Dataset for CDS BCL2L11 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F1SU81_BCL2L11-01      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
C1KGB8_BCL2L11-01      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
F1SU81_BCL2L11-02      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
F1SU81_BCL2L11-03      atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtgg
                       **************************************************

F1SU81_BCL2L11-01      acagttgcagcctgcggaaaggcctcctcagctcaggcctggggccccca
C1KGB8_BCL2L11-01      acagttgcagcctgcggaaaggcctcctcagctcaggcctggggccccca
F1SU81_BCL2L11-02      acagttgcagcctgcggaaaggcctcctcagctcaggcctggggccccca
F1SU81_BCL2L11-03      acagttgcagcctgcggaaaggcctcctcagctcaggcctggggccccca
                       **************************************************

F1SU81_BCL2L11-01      cctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgc
C1KGB8_BCL2L11-01      cctctctacagacagagcggca----------------------------
F1SU81_BCL2L11-02      cctctctacaaacagagcggcaaggtaatccggaaggagaaggggaccgc
F1SU81_BCL2L11-03      cctctctacaaacagagcggca----------------------------
                       ********** ***********                            

F1SU81_BCL2L11-01      tgcccccaaggcagcccccagggcccactggccccaccgaccagccctgg
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SU81_BCL2L11-02      tgcccccaaggcagcccccagggcccactggccccaccgaccagccctgg
F1SU81_BCL2L11-03      --------------------------------------------------
                                                                         

F1SU81_BCL2L11-01      cccctttgctaccagatccccgcttttcatcttcgtgagaagatcctccc
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SU81_BCL2L11-02      cccctttgctaccagatccccgcttttcatcttcgtgagaagatcctccc
F1SU81_BCL2L11-03      --------------------------------------------------
                                                                         

F1SU81_BCL2L11-01      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SU81_BCL2L11-02      tgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagc
F1SU81_BCL2L11-03      ----------------------------------------agacaggagc
                                                                         

F1SU81_BCL2L11-01      ccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
C1KGB8_BCL2L11-01      --------------------------------------------------
F1SU81_BCL2L11-02      ccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
F1SU81_BCL2L11-03      ccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttg
                                                                         

F1SU81_BCL2L11-01      ccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
C1KGB8_BCL2L11-01      ------------------------------agcttccatgaggcagtctc
F1SU81_BCL2L11-02      ccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
F1SU81_BCL2L11-03      ccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
                                                      *******************

F1SU81_BCL2L11-01      aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagtta
C1KGB8_BCL2L11-01      aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagtta
F1SU81_BCL2L11-02      aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagtta
F1SU81_BCL2L11-03      aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagtta
                       **************************************************

F1SU81_BCL2L11-01      cggcgtattggagacgaatttaatgcatattacccaaggagggtctttct
C1KGB8_BCL2L11-01      cggcgtattggagacgaatttaatgcatattacccaaggagggtaatgct
F1SU81_BCL2L11-02      cggcgtattggagacgaatttaatgcatattacccaaggagggtaatgct
F1SU81_BCL2L11-03      cggcgtattggagacgaatttaatgcatattacccaaggagggtaatgct
                       ********************************************  * **

F1SU81_BCL2L11-01      gaataattaccaagcagccgaagcccaccctcagatggttatcttacgac
C1KGB8_BCL2L11-01      gttttctt-----------------taccccc---------cttttcccc
F1SU81_BCL2L11-02      gttttctt-----------------taccccc---------cttttcccc
F1SU81_BCL2L11-03      gttttctt-----------------taccccc---------cttttcccc
                       *  *  **                  **** *           ** *  *

F1SU81_BCL2L11-01      tgttacgctacatcgcccgtctggtgtggaggatgcagtga
C1KGB8_BCL2L11-01      tcacaccctccctcccccttacatt-------------taa
F1SU81_BCL2L11-02      tcacaccctccctcccccttacatt-------------taa
F1SU81_BCL2L11-03      tcacaccctccctcccccttacatt-------------taa
                       *   ** ** * ** *** *    *             * *

© 1998-2018