Dataset for CDS classical BH3-containing proteins of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

16 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A287AZR7_PMAIP1-      ttat----------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        atgc-------------------------------------------gtt
F1SU81_BCL2L11-01       atgg----------------------------------------------
C1KGB8_BCL2L11-01       atgg----------------------------------------------
F1SU81_BCL2L11-02       atgg----------------------------------------------
F1SU81_BCL2L11-03       atgg----------------------------------------------
A0A287A5N9_HRK-01       atg-----------------------------------------------
F1RM01_BBC3-01          atgg----------------------------------------------
A0A287AEF3_BAD-01       atgggcatcccagaaaatccctcatctgcttccacacacacccaaggaat
A0A287AEF3_BAD-02       --------------------------------------------------
A0A287AIU8_BMF-03       atgg----------------------------------------------
A0A287AIU8_BMF-04       atgg----------------------------------------------
A0A287AIU8_BMF-02       atgg----------------------------------------------
A0A287AIU8_BMF-01       atgg----------------------------------------------
A0A287AIU8_BMF-05       atgg----------------------------------------------

A0A287AZR7_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        cttccggatcgcttggctctaggattcgggggctgttggaatcggcagga
F1SU81_BCL2L11-01       --------------------------------------------------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       --------------------------------------------------
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287A5N9_HRK-01       --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A287AEF3_BAD-01       aaggaagtccggagctgaaccagggaccccggaggaaggcggtgggcggg
A0A287AEF3_BAD-02       --------------------------------------------------
A0A287AIU8_BMF-03       --------------------------------------------------
A0A287AIU8_BMF-04       --------------------------------------------------
A0A287AIU8_BMF-02       --------------------------------------------------
A0A287AIU8_BMF-01       --------------------------------------------------
A0A287AIU8_BMF-05       --------------------------------------------------

A0A287AZR7_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        --------------------------------------------------
Q9GL49_PMAIP1-01        tgggaggaattggtaagaagccagccccgggcacatcaaggtctcaccag
F1SU81_BCL2L11-01       --------------------------------caaagcaaccttccgatg
C1KGB8_BCL2L11-01       --------------------------------caaagcaaccttccgatg
F1SU81_BCL2L11-02       --------------------------------caaagcaaccttccgatg
F1SU81_BCL2L11-03       --------------------------------caaagcaaccttccgatg
A0A287A5N9_HRK-01       --------------------------------------------------
F1RM01_BBC3-01          --------------------------------------------------
A0A287AEF3_BAD-01       gccggagccgtagcggccccgcctcccagagcatgttccagatcccagag
A0A287AEF3_BAD-02       --------------------------------atgttccagatcccagag
A0A287AIU8_BMF-03       ---------------------------------------agccacctcag
A0A287AIU8_BMF-04       ---------------------------------------agccacctcag
A0A287AIU8_BMF-02       ---------------------------------------agccacctcag
A0A287AIU8_BMF-01       ---------------------------------------agccacctcag
A0A287AIU8_BMF-05       ---------------------------------------agccacctcag

A0A287AZR7_PMAIP1-      --------------------ctaaggaaacatttatggccaaaggaaaag
F1SMU1_PMAIP1-01        ------gcgcgggca------gcggcgggagc------------------
Q9GL49_PMAIP1-01        tggccggtgtgggcagacgaggcgggaggagcttcgtggttccttcggtc
F1SU81_BCL2L11-01       taagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaagg
C1KGB8_BCL2L11-01       taagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaagg
F1SU81_BCL2L11-02       taagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaagg
F1SU81_BCL2L11-03       taagttctgagtgtgacagagaaggtggacagttgcagcctgcggaaagg
A0A287A5N9_HRK-01       --------------------------------------------------
F1RM01_BBC3-01          -----cccgagcacgcc--aggagggcagctccccggagcccgtagaggg
A0A287AEF3_BAD-01       tttgagcagagtgagca--ggaaga-------ctccagccctgcagacag
A0A287AEF3_BAD-02       tttgagcagagtgagca--ggaaga-------ctccagccctgcagacag
A0A287AIU8_BMF-03       tgtgtggag---gagct--ggaggatgatgtgttccagccagaggaaggg
A0A287AIU8_BMF-04       tgtgtggag---gagct--ggaggatgatgtgttccagccagaggaaggg
A0A287AIU8_BMF-02       tgtgtggag---gagct--ggaggatgatgtgttccagccagaggaaggg
A0A287AIU8_BMF-01       tgtgtggag---gagct--ggaggatgatgtgttccagccagaggaaggg
A0A287AIU8_BMF-05       tgtgtggag---gagct--ggaggatgatgtgttccagccagaggaaggg

