92934_BAD-03          tacttccctcaggcct-atgcaaaaagaggatccgtgct-----------
A0A2I3TBK7_BAD-01      tacttccctcaggcct-atgcaaaaagaggatccgtgct-----------
A0A2I3MCN5_BAD-03      tgcttccctcaggccttatgc-aaaagaggatccgtgct-----------
A0A2K5VCD8_BAD-02      tgcttccctcaggccttatgc-aaaagaggatccgtgct-----------
F7GVS7_BAD-02          tgcttccctcaggccttatgc-aaaagaggatccgtgct-----------
A0A2K6E7J3_BAD-02      tgcttccctcaggccttatgc-aaaagaggatccgtgct-----------
A0A2K5M0C1_BAD-02      tgcttccctcaggccttatgc-aaaagaggatccgtgct-----------
A0A2K5XJR2_BAD-02      tgcttccctcaggcctcatgc-aaaagaggatccgtgct-----------
A0A2K5E6K7_BAD-02      tgcttcctgcagg----gagagc---------------------------
A0A2K6TG62_BAD-02      tgcttcctgcagg----gagggc---------------------------
A0A2R8Z697_BAD-03      ----ctccggagg----atga-----------------------------
A0A2I2Z8C7_BAD-04      ----ctccggagg----atga-----------------------------
Q92934_BAD-04          ----ctccggagg----atga-----------------------------
A0A2I3TBK7_BAD-03      ----ctccggagg----atga-----------------------------
A0A2K5M0C1_BAD-03      ----ctccggagg----atga-----------------------------
A0A2K5XJR2_BAD-03      ----ctccggagg----atga-----------------------------
A0A2I3MCN5_BAD-02      ----ctccggagg----atga-----------------------------
A0A2K5VCD8_BAD-03      ----ctccggagg----atga-----------------------------
F7GVS7_BAD-03          ----ctccggagg----atga-----------------------------
A0A2K6E7J3_BAD-03      ----ctccggagg----atga-----------------------------
A0A2K5HKW9_BAD-02      ----ctccggagg----atga-----------------------------
A0A2K6N1A1_BAD-02      ----ctccggagg----atga-----------------------------
A0A2K6PUM5_BAD-02      ----ctccggagg----atga-----------------------------
A0A2K5HKW9_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactctttt---aa-
A0A2K6N1A1_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactccttt---aa-
A0A2K6PUM5_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactccttt---aa-
A0A0D9R491_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactccttt---aa-
A0A2I3MCN5_BAD-04      ----ctccggagg----atgagtgacgagtttgtggactccttt---aa-
A0A2I3MCN5_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactcctttaagaa-
A0A2K5M0C1_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactccttt---aa-
A0A2K5XJR2_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactccttt---aa-
A0A2K5VCD8_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactccttt---aa-
F7GVS7_BAD-01          ----ctccggagg----atgagtgacgagtttgtggactccttt---aa-
A0A2K6E7J3_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactccttt---aa-
Q2PG01_BAD-01          ----ctccggagg----atgagtgacgagtttgtggactccttt---aa-
A0A2J8TYJ3_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactcctttaagaa-
B4DZQ9_BAD-01          ----ctccggagg----atgagtgacgagtttgtggactcctttaagaa-
A0A2I3H4B2_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactccttt---aa-
A0A2R8Z697_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactcctttaagaa-
A0A2I3TBK7_BAD-02      ----ctccggagg----atgagtgacgagtttgtggactcctttaagaa-
A0A2I2Z8C7_BAD-02      ----ctccggagg----atgagtgacgagtttgtggactcctttaagaa-
A0A2I2Z8C7_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactcctttaagaa-
Q92934_BAD-02          ----ctccggagg----atgagtgacgagtttgtggactcctttaagaa-
Q92934_BAD-01          ----ctccggagg----atgagtgacgagtttgtggactcctttaagaa-
A0A2K5E6K7_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactccttt---aa-
F6SJL0_BAD-01          ----ctccggagg----atgagtgatgagtttgtggactcctttaagaa-
A0A2K6TG62_BAD-01      ----ctccggagg----atgagtgacgagtttgtggactccttc---aa-
A0A2K5E6K7_BAD-03      ----ctccggagg----atga-----------------------------
F6SJL0_BAD-02          ----ctccggagg----atga-----------------------------
A0A2K6TG62_BAD-03      ----ctccggagg----atga-----------------------------
A0A3B3HDU2_BAD-01      ----ctccgacgg----atgagcgacgagtttgacagcctgctggataaa
A0A3B3BQF7_BAD-01      ----cttcggagg----atgagcgacgagttcgacagcctgctggataaa
A0A3B3YFR1_BAD-01      ----cttcggagg----atgagcgatgagtttgtcaacctgcttgataaa
A0A087X8P8_BAD-01      ----cttcggagg----atgagcgatgagtttgtcaacctgcttgataaa
A0A3B3UA11_BAD-01      ----cttcggagg----atgagcgatgagtttgtcaacctgcttgataaa
A0A3B5L9R9_BAD-01      ----cttcggagg----atgagcgatgagtttgtcaacctgcttgataaa
A0A3B5Q2N7_BAD-01      ----cttcggagg----atgagtgatgagtttgtcaacctgcttgataaa
I3K7B6_BAD-01          ----cttcgacgg----atgagtgacgagtttgacagcctactagataaa
A0A3B4GXJ6_BAD-01      ----cttcgacga----atgagtgacgagtttgacagcttactagataaa
A0A3B5K831_BAD-01      ----ctccggaga----atgagcgacgagttcgacagcttgctggataaa
