Dataset for CDS BBC3 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F1RM01_BBC3-01      ------------------------------------------------------------
F1RM01_BBC3-04      atgaccgtgtttgtgggaggttgtgctggccagccagtgccttgggtcagcccccccacc
F1RM01_BBC3-03      ------------------------------------------------------------
F1RM01_BBC3-02      ------------------------------------------------------------
                                                                                

F1RM01_BBC3-01      ------------------------------------------------------------
F1RM01_BBC3-04      atggggggggcgtgtctcttggggccttctcacctgcctcccctccatctgggccttgtg
F1RM01_BBC3-03      ------------------------------------------------------------
F1RM01_BBC3-02      -----------atggcttctggagc-----------------------------------
                                                                                

F1RM01_BBC3-01      ------------------------------------------------------------
F1RM01_BBC3-04      tgtgttgtgggtgccagccctgggcttccctgcctgccacgtgtcctcatgcctgggttc
F1RM01_BBC3-03      ------------------------------------------------------------
F1RM01_BBC3-02      ------------------------------------------------------------
                                                                                

F1RM01_BBC3-01      ------------------------------------------------------------
F1RM01_BBC3-04      aagagtggggtgccctgtgtaccccagggaggggggtgccctgggggccggcctgatgcc
F1RM01_BBC3-03      ------------------------------------------------------------
F1RM01_BBC3-02      ----------------gtgtcccatcagtgggccagtgagcaggaacctgtc--------
                                                                                

F1RM01_BBC3-01      ------------------------------------------------------------
F1RM01_BBC3-04      ccctgcacttctcagctgaccgtgcccctctgtcctgtcctgcaggccccagggagcgcc
F1RM01_BBC3-03      ------------------------------------------------------------
F1RM01_BBC3-02      -----------------------------------------acaggccccagggagcgcc
                                                                                

F1RM01_BBC3-01      -----------------------------gcgagagtcagtgcaggggct-gcccgggca
F1RM01_BBC3-04      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgac
F1RM01_BBC3-03      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgac
F1RM01_BBC3-02      atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgac
                                                  *  *** * **  **** ** ***** *  

F1RM01_BBC3-01      tgtccgtgcc------------------------------cagtgcccagggctttctg-
F1RM01_BBC3-04      ggcccgcgtcccttccccctcagccgcctggtgccctccgccgtgtcctgcggcctctgc
F1RM01_BBC3-03      ggcccgcgtcccttccccctcagccgcctggtgccctccgccgtgtcctgcggcctctgc
F1RM01_BBC3-02      ggcccgcgtcccttccccctcagccgcctggtgccctccgccgtgtcctgcggcctctgc
                     * *** * *                              * *** ** * *   **** 

F1RM01_BBC3-01      ------------------------------ctcaccctg---------------------
F1RM01_BBC3-04      gaacccggtctgcctgccgcccccgccgcccccaccctgctgcccgctgcctacctctgc
F1RM01_BBC3-03      gaacccggtctgcctgccgcccccgccgcccccaccctgctgcccgctgcctacctctgc
F1RM01_BBC3-02      gaacccggtctgcctgccgcccccgccgcccccaccctgctgcccgctgcctacctctgc
                                                  * *******                     

F1RM01_BBC3-01      ---------gccccacc-------------------------------------------
F1RM01_BBC3-04      gcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
F1RM01_BBC3-03      gcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
F1RM01_BBC3-02      gcccccaccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggt
                             ***** **                                           

F1RM01_BBC3-01      -----------------agattc--------atggtcctcagccctcactctcgccggcg
F1RM01_BBC3-04      ccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcg
F1RM01_BBC3-03      ccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcg
F1RM01_BBC3-02      ccccgcagccggccccgaggcccgcgccccgacggtcctcagccctcactctcgccggcg
                                     **   *        * ***************************

