Dataset for CDS PMAIP1 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A287AZR7_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        atgcgttcttccggatcgcttggctctaggattcgggggctgttggaatc

A0A287AZR7_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        ggcaggatgggaggaattggtaagaagccagccccgggcacatcaaggtc

A0A287AZR7_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        -------------gcgcgggca------gcggcgggagc-----------
Q9GL49_PMAIP1-01        tcaccagtggccggtgtgggcagacgaggcgggaggagcttcgtggttcc

A0A287AZR7_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        -----------------------------------gccaacctcagaggc
Q9GL49_PMAIP1-01        ttcggtccgcctcccgctgccgtccgaggaaaccaaccaacctcagaggc

A0A287AZR7_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        ttttgggcgttcagggtgttgcttttctagctctctcccgcttgctcgct
Q9GL49_PMAIP1-01        ttttgggcgttcagggtgttgcttttctagctctctcccgcttgctcgct

A0A287AZR7_PMAIP1-      ----------------------------ttatctaaggaaaca-------
F1SMU1_PMAIP1-01        tctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgct
Q9GL49_PMAIP1-01        tctgcccgaccgccccgcgcgcagcctgctacctgcagagccaaggtgct
                                                     ** **   **  **       

A0A287AZR7_PMAIP1-      ---------------------------tttatggccaaaggaaaagtgct
F1SMU1_PMAIP1-01        cgggtccggggactgagttctcggagttttgcggcaaagttccggctgct
Q9GL49_PMAIP1-01        cgggtccggggactgagttctcggagttttgcggcaaagttccggctgct
                                                   ***  *** **        ****

A0A287AZR7_PMAIP1-      gtttgcaagtatgccacacagaagctccaataagaatacccagacaaatc
F1SMU1_PMAIP1-01        gtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaacc
Q9GL49_PMAIP1-01        gtttgcggagatgcctggaaggaggtctcgtaggaacactcagacgaacc
                        ******    *****    ** ** **   ** *** ** ***** ** *

A0A287AZR7_PMAIP1-      ctctgaggttggcgctcccgccgctgcccgcggtcaaatgcagaataggg
F1SMU1_PMAIP1-01        ctacgcgggtggccctcccgccagatcctgaagtcgagtgtgccattcag
Q9GL49_PMAIP1-01        ctacgcgggtggccctcccgccagatcctgaagtcgagtgtgccattcag
                        **  * ** **** ********    ** *  *** * **    **   *

A0A287AZR7_PMAIP1-      ctaaggcgtgtgggcacaaagctggctatcaggcagcagataacaaattt
F1SMU1_PMAIP1-01        ttcagaaggattggagacaaactgaacttccggcagaaacttctgaatct
Q9GL49_PMAIP1-01        ttcagaaggattggagacaaactgaacttccggcagaaacttctgaatct
                         * **  *  * **    ** ***    ** ***** *  *    *** *

A0A287AZR7_PMAIP1-      cataatcttttttttttttttagggccg---
F1SMU1_PMAIP1-01        gatagccaaactcttccgcctaggaacctga
Q9GL49_PMAIP1-01        gatagccaaactcttccgtctaggaacctga
                         ***  *    * **     ****  *    

© 1998-2019