Dataset for CDS classical BH3-containing proteins of organism Xiphophorus couchianus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B5L9R9_BAD-01       atggacaca---------------------aaatttacaatttcagacgg
A0A3B5M375_BCL2L11      atgctcacggtgacgctctgttcatccaacagaccgccaaatctgctcga
                        ***  ***                      * *    *** *     ** 

A0A3B5L9R9_BAD-01       tgagtcggacccatcggaagacgtagaggaaa---gaggagactt-gcag
A0A3B5M375_BCL2L11      tggctcgaccgaagtaacgccagcagaggggaccggcggagacccagcat
                        **  ***  *  *         * *****  *   * ******   *** 

A0A3B5L9R9_BAD-01       ctaatgcaagaa----------------------aaggagaagccgctca
A0A3B5M375_BCL2L11      cctcagcgcgaacaccacgttcctcgaagcacacagagcggagccgc---
                        *    **  ***                      *  * * ******   

A0A3B5L9R9_BAD-01       gtcaacgccacaccctcacgcttcctgagctccgatctacaaaggtggag
A0A3B5M375_BCL2L11      ----gcgccgcaggcgggcgcctccacagccgggg---gaggaggaggag
                             **** **  *   *** ***  ***   *        *** ****

A0A3B5L9R9_BAD-01       ctgcaggccaggggggaagaggaggtcgggacccccact-----------
A0A3B5M375_BCL2L11      gagaaggagaaggacgaagaggggagccggactcggactcgccgccttgc
                          * ***  * **  ******* *  * **** *  ***           

A0A3B5L9R9_BAD-01       ---------------------gagggctttccattcagg-----------
A0A3B5M375_BCL2L11      tccgtgagcccggccagtttagacgtctttcgaagcaggtcgatatttcg
                                             ** * ***** *  ****           

A0A3B5L9R9_BAD-01       -------------------ggccgatctttatc-----------------
A0A3B5M375_BCL2L11      ccctacccgccgctcatccagcggatacttctcctttgactgcgactcgc
                                            ** ***  ** **                 

A0A3B5L9R9_BAD-01       -----agctcctccctccctgtg-----------ggctgccaag---aag
A0A3B5M375_BCL2L11      tgccgagctccccgctctctccgcacccagtgacggctgacaaagccacg
                             ****** * *** **  *           ***** ***    * *

A0A3B5L9R9_BAD-01       tacggccggcagcttcggaggatgagcgatgagtttgtcaacctgcttga
A0A3B5M375_BCL2L11      ca-gacccccagcctcaccggccaggtgatgaacc--acgccctgc--ag
                         * * **  **** **   **    * *****      *  *****    

A0A3B5L9R9_BAD-01       taaaggggaaatgaggaatgtgagc---agtgatgggtcgaacagaccga
A0A3B5M375_BCL2L11      cgaatggctgtggagcacggtggactcgggctgcagggtgagcaaac---
                          ** **     *** *  ***  *    *     **  ** ** **   

A0A3B5L9R9_BAD-01       ttcaccactcc-------------------------------------ag
A0A3B5M375_BCL2L11      ttcagtcctccctcctcccccttctgaaacatcaacaacatgggaacaaa
                        ****   ****                                     * 

A0A3B5L9R9_BAD-01       gagctggtggagctacctc---ttcagtcaccag---gagacagagg---
A0A3B5M375_BCL2L11      tagctgttaatatcggcccagttttatttatcaggccgataccgatgtta
                         ***** *        * *   ** * * * ***   ** ** ** *   

A0A3B5L9R9_BAD-01       -----gagaga----acaaccaccacgaaaaccacgcctcccgcaccgag
A0A3B5M375_BCL2L11      gtgccgatatatcatgcatccacgttaagaatctcagctc-----tcgag
                             ** * *     ** ****    * ** * *  ***      ****

A0A3B5L9R9_BAD-01       tag
A0A3B5M375_BCL2L11      taa
                        ** 

© 1998-2019