F1RM01_BBC3-01      gagcagcacctggaatcgccagtgcccagcgctccgggggccctggcgggcggccccacc
F1RM01_BBC3-04      gagcagcacctggaatcgccagtgcccagcgctccgggggccctggcgggcggccccacc
F1RM01_BBC3-03      gagcagcacctggaatcgccagtgcccagcgctccgggggccctggcgggcggccccacc
F1RM01_BBC3-02      gagcagcacctggaatcgccagtgcccagcgctccgggggccctggcgggcggccccacc
                    ************************************************************

F1RM01_BBC3-01      caagcagccccgggaatccggggggaggaggagcagtgggcccgagagatcggggcccag
F1RM01_BBC3-04      caagcagccccgggaatccggggggaggaggagcagtgggcccgagagatcggggcccag
F1RM01_BBC3-03      caagcagccccgggaatccggggggaggaggagcagtgggcccgagagatcggggcccag
F1RM01_BBC3-02      caagcagccccgggaatccggggggaggaggagcagtgggcccgagagatcggggcccag
                    ************************************************************

F1RM01_BBC3-01      ctgcggcggatggctgacgatctcaacgcgctgtacgagcggcgg---------------
F1RM01_BBC3-04      ctgcggcggatggctgacgatctcaacgcgctgtacgagcggcgggtgagtgctggggga
F1RM01_BBC3-03      ctgcggcggatggctgacgatctcaacgcgctgtacgagcggcgg---------------
F1RM01_BBC3-02      ctgcggcggatggctgacgatctcaacgcgctgtacgagcggcgg---------------
                    *********************************************               

F1RM01_BBC3-01      -----agaca---------------------------------------------agagg
F1RM01_BBC3-04      ggggtagacggcaggtgggacttcccgcggggagggggttgggggcgacccagccagatg
F1RM01_BBC3-03      -----agaca---------------------------------------------agagg
F1RM01_BBC3-02      -----agaca---------------------------------------------agagg
                         ****                                              *** *

F1RM01_BBC3-01      agcagcagcgacaccgcccc-----------tcgccctggagg-----------------
F1RM01_BBC3-04      tgcggcagc--tgctgccctgcgcggcggggtcgcgctggggacaggcaggtgggagggg
F1RM01_BBC3-03      agcagcagcgacaccgcccc-----------tcgccctggagg-----------------
F1RM01_BBC3-02      agcagcagcgacaccgcccc-----------tcgccctggagg-----------------
                     ** *****    * ****            **** **** *                  

F1RM01_BBC3-01      -gttctgt------------------------------------acaatctcatcatggg
F1RM01_BBC3-04      cggcctgtccgcggagccaccgtaaggcccgcgctgcggctggcaccaccgggtcgaggg
F1RM01_BBC3-03      -gttctgt------------------------------------acaatctcatcatggg
F1RM01_BBC3-02      -gttctgt------------------------------------acaatctcatcatggg
                     *  ****                                    ** * *   **  ***

F1RM01_BBC3-01      ac---------------------------ttctgcccttacccaggggccg-----tgga
F1RM01_BBC3-04      ccagggccggggcagcctcgagcgttacggtgtgcccgcggccggcggccggcggccggc
F1RM01_BBC3-03      ac---------------------------ttctgcccttacccaggggccg-----tgga
F1RM01_BBC3-02      ac---------------------------ttctgcccttacccaggggccg-----tgga
                     *                            * *****    ** * *****      ** 

F1RM01_BBC3-01      gcccccgaga--------tggagc---------------------------ctaattag-
F1RM01_BBC3-04      ggccgcgagaactgagggcggcgctcagccgagcggctcatatatcccaggctatttata
F1RM01_BBC3-03      gcccccgaga--------tggagc---------------------------ctaattag-
F1RM01_BBC3-02      gcccccgaga--------tggagc---------------------------ctaattag-
                    * ** *****         ** **                           *** ***  

F1RM01_BBC3-01      --------
F1RM01_BBC3-04      gccggtga
F1RM01_BBC3-03      --------
F1RM01_BBC3-02      --------
                            

© 1998-2019