A0A287AZR7_PMAIP1-      tgctgtttgcaa----------------gtatgccac-------acagaa
F1SMU1_PMAIP1-01        ----------------------------gccaacctc-------agaggc
Q9GL49_PMAIP1-01        cgcctcccgctgccgtccgaggaaaccaaccaacctc-------agaggc
F1SU81_BCL2L11-01       cctcctcagctcaggcctggggc-----ccccacctctctacaaacagag
C1KGB8_BCL2L11-01       cctcctcagctcaggcctggggc-----ccccacctctctacagacagag
F1SU81_BCL2L11-02       cctcctcagctcaggcctggggc-----ccccacctctctacaaacagag
F1SU81_BCL2L11-03       cctcctcagctcaggcctggggc-----ccccacctctctacaaacagag
A0A287A5N9_HRK-01       -------------tgtccgtgcc-----ccctgcacc-------gcgg--
F1RM01_BBC3-01          cctggcccgcgacggcccgcgtc-----ccttccccc-------tcag--
A0A287AEF3_BAD-01       -------------gggcctgggc-----cccagcccc-------acaggg
A0A287AEF3_BAD-02       -------------gggcctgggc-----cccagcccc-------acaggg
A0A287AIU8_BMF-03       -------------gagccgggga-----cccagccca-------ggaggg
A0A287AIU8_BMF-04       -------------gagccgggga-----cccagccca-------ggaggg
A0A287AIU8_BMF-02       -------------gagccgggga-----cccagccca-------ggaggg
A0A287AIU8_BMF-01       -------------gagccgggga-----cccagccca-------ggaggg
A0A287AIU8_BMF-05       -------------gagccgggga-----cccagccca-------ggaggg
                                                         *             *  

A0A287AZR7_PMAIP1-      gctccaataagaataccc-----------agacaaatcctctgaggttgg
F1SMU1_PMAIP1-01        ttttgg-----------------------------gcgttcagggtgttg
Q9GL49_PMAIP1-01        ttttgg-----------------------------gcgttcagggtgttg
F1SU81_BCL2L11-01       ---cggcaaggtaatccggaaggagaaggggaccgctgcccccaaggcag
C1KGB8_BCL2L11-01       ---cggca------------------------------------------
F1SU81_BCL2L11-02       ---cggcaaggtaatccggaaggagaaggggaccgctgcccccaaggcag
F1SU81_BCL2L11-03       ---cggca------------------------------------------
A0A287A5N9_HRK-01       ---ccgc---ggcccccc-----------agcc--gtgtgc---------
F1RM01_BBC3-01          ---ccgcctggtgccctc-----------cgcc--gtgtcct----gcgg
A0A287AEF3_BAD-01       -----ac---agaccccc-----------agcc--ctggcgc----acgg
A0A287AEF3_BAD-02       -----ac---agacccccaggccccagcaagcc--ctggcgc----acgg
A0A287AIU8_BMF-03       tctctgc---tgacccgtttgtccag---agccagctgg-------actg
A0A287AIU8_BMF-04       tctctgc---tgacccgtttgtccag---agccagctgg-------actg
A0A287AIU8_BMF-02       tctctgc---tgacccgtttgtccag---agccagctgg-------actg
A0A287AIU8_BMF-01       tctctgc---tgacccgtttgtccag---agccagctgg-------actg
A0A287AIU8_BMF-05       tctctgc---tgacccgtttgtccag---agccagctgg-------actg