H3D8J8_BAD-01          ----ctccggaga----atgagcgacgagttcgacagcctgctggataaa
G3Q8B3_BAD-01          ----ctccgaagg----atgagcgacgagttcgacagcctgctggacaaa
A0A3B5BAL2_BAD-01      ----ctgcgaagg----atgagcgacgagtttgacagcctgctagataaa
A0A2U9BAC9_BAD-01      ----ctccggcgg----atgagtgacgagtttgacagcctgctagacaaa
A0A3B4VFC5_BAD-01      ----ctcagaagg----atgagcgacgaatttgacagcctgctagacaaa
A0A3B4W9T1_BAD-01      ----ctcagaagg----atgagcgatgaatttgacagcctgctagacaaa
                                                                         

C1C3S9_BAD-01          -cgagtatccctcgacctaaaagtgcaagtgcagccactgagatgaccgt
F6Z067_BAD-01          -cgggccttcctcgtccaaagagtgcaagtgcagcgggtcagatgactgg
A7MCM4_BAD-01          gggcagatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtca
Q4V925_BAD-03          gg---gatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtca
Q4V925_BAD-02          gg---gatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtca
Q4V925_BAD-01          gggcagatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtca
Q4V925_BAD-04          gggcagatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtca
A0A3B1IH05_BAD-01      gg---gatgaagagggtgaggagtgccggagcagcccgccagatgcaaaa
A0A3B4CPH6_BAD-01      gg---gatgaagagagtgaggagtgcaggtgcagcccgtcagatgcacgc
A0A3B3QX41_BAD-01      gg---gatgaagagggtgcgcagtgccggggctgcccgacagatgcaggc
A0A1W4YVX7_BAD-01      gg---gatgaagagggtgcgcagcgcaggagccgcccgccagatgcaggc
A0A1W4YVX7_BAD-02      gg---gatgaagagggtgcgcagcgcaggagccgcccgccagatgcaggc
E7FBJ6_BAD-01          ggggtgagtaagacaccgaacagcc---------------agaaacagac
B5X1T1_BAD-01          ggggaacccaagagagggataagcccagg---aggggtcaagcaggaggt
B5XEF1_BAD-01          ggggtgcccaagagagggattatcccaag---aggaggcaagcagaaagt
A0A2D0SYM2_BAD-01      ggggacataaggagagtgagcagtcctgggaaagtgtcacagaagcaatc
A0A3B1JLM2_BAD-01      ggggacttaagaagaacaactggccctgg------------gaggcatac
A0A3B4DUY7_BAD-01      ggggacacaagaagagcgagcagccctgg------------gaagcagac
H3ANP3_BAD-03          -tggggcttccgaggccaaagagcgctggagcagctggagaaatggtgga
H3ANP3_BAD-02          -tggggcttccgaggccaaagagcgctggagcagctggagaaatggtgga
H3ANP3_BAD-01          -tggggcttccgaggccaaagagcgctggagcagctggagaaatggtgga
H3ANP3_BAD-04          -tggggcttccgaggccaaagagcgctggagcagctggagaaatggtgga
G3VRY4_BAD-02          -gg-gacttccccgcccgaagagcgcaggcactgcgagccagatgcgtcg
G3VRY4_BAD-01          -gg-gacttccccgcccgaagagcgcaggcactgcgagccagatgcgtcg
Q61337_BAD-02          -gg-ga-----------gaagagc--------------------------
Q61337_BAD-01          -gg-gacttcctcgcccaaagagcgcaggcactgcaacacagatgcgaca
Q61337_BAD-03          -gg-gacttcctcgcccaaagagcgcaggcactgcaacacagatgcgaca
O35147_BAD-01          -gg-gacttcctcgcccaaagagcgcaggcactgcaacacagatgcgaca
Q6P7C5_BAD-01          -----acttccat-------------------------------------
G1SS60_BAD-01          -gg-gactgcctcgcccgaagagcgcgggcacagcgatgcagatgaggga
G3TP47_BAD-01          -gg-gacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
F7GVS7_BAD-04          -ggtgagcgccggaccc---cctcccaggccgccccgcgccggtctgtcc
H0V608_BAD-01          -gg-gtcttcctcgcccgaagagcgcgggcacagcgacgaagctgtggca
H0WVR2_BAD-01          -gg-gacttcctcgcccgaagagcgcaggcacagcgacacagatgcgaca
A0A2K6GWV0_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcgacgcagatacggca
W5P8G9_BAD-01          -gg-ggcttcctcgcccgaagagcgcgggcacggcaacgcaaatgcgaca
F1MUT9_BAD-01          -gg-ggcttcctcgcccgaagagcgcgggcacggcaacgcaaatgcgaca
Q3SYZ0_BAD-01          -gg-ggcttcctcgcccgaagagcgcgggcacggcaacggaaatgcgaca
G1P8C5_BAD-01          -gg-gtctccctcgcccgaagagcgctggcacagcaacgcagatgtggca
I3MBM5_BAD-02          -ggtgacattttc-------------------------------------
I3MBM5_BAD-01          -gg-gacttcctcgcccgaggagcgcaggcacagcgtcgcagatgcggca
A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
G1MI17_BAD-01          -gg-gacttcctcgcccgaagagcgcgggcacagcgacgcagatgcgaca
M3YNE7_BAD-01          -gg-ggcttcctcgcccgaagagcgcaggcacagccacgcagatgcgaca
A0A337SAW2_BAD-01      -gg-gacttccacgcccgaagagcgcgggcacagcgacgcagatgcggca
F1PK10_BAD-01          -gg-gacttcctcgcccgaagagcgcggggacagcgacgcagatgcgaca
Q45KI9_BAD-01          -gg-gacttcctcgcccgaagagcgcggggacagcgacgcagatgcgaca
F7DN67_BAD-01          -gg-cacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
A0A2I2Z8C7_BAD-03      ----gtctcctttggagggaaggc----------tgacccagattc----
A0A2R8Z697_BAD-02      ----gtctcctttggagggagggc----------tgacccagattc----
Q92934_BAD-03          ----gtctcctttggagggagggc----------tgacccagattc----
A0A2I3TBK7_BAD-01      ----gtctcctttggagggagggc----------tgaccccgattc----
A0A2I3MCN5_BAD-03      ----ccctctttcggtgggagggc----------tgacccagattc----
