Dataset for CDS classical BH3-containing proteins of organism Stegastes partitus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B5B8F6_BMF-01      atggacgatgaggaggatgatgtttttgagccagacccccactgctggc-
A0A3B5BAL2_BAD-01      atggctgc----------------------acaattctctattagtggca
                       ****  *                        **   * * * *  **** 

A0A3B5B8F6_BMF-01      ----gcacaacattcagggagataaagtgtgaagaccggggcacacagac
A0A3B5BAL2_BAD-01      gcgagtccgacccggaggaggtagaagag--------ggagaaaacaa--
                           *  * **    ***  *   *** *        ** * * ***   

A0A3B5B8F6_BMF-01      tcctggtcctgccctgcaaccaaacaacggcatgc-tgccctgtggagtc
A0A3B5BAL2_BAD-01      --------ccatccaccagcagaacagccg-atgcatgtcttcgagcgcc
                               *   **  ** *  **** * * **** ** * *   * * *

A0A3B5B8F6_BMF-01      gcag-----------aggagcccagaccactcttctacggt---------
A0A3B5BAL2_BAD-01      gcaacctcgccttacctgaactcagaaccccagccgccggccggatcagg
                       ***              ** * **** * *    *  ***          

A0A3B5B8F6_BMF-01      ---aacgcaggtttt----cgattgcacttcccagcacgctttgagctta
A0A3B5BAL2_BAD-01      ctgaactcagagtcccacgcgaccacggtctccagaga------------
                          *** ***  *      ***   *  *  ****               

A0A3B5B8F6_BMF-01      ttggggatcaccaagcgaggcaacaacaaggaagtga----------aat
A0A3B5BAL2_BAD-01      -cgaggagctccaggccaggggggaagaggaggccggcacgcccactgac
                         * *** * *** ** ***    ** * *     *            * 

A0A3B5B8F6_BMF-01      ggagc---------aaaacgggatggagcagctgccccggcagcaacctg
A0A3B5BAL2_BAD-01      ggagctccgttcaggggacggtctaagtcggctccacctgca-----ctg
                       *****            ****  *    * *** * ** ***     ***

A0A3B5B8F6_BMF-01      tggcgcgcagcgtggaggcttgcattggacagaaactccagctgatagga
A0A3B5BAL2_BAD-01      tgg---gccgccaagaagt-----acggccagaagctgcgaaggatgagc
                       ***   ** **   ** *        ** ***** ** *    ***  * 

A0A3B5B8F6_BMF-01      gaccagtttcaccgggaacacctacaactgtatcatcgaaaccaaaggaa
A0A3B5BAL2_BAD-01      gacgagtttgacag------cctgcta-gataaaggggagatgaagaggg
                       *** ***** ** *      *** * *   **     ** *  **  *  

A0A3B5B8F6_BMF-01      ccaggggccgctgtggtggc-gcctggccgcagccctactc---------
A0A3B5BAL2_BAD-01      tgaggag----tgcagggacggccaaacagatgcaccactctaaaagctg
                         *** *    **  * * * ***   * *  ** * ****         

A0A3B5B8F6_BMF-01      ----agccttctgtttga----cagggggttcattgctggaggaggtg--
A0A3B5BAL2_BAD-01      gtggagctacctctttagtcaccagga--------gctggagggagagaa
                           ***   ** ***      ****         ********  * *  

A0A3B5B8F6_BMF-01      --------gtgcaggacgga------------ggtga
A0A3B5BAL2_BAD-01      caaccaccatgaaaaccacacacatcgcaatgagtag
                                ** *   *  *             **  

© 1998-2019