A0A287AZR7_PMAIP1-      cgctcccg---------------------------------------ccg
F1SMU1_PMAIP1-01        cttttctagctctctcccgcttgctcgcttctgcccgaccgccccgcgcg
Q9GL49_PMAIP1-01        cttttctagctctctcccgcttgctcgcttctgcccgaccgccccgcgcg
F1SU81_BCL2L11-01       cccccagggcccactggccccaccgaccagccctggcccct------ttg
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       cccccagggcccactggccccaccgaccagccctggcccct------ttg
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287A5N9_HRK-01       ------------------gctt----gcagc-------------------
F1RM01_BBC3-01          cctctgcgaacccggtctgcct----gccgcccccgccgcccccaccctg
A0A287AEF3_BAD-01       cccc--aggcc-------acctgggggaagctggtcaccagcaggggcag
A0A287AEF3_BAD-02       cccc--aggcc-------acctgggggaagctggtcaccagcaggggcag
A0A287AIU8_BMF-03       ccccctcagcc-------gtct----gcagctcttccctctcacgcactg
A0A287AIU8_BMF-04       ccccctcagcc-------gtct----gcagctcttccctctcacgcactg
A0A287AIU8_BMF-02       ccccctcagcc-------gtct----gcagctcttccctctcacgcactg
A0A287AIU8_BMF-01       ccccctcagcc-------gtct----gcagctcttccctctcacgcactg
A0A287AIU8_BMF-05       ccccctcagcc-------gtct----gcagctcttccctctcacgcactg

A0A287AZR7_PMAIP1-      ctgcccgcggtcaaatgcagaata--------------------------
F1SMU1_PMAIP1-01        cagcctgctacctgca----------------------------------
Q9GL49_PMAIP1-01        cagcctgctacctgca----------------------------------
F1SU81_BCL2L11-01       ctaccagatccccgcttttcatcttcgtgagaagatcctccctgctgtct
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       ctaccagatccccgcttttcatcttcgtgagaagatcctccctgctgtct
F1SU81_BCL2L11-03       --------------------------------------------------
A0A287A5N9_HRK-01       --gcgagccgcctgggtctgcgctcctcc---------------gccgcg
F1RM01_BBC3-01          ctgcccgctgcctacctctgcg--ccccc---------------accgcc
A0A287AEF3_BAD-01       c--cg----gccagcagc----agccaccatggagg-cgctggggctgtg
A0A287AEF3_BAD-02       c--cg----gccagcagc----agccaccatggagg-cgctggggctgtg
A0A287AIU8_BMF-03       ctgtg----gccctgggcttcgacccaccagccaggaagacaaggccacc
A0A287AIU8_BMF-04       ctgtg----gccctgggcttcgacccaccagccaggaagacaaggccacc
A0A287AIU8_BMF-02       ctgtg----gccctgggcttcgacccaccagccaggaagacaaggccacc
A0A287AIU8_BMF-01       ctgtg----gccctgggcttcgacccaccagccaggaagacaaggccacc
A0A287AIU8_BMF-05       ctgtg----gccctgggcttcgacccaccagccaggaagacaaggccacc

A0A287AZR7_PMAIP1-      --------------------------------------gggctaaggcg-
F1SMU1_PMAIP1-01        --------------------------------------gagccaaggtgc
Q9GL49_PMAIP1-01        --------------------------------------gagccaaggtgc
F1SU81_BCL2L11-01       cgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       cgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
F1SU81_BCL2L11-03       --------------------------------agacaggagcccagcacc
A0A287A5N9_HRK-01       cag-c------tcactgccgccc---------------ggctcaaggcgc
F1RM01_BBC3-01          ccg-cccgccgtcaccgccgccctggggggcccccgctggcctgggggtc
A0A287AEF3_BAD-01       gagacccggagtcgccacagctcttacccag--agg--ggaccgaggag-
A0A287AEF3_BAD-02       gagacccggagtcgccacagctcttacccag--agg--ggaccgaggag-
A0A287AIU8_BMF-03       cagactctcagtc----cagc-ctccccgagccagg--gtgtcatgctgc
A0A287AIU8_BMF-04       cagactctcagtc----cagc-ctccccgagccagg--gtgtcatgctgc
A0A287AIU8_BMF-02       cagactctcagtc----cagc-ctccccgagccagg--gtgtcatgctgc
A0A287AIU8_BMF-01       cagactctcagtc----cagc-ctccccgagccagg--gtgtcatgctgc
A0A287AIU8_BMF-05       cagactctcagtc----cagc-ctccccgagccagg--gtgtcatgctgc