A0A2K5VCD8_BAD-02      ----gcctctttcggtgggagggc----------tgacccagattc----
F7GVS7_BAD-02          ----gcctctttcggtgggagggc----------tgacccagattc----
A0A2K6E7J3_BAD-02      ----gcctctttcggtgggagggc----------tgacccagattc----
A0A2K5M0C1_BAD-02      ----gcctctttcggtgggagggc----------tgacccagattc----
A0A2K5XJR2_BAD-02      ----gcctctttcggtgggagggc----------tgacccagattc----
A0A2K5E6K7_BAD-02      ----------------------------------tgacccagattc----
A0A2K6TG62_BAD-02      ----------------------------------tgacccagattc----
A0A2R8Z697_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K5M0C1_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2I3MCN5_BAD-02      --------------------------------------------------
A0A2K5VCD8_BAD-03      --------------------------------------------------
F7GVS7_BAD-03          --------------------------------------------------
A0A2K6E7J3_BAD-03      --------------------------------------------------
A0A2K5HKW9_BAD-02      --------------------------------------------------
A0A2K6N1A1_BAD-02      --------------------------------------------------
A0A2K6PUM5_BAD-02      --------------------------------------------------
A0A2K5HKW9_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
A0A2K6N1A1_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
A0A2K6PUM5_BAD-01      -gg-gacttcctcgcccgaagagcgcgggtacagcgacgcagatgcggca
A0A0D9R491_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
A0A2I3MCN5_BAD-04      -gg-gacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
A0A2I3MCN5_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
A0A2K5M0C1_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
A0A2K5XJR2_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
A0A2K5VCD8_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
F7GVS7_BAD-01          -gg-gacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
A0A2K6E7J3_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
Q2PG01_BAD-01          -gg-ggcttcctcgcccgaagagcgcgggcacagcgacgcagatgcggca
A0A2J8TYJ3_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
B4DZQ9_BAD-01          -gg-gacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
A0A2I3H4B2_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
A0A2R8Z697_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
A0A2I3TBK7_BAD-02      -gg-gacttcctcgcccgaagagcgcgggcacagcaacccagatgcggca
A0A2I2Z8C7_BAD-02      -gg-gacttcctcgcccgaagagcgcaggcacagcaacgcagatgcggca
A0A2I2Z8C7_BAD-01      -gg-gacttcctcgcccgaagagcgcaggcacagcaacgcagatgcggca
Q92934_BAD-02          -gg-gacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
Q92934_BAD-01          -gg-gacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
A0A2K5E6K7_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
F6SJL0_BAD-01          -gg-gacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
A0A2K6TG62_BAD-01      -gg-gacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggca
A0A2K5E6K7_BAD-03      --------------------------------------------------
F6SJL0_BAD-02          --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
A0A3B3HDU2_BAD-01      ggggagatgaggaaggtgaggagcactggggcggccaaacagatgctcca
A0A3B3BQF7_BAD-01      ggggagatgaggaaggtgaggagcgcgggggcgaccaaacagatgcacca
A0A3B3YFR1_BAD-01      ggggaaatgaggaaggtgagcagtaccgggtcgaacagaccgatacacca
A0A087X8P8_BAD-01      ggggaaatgaggaaggtgagcagtaccgggtcgaacagaccgatacacca
A0A3B3UA11_BAD-01      ggggaaatgaggaaggtgagcagtaccgggtcgaacagaccgatacacca
A0A3B5L9R9_BAD-01      ggggaaatgaggaatgtgagcagtgatgggtcgaacagaccgattcacca
A0A3B5Q2N7_BAD-01      ggggaaatgaggaatgtgagcagtgatgggtcgaacagaccgattcacca
I3K7B6_BAD-01          ggggagatgaag---------------------ctcaagaagctgcacca
A0A3B4GXJ6_BAD-01      ggggagatgaag---------------------gtcaagaagctgcacca
A0A3B5K831_BAD-01      ggggggatgaggaagaccaacagcaccggatcgaccaaaccgatgcacca
H3D8J8_BAD-01          gggggaatgaggaagaccagcagcgccggctcggccaggcagatgcacca
G3Q8B3_BAD-01          ggggaaatgaggagggtaaagagcgccgggacgaccaaacagatgcagca
A0A3B5BAL2_BAD-01      ggggagatgaagagggtgaggagtgcagggacggccaaacagatgcacca
A0A2U9BAC9_BAD-01      ggggagatgaggaaggtgaagagcgccgggacggccagacagatgcacca
A0A3B4VFC5_BAD-01      ggggagatgaggaaggtgaagagcgctgggacagccaaacagatgcacca
A0A3B4W9T1_BAD-01      ggggagatgaggaaggtgaagagcgctgggacagccaaacagatgcacca
                                                                         

C1C3S9_BAD-01          tagcaagagtttcggagaaacattttttaacttc--tttagaagaaagaa
F6Z067_BAD-01          gaacagaagca--ttcgagacttaatcatgggcttgttctcaagacggaa
