Dataset for CDS classical BH3-containing proteins of organism Xenopus tropicalis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F6Z067_BAD-01          atggcagattcatccccttcagcagttttcaagttagaggaattcgataa
F6TGJ4_BMF-01          caggagagttacctgaatatggatgagttagatgacgatgtgttttatcc
Q4KMV9_BCL2L11-01      -------atggccaaacaaccgtcggtcttgagtccggactgtaatag--
                               *            *  *   *  *    *     *   *   

F6Z067_BAD-01          tgaggaacagggattacctttgccttttgtggatccccctcgtggggcag
F6TGJ4_BMF-01          tgatgaatttggatacccagatcagaccatgacttcctcc----------
Q4KMV9_BCL2L11-01      tggtgaaggtgg----ccagtt----------------------------
                       **  ***   **    **                                

F6Z067_BAD-01          gcgttcgacaacctgtagctaagagttctccc---agcctgcgaagatac
F6TGJ4_BMF-01          acagtattcaaccaga-gcca----gtcctacacatgcctgct-------
Q4KMV9_BCL2L11-01      acaatcaacaagcagacaaca----ttctcat---cgccctctcaga---
                        *  *   *** * *     *     **        ***  *        

F6Z067_BAD-01          ccagggaaggagtcacgtttacgcactgagtctgcttcagagtccagtga
F6TGJ4_BMF-01          ---gagccgctttcacctcttccca------ctttctcactgt--tgtgg
Q4KMV9_BCL2L11-01      --agaggggcccccacctctcttagc--agtccttttcaaggt--aatca
                          * *  *    *** * *           *    ***  **    *  

F6Z067_BAD-01          gac-agaca-aagtgggcgagctcc-------------------atc---
F6TGJ4_BMF-01          ccctggatgcaggggcgcagactacgaagacaaggctacgcagactc---
Q4KMV9_BCL2L11-01      atc-agatg--agggtgggagctcctcagccagcactccatggggtccta
                         *  **     * * *    ** *                    **   

F6Z067_BAD-01          --------ctttccgttcccgttcc--------------cgttctgctcc
F6TGJ4_BMF-01          -----------tgggttccccttccatcagccaggacatcatgctaccct
Q4KMV9_BCL2L11-01      ctatatcgccttatagtcccagttcctttgtcaacagatcaccccattgc
                                  *    ****  * *              *   *      

F6Z067_BAD-01          gt---------------cttcaatga---------------------tcg
F6TGJ4_BMF-01          gtggggtgtctgaaacccctcaaagacttttttatggacatgcaggatac
Q4KMV9_BCL2L11-01      atgctg-gtaagaggatcatc----acttgtctccaaaacctcaag-tgg
                        *               * **    *                     *  

F6Z067_BAD-01          ctacaaaatatggacgggagt---------------------taagaaga
F6TGJ4_BMF-01          ctattatatctccctcagaat---tctccggcccgttttggagaagaggt
Q4KMV9_BCL2L11-01      ctatt---tttcattcgaagtgagtcctgggcctgt---------gagct
                       ***     * *       * *                        **   

F6Z067_BAD-01          atgagtgatgaatttgaaaa--aagc---------------ttcacgggc
F6TGJ4_BMF-01          -tgacaacaggaggcaagaacagagc-------gcagagcatcggatcgc
Q4KMV9_BCL2L11-01      gtgataaatcaactcaaacaccaagccctccttgtcaggcatttaatcat
                        ***       *    *  *   ***               *        

F6Z067_BAD-01          cttcctcgtccaaagagtgcaagt---gcagcgggtcagatg--actgg-
F6TGJ4_BMF-01          ccgcaaactgcagtgtattggaga---ccagtttcacaggtttcatctg-
Q4KMV9_BCL2L11-01      ctcctttccgcaatggctgacagaaatcctgtgaatcagatgtcaccaga
                       *  *      **  *  *   **     * *     *** *   *   * 

F6Z067_BAD-01          ----------gaacagaagc--------attcgaga--------------
F6TGJ4_BMF-01          -------------cagagacttcaacagaaccgaaatcagt---------
Q4KMV9_BCL2L11-01      actgtggatagcacaggaactccggcggattggggatgactttaatgcat
                                    ***   *        *   *  *              

F6Z067_BAD-01          --cttaatcatggg---cttgttctcaa----------------------
F6TGJ4_BMF-01          --tttggtctcaga--------tcttaatcttcttccgcaactt------
Q4KMV9_BCL2L11-01      cattcagtccaagaaggggcattttcaacaaccttccacgacccttggac
                          *   **   *         * * **                      

F6Z067_BAD-01          gacggaaaagtaaag------gaagggatga---------gtctgg--gg
F6TGJ4_BMF-01          --------ggtaatgcatccagtggggaataga-------gccgggctgg
Q4KMV9_BCL2L11-01      aacgaccaagtaata-atcctgcgtgttttacgtttcattatccgactga
                                ****        *   *    *           * *   * 

F6Z067_BAD-01          atgaggagtga---
F6TGJ4_BMF-01          ctcagaggtga---
Q4KMV9_BCL2L11-01      tcctgagattataa
                           *   * *   

© 1998-2019