Dataset for CDS classical BH3-containing proteins of organism Ursus americanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A452SBG5_BCL2L11      atggcaaagcaaccttcagatgtaagttctgagtgtga------------
A0A452QUG1_BIK-01       --tttcacaccacccgcaggtgcgctcagcgggtggtagca-------cc
A0A452STA4_PMAIP1-      at------------------------------------------------
A0A452RJM6_BAD-01       atgttccagatcccagagtttgagcccagtgagcaggaaga-------ct
A0A452SED0_BMF-01       atggagccg-cctcagtgtgtg-----gaggagctggaggatgatgtgtt
                                                                          

A0A452SBG5_BCL2L11      ------------------------------------cagagaaggtggac
A0A452QUG1_BIK-01       ctccctccaccaccagcaccccgcag------------gggaaggtgct-
A0A452STA4_PMAIP1-      ------------------gcctggga-----------agaaagcgcg---
A0A452RJM6_BAD-01       ccagccctgcagataggggcctgggccccagccccacaggggaccagccc
A0A452SED0_BMF-01       ccagccagaggacggggagccggggacccagcct----gggagcttgctc
                                                              *       *   

A0A452SBG5_BCL2L11      aa---------------ctgcagcctgctgagaggcctcctca-------
A0A452QUG1_BIK-01       ------gtcctga----caggtgcgggtggcata----------------
A0A452STA4_PMAIP1-      -----------------taagagcgcgcaggcgagccc------------
A0A452RJM6_BAD-01       ccag--gccctgg----caagcaccggc-agacagccc---caggcct--
A0A452SED0_BMF-01       tctgctgacctgtttgcccagagccagctggactgccccctcagccgtct
                                               *  *                       

A0A452SBG5_BCL2L11      -----------------------gctcaggcctggggcccctacctctct
A0A452QUG1_BIK-01       ----------------------tgtcaggccacgggccctttgtgcaaca
A0A452STA4_PMAIP1-      ----------------------tgcgcggaccccgg------------ca
A0A452RJM6_BAD-01       ----------cctaggggaagctgctcaaccccaggg--gcagccggcca
A0A452SED0_BMF-01       gcatctcttccctctcacccactgctgtggccctgggcttcgacccacca
                                               *      *   **            * 

A0A452SBG5_BCL2L11      ac-----agacagagcagca--------------------------agac
A0A452QUG1_BIK-01       accccgacgatgtggccatgcggctggccttcatcggggacgagatggaa
A0A452STA4_PMAIP1-      ga------------------------------------------------
A0A452RJM6_BAD-01       gc-----agcaaccaccatgga------------------------ggcg
A0A452SED0_BMF-01       gccaggaagacaaggccaccca------------------------gacc
                                                                          

A0A452SBG5_BCL2L11      aggagcc--cggcacccatgagttgtgacaaatcaacacaa--------a
A0A452QUG1_BIK-01       gtgagatggatgcttccccgcgttggcg--------agctccccgggatg
A0A452STA4_PMAIP1-      -------------------------------------------------g
A0A452RJM6_BAD-01       ctggggctgtggagccccggagtcgccacagctcg-taccccgcggg--g
A0A452SED0_BMF-01       ctgagcc--cggcctccccgagtcagggtgtcatgctgccttgtggggtg
                                                                          

A0A452SBG5_BCL2L11      ccccaagt----------------------cctccttgccaggccttca-
A0A452QUG1_BIK-01       gccatgta---------------------------cagcttggctttta-
A0A452STA4_PMAIP1-      cccgaag-------------------------------------------
A0A452RJM6_BAD-01       accgaagaggatgaagggttggaggaggaagagctcagc----cctttcc
A0A452SED0_BMF-01       accgaaga-----------------------accccagcgactcttttat
                         **                                               

A0A452SBG5_BCL2L11      -------------------------------accattatctcagtgcaat
A0A452QUG1_BIK-01       -------------------------------cctacaaccagacaggcct
A0A452STA4_PMAIP1-      --------------------------------------------tggagt
A0A452RJM6_BAD-01       gggggcgctcgagctcagcgcccc-------ccaacctctgtgctgcact
A0A452SED0_BMF-01       ggcaacgcaggctaccggctccctctccctgccagtttccctgcaggctt
                                                                     *   *

A0A452SBG5_BCL2L11      ggcttccatgaggcagtctcaggatgtacc-tgccgatat----------
A0A452QUG1_BIK-01       g-------agaggtgttcttcgaagtctcatggacggactcactaacctc
A0A452STA4_PMAIP1-      gtgccat------tcaactcaggagatttggagacaaact----------
A0A452RJM6_BAD-01       gcgctat-ggccgcgagctccggaggatgagcgacgagttc--------c
A0A452SED0_BMF-01       gccccttggggagcagcccccagaagggccgtggcaacatc--------g
                        *                *     *        * *    *          

A0A452SBG5_BCL2L11      -----gcgcccggagatttggattgcgcaagagttgcggcgtattggaga
A0A452QUG1_BIK-01       agggagaacataaggatttggagcttcctgaccttcaggaacagggtgtc
A0A452STA4_PMAIP1-      --------------------------------------------------
A0A452RJM6_BAD-01       agggctccttcaagggacttcctcgcccgaagagcgcgg-gcacagcgac
A0A452SED0_BMF-01       ag--------cagaggtacagattgcccgaaagcttcagtgcattgcaga
                                                                          

A0A452SBG5_BCL2L11      cgaatttaatgcatattacccaaggagggtctttttgaataattaccaag
A0A452QUG1_BIK-01       c-----------------------------ccc-----------------
A0A452STA4_PMAIP1-      --------------------------gaatttc-----------------
A0A452RJM6_BAD-01       gcag---------------atgcgacaaagccc-----------------
A0A452SED0_BMF-01       ccagttccaccggcttcacatgcagcaa--cac-----------------
                                                                          

A0A452SBG5_BCL2L11      cagccgaagcccacccccaaatgatta--------tcttgcgactgttac
A0A452QUG1_BIK-01       cacccggggcgcaggctggtgctgtccctgc----tgctgct--------
A0A452STA4_PMAIP1-      cggcagaa--acttctgaatctgatatccaaactcttccgct--------
A0A452RJM6_BAD-01       cagctggac---------gcgcgtcatccag----tcctggt--------
A0A452SED0_BMF-01       cagcaaaaccaaaatcgagtgtggtggcaga----tcctgctcttcttac
                        *  *                               *   *          

A0A452SBG5_BCL2L11      gttacatc-------------------atccgcctggtgtggagattgc-
A0A452QUG1_BIK-01       ---------------gctggggctgctgctaggctggg---ggttccgcc
A0A452STA4_PMAIP1-      ---------------------------------------caggaacc---
A0A452RJM6_BAD-01       ------------------gggatcggaacttggggagaggaggctccgcc
A0A452SED0_BMF-01       acaacctcgctttgaacgcagatgagaacagggatggggcaggtccca--
                                                                 *        

A0A452SBG5_BCL2L11      -------agtga
A0A452QUG1_BIK-01       tcctcc-agtga
A0A452STA4_PMAIP1-      ---------tga
A0A452RJM6_BAD-01       ccctcccaatga
A0A452SED0_BMF-01       -------ggtga
                                 ***

© 1998-2019