A7MCM4_BAD-01          atcgcccagct--ggttggcatttctttggagtc--acaaagagtctgat
Q4V925_BAD-03          atcgcccagct--ggttggcatttctttggagtc--acaaagagtctgat
Q4V925_BAD-02          atcgcccagct--ggttggcatttctttggagtc--acaaagagtctgat
Q4V925_BAD-01          atcgcccagct--ggttggcatttctttggagtc--acaaagagtctgat
Q4V925_BAD-04          atcgcccagct--ggttggcatttctttggagtc--acaaagagtctgat
A0A3B1IH05_BAD-01      ctcccccagct--ggtttgcctttctttggagtc--acaaggaatcagac
A0A3B4CPH6_BAD-01      ttcccccagct--ggttcaccttcttatggagcc--acaaagagtcagac
A0A3B3QX41_BAD-01      gtcccccagct--ggttcgcctttctctggagcc--acaaggagagcgac
A0A1W4YVX7_BAD-01      ttccccaagtt--ggtttgccttcctttggagcc--acaaggagagcgag
A0A1W4YVX7_BAD-02      ttccccaagtt--ggtttgccttcctttggagcc--acaaggagagcgag
E7FBJ6_BAD-01          ctaccgaggat--ggttttcgttcctctggagtc--cca------aagaa
B5X1T1_BAD-01          ctcccgaggat--ggttctctttcctctggagtc--caa------aaaag
B5XEF1_BAD-01          ctcccgaggat--ggttctctttcctctggagtc--caa------aggag
A0A2D0SYM2_BAD-01      caaccgtgggt--ggttctccttcctctggggat--ctagagaggaggag
A0A3B1JLM2_BAD-01      caaccgaggat--ggttctctttcctctggggta--cca------aagaa
A0A3B4DUY7_BAD-01      gaaccgaggat--ggttctcttttctctggggtt--cca------aagaa
H3ANP3_BAD-03          cgagagctggt--ggaagaaactgatacgctctc--taaaggggcgcggg
H3ANP3_BAD-02          cgagagctggt--ggaagaaactgatacgctctc--taaaggggcgcggg
H3ANP3_BAD-01          cgagagctggt--ggaagaaactgatacgctctc--taaaggggcgcggg
H3ANP3_BAD-04          cgagagctggt--ggaagaaactgatacgctctc--taaaggggcgcggg
G3VRY4_BAD-02          gagccatggct--ggacccgcaccttc--cagtc--ttggttcgggcgga
G3VRY4_BAD-01          gagccatggct--ggacccgcaccttc--cagtc--ttggttcgggcgga
Q61337_BAD-02          -------------tgacgtaca----------------------------
Q61337_BAD-01          aagcgccggct--ggacgcgcattatc--cagtc--ctggtgggatcgaa
Q61337_BAD-03          aagcgccggct--ggacgcgcattatc--cagtc--ctggtgggatcgaa
O35147_BAD-01          aagcgccagtt--ggacgcgcattatc--cagtc--ctggtgggatcgaa
Q6P7C5_BAD-01          --------------------cattttc--ctgtc----------------
G1SS60_BAD-01          aagctccagct--ggacgcgcgtcatc--cagtc--ttggtgggatcgca
G3TP47_BAD-01          aagccccagct--ggacacgcatcatc--caggc--ctggtgggatcgga
F7GVS7_BAD-04          cttccttgtcc--caaggcacg---tc--cggat--ctgatgtcccacga
H0V608_BAD-01          gaactctaatt--ggacacgggccatc--cagtc--ctggtgggatcgga
H0WVR2_BAD-01          gagctccagct--ggacgcgtgtcatt--cagtc--ctggtgggatcgga
A0A2K6GWV0_BAD-01      gagctccagct--ggacgcgcgtcatt--cagtc--ctggtgggatcgga
W5P8G9_BAD-01          aagccctagct--ggacgcgcttcctc--cagtc--ctggttgagccgga
F1MUT9_BAD-01          aagccccagct--ggacgcgcttcctc--cagtc--ctggttgagccgga
Q3SYZ0_BAD-01          aagccccagct--ggacgcgcttcctc--cagtc--ctggttgagccgga
G1P8C5_BAD-01          aaagtccagct--ggacgcgctttttc--cagtc--ctggtgggatcgga
I3MBM5_BAD-02          -----ccagtc--------------cc--cattc--ctgaggg-------
I3MBM5_BAD-01          aagctccagct--ggacgcgcttcatc--cagtc--ctggtgggatcgga
A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      aagccccagct--ggaagcgcttcctc--cagtc--ctggtggtaccgga
G1MI17_BAD-01          aagccccagct--ggacgcgcgtcatc--cagtc--ctggtgggatcgga
M3YNE7_BAD-01          gagccccagtt--ggacgcgcgtcatc--cagtc--ctggtgggatcgga
A0A337SAW2_BAD-01      aagccccagct--ggacgcgcttcatc--cagtc--ctggtgggatcgga
F1PK10_BAD-01          aagccccagct--ggacgcgcgtcatc--cagtc--ctggtgggatcgga
Q45KI9_BAD-01          aagccccagct--ggacgcgcgtcatc--cagtc--ctggtgggatcgga
F7DN67_BAD-01          aagccccagct--ggacgcgcgccatc--cagtc--ctggtgggatcgga
A0A2I2Z8C7_BAD-03      --------------------------------------------------
A0A2R8Z697_BAD-02      --------------------------------------------------
Q92934_BAD-03          --------------------------------------------------
A0A2I3TBK7_BAD-01      --------------------------------------------------
A0A2I3MCN5_BAD-03      --------------------------------------------------
A0A2K5VCD8_BAD-02      --------------------------------------------------
F7GVS7_BAD-02          --------------------------------------------------
A0A2K6E7J3_BAD-02      --------------------------------------------------
A0A2K5M0C1_BAD-02      --------------------------------------------------
A0A2K5XJR2_BAD-02      --------------------------------------------------
A0A2K5E6K7_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2R8Z697_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K5M0C1_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2I3MCN5_BAD-02      --------------------------------------------------
A0A2K5VCD8_BAD-03      --------------------------------------------------