A0A287AZR7_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        tc------gggtccggggactgagttctcggagtt---------------
Q9GL49_PMAIP1-01        tc------gggtccggggactgagttctcggagtt---------------
F1SU81_BCL2L11-01       catgagttgtgacaaatcaacacaaaccccaagtcctcct----------
C1KGB8_BCL2L11-01       --------------------------------------------------
F1SU81_BCL2L11-02       catgagttgtgacaaatcaacacaaaccccaagtcctcct----------
F1SU81_BCL2L11-03       catgagttgtgacaaatcaacacaaaccccaagtcctcct----------
A0A287A5N9_HRK-01       tcggcgacgagctgc---accagcgcacc-atg-----------------
F1RM01_BBC3-01          cccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactc
A0A287AEF3_BAD-01       --gatgaagggactgaggatgaggagctcagc--ccctt-----------
A0A287AEF3_BAD-02       --gatgaagggactgaggatgaggagctcagc--ccctt-----------
A0A287AIU8_BMF-03       cttgtggggtgactgagga-----accccagcgactctt-----------
A0A287AIU8_BMF-04       cttgtggggtgactgagga-----accccagcgactctt-----------
A0A287AIU8_BMF-02       cttgtggggtgactgagga-----accccagcgactctt-----------
A0A287AIU8_BMF-01       cttgtggggtgactgagga-----accccagcgactctt-----------
A0A287AIU8_BMF-05       cttgtggggtgactgagga-----accccagcgactctt-----------

A0A287AZR7_PMAIP1-      ----tgtgggcacaa-----------------agctggctatcaggcagc
F1SMU1_PMAIP1-01        ----ttgcggcaaagttccggctgctgtttg-cggagatgcctggaagga
Q9GL49_PMAIP1-01        ----ttgcggcaaagttccggctgctgtttg-cggagatgcctggaagga
F1SU81_BCL2L11-01       ----tgccaagccttcaaccattatctcagtgcgatggcttccatgaggc
C1KGB8_BCL2L11-01       ------------------------------------agcttccatgaggc
F1SU81_BCL2L11-02       ----tgccaagccttcaaccattatctcagtgcgatggcttccatgaggc
F1SU81_BCL2L11-03       ----tgccaagccttcaaccattatctcagtgcgatggcttccatgaggc
A0A287A5N9_HRK-01       ----tggcggcgcagcgcgcggagccggagggcgccggcgccc----ggc
F1RM01_BBC3-01          tcgccggcggagcagcacctggaat-------cgccagtgccc----agc
A0A287AEF3_BAD-01       ----ccgcggc---------------------cgatcgctctc----ggc
A0A287AEF3_BAD-02       ----ccgcggc---------------------cgatcgctctc----ggc
A0A287AIU8_BMF-03       ----ttatggcaa-------------------tgctggctacc----ggc
A0A287AIU8_BMF-04       ----ttatggcaa-------------------tgctggctacc----ggc
A0A287AIU8_BMF-02       ----ttatggcaa-------------------tgctggctacc----ggc
A0A287AIU8_BMF-01       ----ttatggcaa-------------------tgctggctacc----ggc
A0A287AIU8_BMF-05       ----ttatggcaa-------------------tgctggctacc----ggc

