Dataset for CDS BMF of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287AIU8_BMF-02      atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagcc
A0A287AIU8_BMF-04      atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagcc
A0A287AIU8_BMF-03      atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagcc
A0A287AIU8_BMF-01      atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagcc
A0A287AIU8_BMF-05      atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagcc
                       **************************************************

A0A287AIU8_BMF-02      agaggaaggggagccggggacccagcccaggagggtctctgctgacccgt
A0A287AIU8_BMF-04      agaggaaggggagccggggacccagcccaggagggtctctgctgacccgt
A0A287AIU8_BMF-03      agaggaaggggagccggggacccagcccaggagggtctctgctgacccgt
A0A287AIU8_BMF-01      agaggaaggggagccggggacccagcccaggagggtctctgctgacccgt
A0A287AIU8_BMF-05      agaggaaggggagccggggacccagcccaggagggtctctgctgacccgt
                       **************************************************

A0A287AIU8_BMF-02      ttgtccagagccagctggactgccccctcagccgtctgcagctcttccct
A0A287AIU8_BMF-04      ttgtccagagccagctggactgccccctcagccgtctgcagctcttccct
A0A287AIU8_BMF-03      ttgtccagagccagctggactgccccctcagccgtctgcagctcttccct
A0A287AIU8_BMF-01      ttgtccagagccagctggactgccccctcagccgtctgcagctcttccct
A0A287AIU8_BMF-05      ttgtccagagccagctggactgccccctcagccgtctgcagctcttccct
                       **************************************************

A0A287AIU8_BMF-02      ctcacgcactgctgtggccctgggcttcgacccaccagccaggaagacaa
A0A287AIU8_BMF-04      ctcacgcactgctgtggccctgggcttcgacccaccagccaggaagacaa
A0A287AIU8_BMF-03      ctcacgcactgctgtggccctgggcttcgacccaccagccaggaagacaa
A0A287AIU8_BMF-01      ctcacgcactgctgtggccctgggcttcgacccaccagccaggaagacaa
A0A287AIU8_BMF-05      ctcacgcactgctgtggccctgggcttcgacccaccagccaggaagacaa
                       **************************************************

A0A287AIU8_BMF-02      ggccacccagactctcagtccagcctccccgagccagggtgtcatgctgc
A0A287AIU8_BMF-04      ggccacccagactctcagtccagcctccccgagccagggtgtcatgctgc
A0A287AIU8_BMF-03      ggccacccagactctcagtccagcctccccgagccagggtgtcatgctgc
A0A287AIU8_BMF-01      ggccacccagactctcagtccagcctccccgagccagggtgtcatgctgc
A0A287AIU8_BMF-05      ggccacccagactctcagtccagcctccccgagccagggtgtcatgctgc
                       **************************************************

A0A287AIU8_BMF-02      cttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggc
A0A287AIU8_BMF-04      cttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggc
A0A287AIU8_BMF-03      cttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggc
A0A287AIU8_BMF-01      cttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggc
A0A287AIU8_BMF-05      cttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggc
                       **************************************************

A0A287AIU8_BMF-02      taccggctccctctccctgccggtttccccgcaggcttgccccttggcga
A0A287AIU8_BMF-04      taccggctccctctccctgccggtttccccgcaggcttgccccttggcga
A0A287AIU8_BMF-03      taccggctccctctccctgccggtttccccgcaggcttgccccttggcga
A0A287AIU8_BMF-01      taccggctccctctccctgccggtttccccgcaggcttgccccttggcga
A0A287AIU8_BMF-05      taccggctccctctccctgccggtttccccgcaggcttgccccttggcga
                       **************************************************

A0A287AIU8_BMF-02      acagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
A0A287AIU8_BMF-04      acagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
A0A287AIU8_BMF-03      acagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
A0A287AIU8_BMF-01      acagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
A0A287AIU8_BMF-05      acagccccccgaagggcagtggcaacatcgagcagaggtacagattgccc
                       **************************************************

A0A287AIU8_BMF-02      gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcag
A0A287AIU8_BMF-04      gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcag
A0A287AIU8_BMF-03      gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcag
A0A287AIU8_BMF-01      gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcag
A0A287AIU8_BMF-05      gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcag
                       **************************************************

A0A287AIU8_BMF-02      caccagcagaaccaaaatcgtgtgtggtggcaaatcctcctgtttctaca
A0A287AIU8_BMF-04      caccagcagaaccaaaatcgtgtgtggtggcaaatcctcctgtttctaca
A0A287AIU8_BMF-03      caccagcagaaccaaaatcgtgtgtggtggcaaatcctcctgtttctaca
A0A287AIU8_BMF-01      caccagcagaaccaaaatcgtgtgtggtggcaaatcctcctgtttctaca
A0A287AIU8_BMF-05      ga---------------------------------gttcccgt-------
                        *                                   *** **       

A0A287AIU8_BMF-02      caacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggt
A0A287AIU8_BMF-04      caacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggt
A0A287AIU8_BMF-03      caacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggt
A0A287AIU8_BMF-01      caacctcgctttgcatggagatgagaacaggaatggggcaggtcccaggt
A0A287AIU8_BMF-05      -------------cgtgg-------------------------cttggtt
                                    * ***                         *   * *

A0A287AIU8_BMF-02      ga
A0A287AIU8_BMF-04      ga
A0A287AIU8_BMF-03      ga
A0A287AIU8_BMF-01      ga
A0A287AIU8_BMF-05      aa
                        *

© 1998-2018