F7GVS7_BAD-03          --------------------------------------------------
A0A2K6E7J3_BAD-03      --------------------------------------------------
A0A2K5HKW9_BAD-02      --------------------------------------------------
A0A2K6N1A1_BAD-02      --------------------------------------------------
A0A2K6PUM5_BAD-02      --------------------------------------------------
A0A2K5HKW9_BAD-01      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2K6N1A1_BAD-01      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2K6PUM5_BAD-01      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A0D9R491_BAD-01      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2I3MCN5_BAD-04      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2I3MCN5_BAD-01      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2K5M0C1_BAD-01      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2K5XJR2_BAD-01      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2K5VCD8_BAD-01      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
F7GVS7_BAD-01          aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2K6E7J3_BAD-01      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
Q2PG01_BAD-01          aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2J8TYJ3_BAD-01      aagctccagct--ggacgcgagtcttc--caatc--ctggtgggatcgga
B4DZQ9_BAD-01          aagcccca---------------------------------------ggc
A0A2I3H4B2_BAD-01      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2R8Z697_BAD-01      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2I3TBK7_BAD-02      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2I2Z8C7_BAD-02      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2I2Z8C7_BAD-01      aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
Q92934_BAD-02          aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
Q92934_BAD-01          aagctccagct--ggacgcgagtcttc--cagtc--ctggtgggatcgga
A0A2K5E6K7_BAD-01      aagctccagtt--ggacgcaagtcatc--cagtc--ctggtgggatcgga
F6SJL0_BAD-01          aagctccagct--ggacgcgagtcatc--cagtc--ctggtgggatagga
A0A2K6TG62_BAD-01      aagctccagct--ggacgcgagtcatc--cagtc--ctggtgggatcgga
A0A2K5E6K7_BAD-03      --------------------------------------------------
F6SJL0_BAD-02          --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
A0A3B3HDU2_BAD-01      ctccacgagct--ggtggaactacctcttcagcc--acccggaggcggaa
A0A3B3BQF7_BAD-01      ctccacgagct--ggtggaactacctcttcagcc--acccggaggccgaa
A0A3B3YFR1_BAD-01      ctccaggagct--ggtggagctacctcttcagtc--accaggagacggag
A0A087X8P8_BAD-01      ctccaggagct--ggtggagctacctcttcagtc--accaggagacggag
A0A3B3UA11_BAD-01      ctccaggagct--ggtggagctacctcttcagtc--accaggagacggag
A0A3B5L9R9_BAD-01      ctccaggagct--ggtggagctacctcttcagtc--accaggagacagag
A0A3B5Q2N7_BAD-01      ctccaggagct--ggtggagctacctcttcagtc--accaggagacagag
I3K7B6_BAD-01          ctctaaaacct--ggtggagctacctctttagtc--accaagagactgaa
A0A3B4GXJ6_BAD-01      ctctaaaacct--ggtggagctatctctttagtc--accaagagactgaa
A0A3B5K831_BAD-01      ctcccggagct--ggtggagctacctgttcagcc--accaggagacggag
H3D8J8_BAD-01          ctcccgcagct--ggtggagctacctgttcagcc--accaggagacggag
G3Q8B3_BAD-01          ctccaagagct--ggtggagttccctctttagtc--accaggagatggag
A0A3B5BAL2_BAD-01      ctctaaaagct--ggtggagctacctctttagtc--accaggagctggag
A0A2U9BAC9_BAD-01      ctctcaaagct--ggtggagctacctctttagtc--accaggagatggaa
A0A3B4VFC5_BAD-01      ctctaaaagct--ggtggagctacctctttagtc--accaggagacagaa
A0A3B4W9T1_BAD-01      ctctaaaagct--ggtggagctacctctttagtc--accaggagacagaa
                                                                         

C1C3S9_BAD-01          caaagaccgaagtcagtcagaaaacgacaagcac----------------
F6Z067_BAD-01          aagtaa------------aggaaggga-----------------tgagtc
A7MCM4_BAD-01          gcggag------------tcgcgc--------------------------
Q4V925_BAD-03          gcggag------------tcgcgc--------------------------
Q4V925_BAD-02          gcggag------------tcgcgc--------------------------
Q4V925_BAD-01          gcggag------------tcgcgc--------------------------
Q4V925_BAD-04          gcggag------------tcgcgc--------------------------
A0A3B1IH05_BAD-01      tctgag------------gcgagcagcag---------------------
A0A3B4CPH6_BAD-01      tctgag------------gccagcagcagtctaacagctcc---agacac
A0A3B3QX41_BAD-01      gcggag------------atcagcggaagcttgtcgaccgc---cgacag
A0A1W4YVX7_BAD-01      gccgag------------atcagcag------------------cggagg
A0A1W4YVX7_BAD-02      gccgag------------atcagcag------------------cggagg
E7FBJ6_BAD-01          gaagag------------ggcagagaa-----------------------