A0A287AZR7_PMAIP1-      a-------------------------------------------------
F1SMU1_PMAIP1-01        ggtct-----------cgtaggaacactcagacgaaccctacgcgggtgg
Q9GL49_PMAIP1-01        ggtct-----------cgtaggaacactcagacgaaccctacgcgggtgg
F1SU81_BCL2L11-01       agtct-------caggctga---acccgcagatatgcgcccg--------
C1KGB8_BCL2L11-01       agtct-------caggctga---acccgcagatatgcgcccg--------
F1SU81_BCL2L11-02       agtct-------caggctga---acccgcagatatgcgcccg--------
F1SU81_BCL2L11-03       agtct-------caggctga---acccgcagatatgcgcccg--------
A0A287A5N9_HRK-01       gcgct------------------ccccacctac-tggccctgg-------
F1RM01_BBC3-01          gctccgggggccctggcgggcggccccacccaagcagccccggga-----
A0A287AEF3_BAD-01       gcccc----ccatcctctgggctgcacagcgttatggcc----gcgag--
A0A287AEF3_BAD-02       gcccc----ccatcctctgggctgcacagcgttatggcc----gcgag--
A0A287AIU8_BMF-03       tccct----ctccctgccggtttccccgcaggcttgccccttggcgaaca
A0A287AIU8_BMF-04       tccct----ctccctgccggtttccccgcaggcttgccccttggcgaaca
A0A287AIU8_BMF-02       tccct----ctccctgccggtttccccgcaggcttgccccttggcgaaca
A0A287AIU8_BMF-01       tccct----ctccctgccggtttccccgcaggcttgccccttggcgaaca
A0A287AIU8_BMF-05       tccct----ctccctgccggtttccccgcaggcttgccccttggcgaaca

A0A287AZR7_PMAIP1-      --------------------------------------------------
F1SMU1_PMAIP1-01        ccctcccgccagat--------------cctgaagtcgagtgtgccattc
Q9GL49_PMAIP1-01        ccctcccgccagat--------------cctgaagtcgagtgtgccattc
F1SU81_BCL2L11-01       -------------------------------gagatatggattgcgcagg
C1KGB8_BCL2L11-01       -------------------------------gagatatggattgcgcagg
F1SU81_BCL2L11-02       -------------------------------gagatatggattgcgcagg
F1SU81_BCL2L11-03       -------------------------------gagatatggattgcgcagg
A0A287A5N9_HRK-01       --------------------------------------ctgtgcgcgg--
F1RM01_BBC3-01          ---atccggggggaggaggagcagtgggcccgagagatcggggcccag--
A0A287AEF3_BAD-01       ---ctccggaggat-----------------gagtgacgagttccagggt
A0A287AEF3_BAD-02       ---ctccggaggat-----------------ga-----------------
A0A287AIU8_BMF-03       gccccccgaagggcagtggcaacatcgagcagaggtacagattgcccgaa
A0A287AIU8_BMF-04       gccccccgaagggcagtggcaacatcgagcagaggtacagattgcccgaa
A0A287AIU8_BMF-02       gccccccgaagggcagtggcaacatcgagcagaggtacagattgcccgaa
A0A287AIU8_BMF-01       gccccccgaagggcagtggcaacatcgagcagaggtacagattgcccgaa
A0A287AIU8_BMF-05       gccccccgaagggcagtggcaacatcgagcagaggtacagattgcccgaa

A0A287AZR7_PMAIP1-      --------------gataacaaatttcataatctt---------------
F1SMU1_PMAIP1-01        agttcagaaggattggagacaa---------actgaacttccggcagaaa
Q9GL49_PMAIP1-01        agttcagaaggattggagacaa---------actgaacttccggcagaaa
F1SU81_BCL2L11-01       agttacggcgtattggagacgaatttaatgcatattacccaaggagggtc
C1KGB8_BCL2L11-01       agttacggcgtattggagacgaatttaatgcatattacccaaggagggta
F1SU81_BCL2L11-02       agttacggcgtattggagacgaatttaatgcatattacccaaggagggta
F1SU81_BCL2L11-03       agttacggcgtattggagacgaatttaatgcatattacccaaggagggta
A0A287A5N9_HRK-01       --ccgc-gcaggtggcg------------gcgctg---------------
F1RM01_BBC3-01          --ctgcggcggatggctgacgatctcaacgcgctgtacgagcggcggaga
A0A287AEF3_BAD-01       tccttcaagggactt----cctcgcccgaagagcgcgggcacagcgacg-
A0A287AEF3_BAD-02       --------------------------------------------------
A0A287AIU8_BMF-03       aacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcac
A0A287AIU8_BMF-04       aacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcac
A0A287AIU8_BMF-02       aacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcac
A0A287AIU8_BMF-01       aacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcac
A0A287AIU8_BMF-05       aacttcagtgcattgcagaccagttccatcggcttcatatgcagcagga-

