Dataset for CDS BCL2L11 of organism Tarsius syrichta

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1U7SU38_BCL2L11      atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaaggggg
A0A1U7SU38_BCL2L11      atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaaggggg
A0A1U7SU38_BCL2L11      atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaaggggg
A0A1U7SU38_BCL2L11      atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaaggggg
A0A1U7SU38_BCL2L11      atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaaggggg
A0A1U7SU38_BCL2L11      atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaaggggg
A0A1U7SU38_BCL2L11      atggcaaagcaaccttccgttgtaagttctgagtgtgaccgagaaggggg
                        **************************************************

A0A1U7SU38_BCL2L11      acaattgcagcctgccgagaggcctccccaactcaggcctggggccccta
A0A1U7SU38_BCL2L11      acaattgcagcctgccgagaggcctccccaactcaggcctggggccccta
A0A1U7SU38_BCL2L11      acaattgcagcctgccgagaggcctccccaactcaggcctggggccccta
A0A1U7SU38_BCL2L11      acaattgcagcctgccgagaggcctccccaactcaggcctggggccccta
A0A1U7SU38_BCL2L11      acaattgcagcctgccgagaggcctccccaactcaggcctggggccccta
A0A1U7SU38_BCL2L11      acaattgcagcctgccgagaggcctccccaactcaggcctggggccccta
A0A1U7SU38_BCL2L11      acaattgcagcctgccgagaggcctccccaactcaggcctggggccccta
                        **************************************************

A0A1U7SU38_BCL2L11      cctccctacagacagagccgcaag--------------------------
A0A1U7SU38_BCL2L11      cctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
A0A1U7SU38_BCL2L11      cctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
A0A1U7SU38_BCL2L11      cctccctacagacagagccgca----------------------------
A0A1U7SU38_BCL2L11      cctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
A0A1U7SU38_BCL2L11      cctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
A0A1U7SU38_BCL2L11      cctccctacagacagagccgcaaggtaatcctgaaggcagtcccggaggc
                        **********************                            

A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccactggccccacc
A0A1U7SU38_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccactggccccacc
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccactggccccacc
A0A1U7SU38_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccactggccccacc
A0A1U7SU38_BCL2L11      gaaggggaccgctgcccccacggcagccctcagggcccactggccccacc
                                                                          

A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A1U7SU38_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A1U7SU38_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
A0A1U7SU38_BCL2L11      ggccagccctggcccttttgctaccagatccccgcttttcatctttgtga
                                                                          

A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A1U7SU38_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A1U7SU38_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
A0A1U7SU38_BCL2L11      gaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgac
                                                                          

A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A1U7SU38_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A1U7SU38_BCL2L11      --agacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A1U7SU38_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A1U7SU38_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
A0A1U7SU38_BCL2L11      acagacaggagcccagcacccatgagttgtgacaaatcaacacaaacccc
                                                                          

A0A1U7SU38_BCL2L11      --------------------------------------------agtcca
A0A1U7SU38_BCL2L11      aagtcctccctgccaggccttcaaccactatctcagtgcaatgg------
A0A1U7SU38_BCL2L11      aagtcctccctgccaggccttcaaccactatctcagtgcaat--------
A0A1U7SU38_BCL2L11      aagtcctccctgccaggccttcaaccactatctcagtgcaatggagtcca
A0A1U7SU38_BCL2L11      aagtcctccctgccaggccttcaaccactatctcagtgcaatggagtcca
A0A1U7SU38_BCL2L11      aagtcctccctgccaggccttcaaccactatctcagtgcaatggagtcca
A0A1U7SU38_BCL2L11      aagtcctccctgccaggccttcaaccactatctcagtgcaatggagtcca
                                                                          

A0A1U7SU38_BCL2L11      tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatc
A0A1U7SU38_BCL2L11      -----------------------------------ttagagaaataga--
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatc
A0A1U7SU38_BCL2L11      tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatc
A0A1U7SU38_BCL2L11      tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatc
A0A1U7SU38_BCL2L11      tgaggcagtctcaggctgaacctccagatatgcgcccggagatatggatc
                                                                          

A0A1U7SU38_BCL2L11      gcacaggagttgcggcgtatcggagacgagtttaacgcttattatccgag
A0A1U7SU38_BCL2L11      ----ggaagttgtcgtgtag------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      gcacaggagttgcggcgtatcggagacgagtttaacgcttattatccgag
A0A1U7SU38_BCL2L11      gcacaggagttgcggcgtatcggagacgagtttaacgcttattatccgag
A0A1U7SU38_BCL2L11      gcacaggagttgcggcgtatcggagacgagtttaacgcttattatccgag
A0A1U7SU38_BCL2L11      gcacaggagttgcggcgtatcggagacgagtttaacgcttattatccgag
                                                                          

A0A1U7SU38_BCL2L11      gaggct-------------ggcaaaaaacctagcatcct-----------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --gggc-------ttatttgaataa-------------------------
A0A1U7SU38_BCL2L11      gagggc-------ttatttgaataataaccaagcagccgaagatcaccca
A0A1U7SU38_BCL2L11      gagggc-------ttatttgaataataaccaagcagccgaagatcaccca
A0A1U7SU38_BCL2L11      gaggatgccctttccacctgattaa-------------------------
A0A1U7SU38_BCL2L11      gaggtt---------agagaaatag-------------------------
                                                                          

A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      caaatggttctcttacgactgttacgttacattgtccgcctggtatggag
A0A1U7SU38_BCL2L11      caaatggttctcttacgactgttacgttacattgtccgcctggtatggag
A0A1U7SU38_BCL2L11      --------------------------------------------------
A0A1U7SU38_BCL2L11      --------------------------------------------------
                                                                          

A0A1U7SU38_BCL2L11      --cctcttga
A0A1U7SU38_BCL2L11      ----------
A0A1U7SU38_BCL2L11      ----------
A0A1U7SU38_BCL2L11      aatgtattga
A0A1U7SU38_BCL2L11      aatgtattga
A0A1U7SU38_BCL2L11      ----------
A0A1U7SU38_BCL2L11      ----------
                                  

© 1998-2018