B5X1T1_BAD-01          gctgaa------------ggcagggag-----------------------
B5XEF1_BAD-01          gcggaa------------ggcagggag-----------------------
A0A2D0SYM2_BAD-01      gaggag------------ggaagagaa-----------------------
A0A3B1JLM2_BAD-01      gaggag------------ggaagagaa-----------------------
A0A3B4DUY7_BAD-01      gaagaa------------ggaagagaa-----------------------
H3ANP3_BAD-03          caaccc------------agggacccgcctgggcaa--------------
H3ANP3_BAD-02          caaccc------------agggacccgcctgggcaacagggagtgtcgat
H3ANP3_BAD-01          caaccc------------agggacccgcctgggcaacagggagtgtcgat
H3ANP3_BAD-04          caaccc------------agggacccgcctgggcaa--------------
G3VRY4_BAD-02          atttgg------------ggaaagggagcgtcgg----------tccttc
G3VRY4_BAD-01          atttgg------------ggaaagggagcgtcgg----------tccttc
Q61337_BAD-02          ---------------------------gcttgag----------tccctt
Q61337_BAD-01          acttgg------------gcaaaggaggctccac----------cccctc
Q61337_BAD-03          acttgg------------gcaaaggaggctccac----------cccctc
O35147_BAD-01          atttgg------------ggaaaggaggctccac----------tccctc
Q6P7C5_BAD-01          ------------------------------ccat----------gtcccc
G1SS60_BAD-01          atttgg------------ggaaaggaggctccgc----------cccttc
G3TP47_BAD-01          atttgg------------ggagaggcagctccgc----------cccgtc
F7GVS7_BAD-04          tccctc------------cccaacgccgtcctgc----------cccttc
H0V608_BAD-01          acttgg------------ggagaggaggctccgc----------cccctc
H0WVR2_BAD-01          acgtgg------------gcaggggaggttccgc----------cccctg
A0A2K6GWV0_BAD-01      acgtgg------------gcaggggaggttccgc----------cccctc
W5P8G9_BAD-01          acttgg------------ggagaggaggctccgc----------cccctc
F1MUT9_BAD-01          acttgg------------ggagaggaggctccgc----------cccctc
Q3SYZ0_BAD-01          acttgg------------ggagaggaggctccgc----------cccctc
G1P8C5_BAD-01          actcgg------------ggagaggaggctccgc----------cccctc
I3MBM5_BAD-02          -------------------------------------------------c
I3MBM5_BAD-01          acttgg------------ggaggcgaggctccgc----------cccctc
A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      actcgg------------ggagaggaggccccgc----------cccctc
G1MI17_BAD-01          acttgg------------ggagaggaggctccgc----------cccctc
M3YNE7_BAD-01          acttgg------------ggagaggaggctccgc----------cccctc
A0A337SAW2_BAD-01      acttgg------------ggagaggaggctccgc----------cccctc
F1PK10_BAD-01          acttgg------------ggagaggaggctccgc----------cccgtc
Q45KI9_BAD-01          acttgg------------ggagaggaggctccgc----------cccgtc
F7DN67_BAD-01          acttgg------------ggagaggaggctccgc----------cccctc
A0A2I2Z8C7_BAD-03      ------------------------------cctt----------ccggtg
A0A2R8Z697_BAD-02      ------------------------------cctt----------ccggtg
Q92934_BAD-03          ------------------------------cctt----------ccggtg
A0A2I3TBK7_BAD-01      ------------------------------cctt----------ccggtg
A0A2I3MCN5_BAD-03      ------------------------------cctt----------ccggtg
A0A2K5VCD8_BAD-02      ------------------------------cctt----------ccggtg
F7GVS7_BAD-02          ------------------------------cctt----------ccggtg
A0A2K6E7J3_BAD-02      ------------------------------cctt----------ccggtg
A0A2K5M0C1_BAD-02      ------------------------------cctt----------ccggtg
A0A2K5XJR2_BAD-02      ------------------------------cctt----------ccggtg
A0A2K5E6K7_BAD-02      ------------------------------cctt----------ccggtg
A0A2K6TG62_BAD-02      ------------------------------cctt----------ccggtg
A0A2R8Z697_BAD-03      --------------------------------------------------
A0A2I2Z8C7_BAD-04      --------------------------------------------------
Q92934_BAD-04          --------------------------------------------------
A0A2I3TBK7_BAD-03      --------------------------------------------------
A0A2K5M0C1_BAD-03      --------------------------------------------------
A0A2K5XJR2_BAD-03      --------------------------------------------------
A0A2I3MCN5_BAD-02      --------------------------------------------------
A0A2K5VCD8_BAD-03      --------------------------------------------------
F7GVS7_BAD-03          --------------------------------------------------
A0A2K6E7J3_BAD-03      --------------------------------------------------
A0A2K5HKW9_BAD-02      --------------------------------------------------
A0A2K6N1A1_BAD-02      --------------------------------------------------
A0A2K6PUM5_BAD-02      --------------------------------------------------
A0A2K5HKW9_BAD-01      acttgg------------gcaggggaagctccgc----------cccctc