A0A287AZR7_PMAIP1-      -----------------------------------------------ttt
F1SMU1_PMAIP1-01        cttctgaatctgata--------------------------gccaaactc
Q9GL49_PMAIP1-01        cttctgaatctgata--------------------------gccaaactc
F1SU81_BCL2L11-01       tttctgaataattaccaagcagccgaagcccaccctcagatggttatctt
C1KGB8_BCL2L11-01       atgctgttttctt-----------------taccccc---------cttt
F1SU81_BCL2L11-02       atgctgttttctt-----------------taccccc---------cttt
F1SU81_BCL2L11-03       atgctgttttctt-----------------taccccc---------cttt
A0A287A5N9_HRK-01       -----------gcag----------------cctgg--------------
F1RM01_BBC3-01          caagaggagcagcagcgacaccgcccctcgccctggagggttctgtacaa
A0A287AEF3_BAD-01       cagatgcggcaaagc----------------cccagctggaagcgcttcc
A0A287AEF3_BAD-02       --------------------------------------------------
A0A287AIU8_BMF-03       cagcagaaccaaaat----------------cgtgtgtggtggcaaatcc
A0A287AIU8_BMF-04       cagcagaaccaaaat----------------cgtgtgtggtggcaaatcc
A0A287AIU8_BMF-02       cagcagaaccaaaat----------------cgtgtgtggtggcaaatcc
A0A287AIU8_BMF-01       cagcagaaccaaaat----------------cgtgtgtggtggcaaatcc
A0A287AIU8_BMF-05       ------------------------------------------------gt

A0A287AZR7_PMAIP1-      tttttttttagggccg----------------------------------
F1SMU1_PMAIP1-01        ttccgcctaggaacc-----------------------------------
Q9GL49_PMAIP1-01        ttccgtctaggaacc-----------------------------------
F1SU81_BCL2L11-01       acgactgttacgctacatcgcccgtctggtgtggaggatgcag-------
C1KGB8_BCL2L11-01       tcccctcacaccctccctcccccttacatt--------------------
F1SU81_BCL2L11-02       tcccctcacaccctccctcccccttacatt--------------------
F1SU81_BCL2L11-03       tcccctcacaccctccctcccccttacatt--------------------
A0A287A5N9_HRK-01       ----------------ctgc-tc---------ggc-------------ag
F1RM01_BBC3-01          tctcatcatgggacttctgc-ccttacccaggggccgtggagcccccgag
A0A287AEF3_BAD-01       tccagtcctggtggtaccggaactcggggagaggaggcccc---------
A0A287AEF3_BAD-02       --------------------------------------------------
A0A287AIU8_BMF-03       tcctgtttctacacaacctcgctttgcatggagatgagaacaggaatggg
A0A287AIU8_BMF-04       tcctgtttctacacaacctcgctttgcatggagatgagaacaggaatggg
A0A287AIU8_BMF-02       tcctgtttctacacaacctcgctttgcatggagatgagaacaggaatggg
A0A287AIU8_BMF-01       tcctgtttctacacaacctcgctttgcatggagatgagaacaggaatggg
A0A287AIU8_BMF-05       tcccgt--------------------cgtgg-------------------

A0A287AZR7_PMAIP1-      ---------------
F1SMU1_PMAIP1-01        ------------tga
Q9GL49_PMAIP1-01        ------------tga
F1SU81_BCL2L11-01       ------------tga
C1KGB8_BCL2L11-01       ------------taa
F1SU81_BCL2L11-02       ------------taa
F1SU81_BCL2L11-03       ------------taa
A0A287A5N9_HRK-01       gcggaacttg--tag
F1RM01_BBC3-01          atggagcctaattag
A0A287AEF3_BAD-01       gccccctcccaatga
A0A287AEF3_BAD-02       ---------------
A0A287AIU8_BMF-03       gcaggtcccaggtga
A0A287AIU8_BMF-04       gcaggtcccaggtga
A0A287AIU8_BMF-02       gcaggtcccaggtga
A0A287AIU8_BMF-01       gcaggtcccaggtga
A0A287AIU8_BMF-05       ------cttggttaa

© 1998-2019