Dataset for CDS BAD of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      atgggcatcccagaaaatccctcatctgcttccacacacacccaaggaat
                                                                         

A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      aaggaagtccggagctgaaccagggaccccggaggaaggcggtgggcggg
                                                                         

A0A287AEF3_BAD-02      --------------------------------atgttccagatcccagag
A0A287AEF3_BAD-01      gccggagccgtagcggccccgcctcccagagcatgttccagatcccagag
                                                       ******************

A0A287AEF3_BAD-02      tttgagcagagtgagcaggaagactccagccctgcagacaggggcctggg
A0A287AEF3_BAD-01      tttgagcagagtgagcaggaagactccagccctgcagacaggggcctggg
                       **************************************************

A0A287AEF3_BAD-02      ccccagccccacagggacagacccccaggccccagcaagccctggcgcac
A0A287AEF3_BAD-01      ccccagccccacagggacagaccccc-----------agccctggcgcac
                       **************************           *************

A0A287AEF3_BAD-02      ggccccaggccacctgggggaagctggtcaccagcaggggcagccggcca
A0A287AEF3_BAD-01      ggccccaggccacctgggggaagctggtcaccagcaggggcagccggcca
                       **************************************************

A0A287AEF3_BAD-02      gcagcagccaccatggaggcgctggggctgtggagacccggagtcgccac
A0A287AEF3_BAD-01      gcagcagccaccatggaggcgctggggctgtggagacccggagtcgccac
                       **************************************************

A0A287AEF3_BAD-02      agctcttacccagaggggaccgaggaggatgaagggactgaggatgagga
A0A287AEF3_BAD-01      agctcttacccagaggggaccgaggaggatgaagggactgaggatgagga
                       **************************************************

A0A287AEF3_BAD-02      gctcagccccttccgcggccgatcgctctcggcgccccccatcctctggg
A0A287AEF3_BAD-01      gctcagccccttccgcggccgatcgctctcggcgccccccatcctctggg
                       **************************************************

A0A287AEF3_BAD-02      ctgcacagcgttatggccgcgagctccggaggatga--------------
A0A287AEF3_BAD-01      ctgcacagcgttatggccgcgagctccggaggatgagtgacgagttccag
                       ************************************              

A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      ggttccttcaagggacttcctcgcccgaagagcgcgggcacagcgacgca
                                                                         

A0A287AEF3_BAD-02      --------------------------------------------------
A0A287AEF3_BAD-01      gatgcggcaaagccccagctggaagcgcttcctccagtcctggtggtacc
                                                                         

A0A287AEF3_BAD-02      --------------------------------------
A0A287AEF3_BAD-01      ggaactcggggagaggaggccccgccccctcccaatga
                                                             

© 1998-2019