A0A2K6N1A1_BAD-01      acttgg------------gcaggggaagctccgc----------cccctc
A0A2K6PUM5_BAD-01      acttgg------------gcaggggaagctccgc----------cccctc
A0A0D9R491_BAD-01      acttgg------------gcaggggaagctccgc----------cccctc
A0A2I3MCN5_BAD-04      acttgg------------gcaggggaagctccgc----------cccctc
A0A2I3MCN5_BAD-01      acttgg------------gcaggggaagctccgc----------cccctc
A0A2K5M0C1_BAD-01      acttgg------------gcaggggaagctccgc----------cccctc
A0A2K5XJR2_BAD-01      acttgg------------gcaggggaagctccgc----------cccctc
A0A2K5VCD8_BAD-01      acttgg------------gcaggggaagctccgc----------accctc
F7GVS7_BAD-01          acttgg------------gcaggggaagctccgc----------accctc
A0A2K6E7J3_BAD-01      acttgg------------gcaggggaagctccgc----------accctc
Q2PG01_BAD-01          acttgg------------gcaggggaagctccgc----------accctc
A0A2J8TYJ3_BAD-01      acttgg------------gcaggggaagctccgc----------cccctc
B4DZQ9_BAD-01          gcctgc------------gc------------------------------
A0A2I3H4B2_BAD-01      acttgg------------gcaggggaagctccgc----------cccctc
A0A2R8Z697_BAD-01      acttgg------------gcaggggaagctccgc----------cccctc
A0A2I3TBK7_BAD-02      acttgg------------gcaggggaagctccgc----------cccctc
A0A2I2Z8C7_BAD-02      acttgg------------gcaggggaagctccgc----------cccctc
A0A2I2Z8C7_BAD-01      acttgg------------gcaggggaagctccgc----------cccctc
Q92934_BAD-02          acttgg------------gcaggggaagctccgc----------cccctc
Q92934_BAD-01          acttgg------------gcaggggaagctccgc----------cccctc
A0A2K5E6K7_BAD-01      acttgg------------gcaggggaggctccgc----------tccctc
F6SJL0_BAD-01          acttgg------------gcaggggaggctccgc----------tccttc
A0A2K6TG62_BAD-01      acttgg------------gcaggggaggctccgc----------tccctc
A0A2K5E6K7_BAD-03      --------------------------------------------------
F6SJL0_BAD-02          --------------------------------------------------
A0A2K6TG62_BAD-03      --------------------------------------------------
A0A3B3HDU2_BAD-01      ----gg------------agagtacagccaccacga-----gagccac--
A0A3B3BQF7_BAD-01      ----gg------------agagtacagccaccacga-----aagccac--
A0A3B3YFR1_BAD-01      ----gg------------agagaacaaccaccacga-----aaaccacgc
A0A087X8P8_BAD-01      ----gg------------agagaacaaccaccacga-----aaaccacgc
A0A3B3UA11_BAD-01      ----gg------------agagaacaaccaccacga-----aaaccacgc
A0A3B5L9R9_BAD-01      ----gg------------agagaacaaccaccacga-----aaaccacgc
A0A3B5Q2N7_BAD-01      ----gg------------agagaacaaccaccacga-----aaaccacgc
I3K7B6_BAD-01          ----gg------------agagaacaaccatcttga-----a--------
A0A3B4GXJ6_BAD-01      ----gg------------agagaacaaccatcttga-----aaaccacaa
A0A3B5K831_BAD-01      ----gg------------cgagaacggccaccacga-----cggccacac
H3D8J8_BAD-01          ----ag------------cgagaacaaccaccacga-----c--------
G3Q8B3_BAD-01          ----gg------------agagaacaaccaccatga-----a--------
A0A3B5BAL2_BAD-01      ----gg------------agagaacaaccaccatga-----aaaccacac
A0A2U9BAC9_BAD-01      ----gg------------agaaaacaaccaccacga-----gaaccacac
A0A3B4VFC5_BAD-01      ----gg------------agaaaacaaccaccatga-----aaaccacac
A0A3B4W9T1_BAD-01      ----gg------------agaaaacaaccaccatga-----aaaccacac
                                                                         

C1C3S9_BAD-01          -------------tga---------
F6Z067_BAD-01          tggggatgaggagtga---------
A7MCM4_BAD-01          ----cccgcagagtga---------
Q4V925_BAD-03          ----cccgcagagtga---------
Q4V925_BAD-02          ----cccgcagagtga---------
Q4V925_BAD-01          ----cccgcagagtga---------
Q4V925_BAD-04          ----cccgcagagtga---------
A0A3B1IH05_BAD-01      ccgtccagcagaatga---------
A0A3B4CPH6_BAD-01      ccgtccggcagagtga---------
A0A3B3QX41_BAD-01      cagagctgcacagtga---------
A0A1W4YVX7_BAD-01      cagggctgcgcagtga---------
A0A1W4YVX7_BAD-02      cagggctgcgcagtga---------
E7FBJ6_BAD-01          -------------tga---------
B5X1T1_BAD-01          -------------tga---------
B5XEF1_BAD-01          -------------tga---------
A0A2D0SYM2_BAD-01      -------------taa---------
A0A3B1JLM2_BAD-01      -------------taa---------
A0A3B4DUY7_BAD-01      -------------taa---------
H3ANP3_BAD-03          -------------------------
H3ANP3_BAD-02          ccgaggacctgactaa---------
H3ANP3_BAD-01          ccgaggacctgactaa---------
H3ANP3_BAD-04          -------------------------
G3VRY4_BAD-02          ccac---------tga---------
G3VRY4_BAD-01          ccac---------tga---------
Q61337_BAD-02          ccgg---------tgcgtgcaatag
Q61337_BAD-01          ccag---------tga---------
