Dataset for CDS classical BH3-containing proteins of organism Takifugu rubripes

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B5K831_BAD-01      atgg-cgacgaggttcagcat---ttccagcgacagcgactcggatccct
A0A3B5KWG6_BMF-01      atggacgatgaggaggatgatgtatttcagccaga-----------ccct
                       **** *** ****   *  **   ** **** * *           ****

A0A3B5K831_BAD-01      cggaggaggtggacga------aggagagaggaatagttctctaagtgag
A0A3B5KWG6_BMF-01      tacagctggcgcaccacattccaggagata-------------aagtgcg
                          **  ** * ** *      ****** *             ***** *

A0A3B5K831_BAD-01      caggagaggcaggttcttcagcggcacaccctgactctacctgaactcag
A0A3B5KWG6_BMF-01      agg----------------accggggcacgcagac---acctggcccgac
                         *                * ***  *** * ***   *****  *  * 

A0A3B5K831_BAD-01      actgacaggtaccagtcggaccagggtcagct------cggagtcccag-
A0A3B5KWG6_BMF-01      cctggca--------ccgcacagcggcatgcttccctgtggagtcgcaga
                        *** **         ** **   **   ***       ****** *** 

A0A3B5K831_BAD-01      -gcgtcca------ccttctccagagaggaaga------gcttcagggga
A0A3B5KWG6_BMF-01      agagcccagactactcttctacggtgaggccggcgacacgcttcattaca
                        * * ***       ***** * * ****  *       ******    *

A0A3B5K831_BAD-01      acgtggaggatgaggccgggacgcccac--ggaaggagccccgttcagag
A0A3B5KWG6_BMF-01      ccgga------------ggggcgcccaacgggatggagccgctgccccag
                        **              *** ******   *** ****** *   *  **

A0A3B5K831_BAD-01      gaaggtccaggtcagcgcctcccgccttgtgggccgcgcagagat-----
A0A3B5KWG6_BMF-01      cagggtcctg----------------tggtgcgcagcacggaggcttgca
                        * ***** *                * *** ** ** * ***       

A0A3B5K831_BAD-01      acggccggcagctccggagaatgagcgacgagt----tcgacagcttgct
A0A3B5KWG6_BMF-01      ttggccagaagctccagctgattggggatcagtttcatcgggaacgcgtt
                         **** * ****** *   **  * **  ***    ***  * *  * *

A0A3B5K831_BAD-01      ggataaaggggggatgaggaagaccaacagcaccggatcgaccaaaccga
A0A3B5KWG6_BMF-01      caat------tgtatcagcgaaaccaaaggaaccagggc-------ccgc
                         **       * ** **  * *****  * *** *  *       *** 

A0A3B5K831_BAD-01      tgcaccactcccggagctggtggagctacctgttcagccaccag-gagac
A0A3B5KWG6_BMF-01      tg------tggtggcgcctgggcaccgctctgctcagccttctgtttgac
                       **      *   ** **  * * * *   *** ******  * *   ***

A0A3B5K831_BAD-01      ggagggc---------gagaacggccaccacgacggccacacgcaccgca
A0A3B5KWG6_BMF-01      aggggcttcgtcgctggaggaggaggagcggggcgg--------------
                        * **           *** * *   * *  * ***              

A0A3B5K831_BAD-01      ctgagtag
A0A3B5KWG6_BMF-01      --aggtga
                           **  

© 1998-2019