Q61337_BAD-03          ccag---------tga---------
O35147_BAD-01          ccag---------tga---------
Q6P7C5_BAD-01          -------------tga---------
G1SS60_BAD-01          ccag---------------------
G3TP47_BAD-01          tcag---------tga---------
F7GVS7_BAD-04          ctag----ctccatag---------
H0V608_BAD-01          ccaggagtcggtctga---------
H0WVR2_BAD-01          ccag---------tga---------
A0A2K6GWV0_BAD-01      ccag---------tga---------
W5P8G9_BAD-01          tcag---------tga---------
F1MUT9_BAD-01          ccag---------tga---------
Q3SYZ0_BAD-01          ccag---------tga---------
G1P8C5_BAD-01          ccag---------tga---------
I3MBM5_BAD-02          ctaa---------------------
I3MBM5_BAD-01          ccag---------tga---------
A0A287AEF3_BAD-02      -------------------------
A0A287AEF3_BAD-01      ccaa---------tga---------
G1MI17_BAD-01          ccaa---------tga---------
M3YNE7_BAD-01          ccaa---------tga---------
A0A337SAW2_BAD-01      ccag---------tga---------
F1PK10_BAD-01          ccag---------tga---------
Q45KI9_BAD-01          ccag---------tga---------
F7DN67_BAD-01          ccag---------tga---------
A0A2I2Z8C7_BAD-03      cgtg---------tga---------
A0A2R8Z697_BAD-02      cgtg---------tga---------
Q92934_BAD-03          cgtg---------tga---------
A0A2I3TBK7_BAD-01      cgtg---------tga---------
A0A2I3MCN5_BAD-03      catg---------tga---------
A0A2K5VCD8_BAD-02      catg---------tga---------
F7GVS7_BAD-02          catg---------tga---------
A0A2K6E7J3_BAD-02      catg---------tga---------
A0A2K5M0C1_BAD-02      catg---------tga---------
A0A2K5XJR2_BAD-02      catg---------tga---------
A0A2K5E6K7_BAD-02      cgtg---------tga---------
A0A2K6TG62_BAD-02      cgtg---------tga---------
A0A2R8Z697_BAD-03      -------------------------
A0A2I2Z8C7_BAD-04      -------------------------
Q92934_BAD-04          -------------------------
A0A2I3TBK7_BAD-03      -------------------------
A0A2K5M0C1_BAD-03      -------------------------
A0A2K5XJR2_BAD-03      -------------------------
A0A2I3MCN5_BAD-02      -------------------------
A0A2K5VCD8_BAD-03      -------------------------
F7GVS7_BAD-03          -------------------------
A0A2K6E7J3_BAD-03      -------------------------
A0A2K5HKW9_BAD-02      -------------------------
A0A2K6N1A1_BAD-02      -------------------------
A0A2K6PUM5_BAD-02      -------------------------
A0A2K5HKW9_BAD-01      ccag---------tga---------
A0A2K6N1A1_BAD-01      ccag---------tga---------
A0A2K6PUM5_BAD-01      ccag---------tga---------
A0A0D9R491_BAD-01      ccag---------tga---------
A0A2I3MCN5_BAD-04      ccag---------tga---------
A0A2I3MCN5_BAD-01      ccag---------tga---------
A0A2K5M0C1_BAD-01      ccag---------tga---------
A0A2K5XJR2_BAD-01      ccag---------tga---------
A0A2K5VCD8_BAD-01      ccag---------tga---------
F7GVS7_BAD-01          ccag---------tga---------
A0A2K6E7J3_BAD-01      ccag---------tga---------
Q2PG01_BAD-01          ccag---------tga---------
A0A2J8TYJ3_BAD-01      ccag---------tga---------
B4DZQ9_BAD-01          -------------taa---------
A0A2I3H4B2_BAD-01      ccag---------tga---------
A0A2R8Z697_BAD-01      ccag---------tga---------
A0A2I3TBK7_BAD-02      ccag---------tga---------
A0A2I2Z8C7_BAD-02      ccag---------tga---------
A0A2I2Z8C7_BAD-01      ccag---------tga---------
Q92934_BAD-02          ccag---------tga---------
Q92934_BAD-01          ccag---------tga---------
A0A2K5E6K7_BAD-01      ccag---------tga---------
F6SJL0_BAD-01          ccag---------tga---------
A0A2K6TG62_BAD-01      ccag---------tga---------
A0A2K5E6K7_BAD-03      -------------------------
F6SJL0_BAD-02          -------------------------
A0A2K6TG62_BAD-03      -------------------------
A0A3B3HDU2_BAD-01      ----cgcactgagtaa---------
A0A3B3BQF7_BAD-01      ----cgcaccgagtag---------
A0A3B3YFR1_BAD-01      ctcccgcaccgagtag---------
A0A087X8P8_BAD-01      ctcccgcaccgagtag---------
A0A3B3UA11_BAD-01      ctcccgcaccgagtag---------
A0A3B5L9R9_BAD-01      ctcccgcaccgagtag---------
A0A3B5Q2N7_BAD-01      ctcccgcaccgagtag---------
I3K7B6_BAD-01          -------------------------
A0A3B4GXJ6_BAD-01      ccaacgcactgagtaa---------
A0A3B5K831_BAD-01      gcaccgcactgagtag---------
H3D8J8_BAD-01          -------------------------
G3Q8B3_BAD-01          -------------------------
A0A3B5BAL2_BAD-01      acatcgcaatgagtag---------
A0A2U9BAC9_BAD-01      tcaacgcaacgagtag---------
A0A3B4VFC5_BAD-01      tcaccgcactgagtag---------
A0A3B4W9T1_BAD-01      tcaccgcactgagtag---------
                                                

© 1998-2019