Dataset for CDS classical BH3-containing proteins of organism Seriola lalandi dorsalis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B4W9T1_BAD-01       atggctgcaaa-----------cttcaccattt------cagacagtga-
A0A3B4WM88_BMF-01       atggacgatgaggaggatgatg------tgtttgagc--cagaccccca-
A0A3B4XZH1_BCL2L11      atgaaagcccaggctgacggtgccgctctattcatccaacagaccacaaa
                        ***   *   *                   **       *****    * 

A0A3B4W9T1_BAD-01       --------gtcagagccatcgga-----ggaggtagacgaaggagaaatg
A0A3B4WM88_BMF-01       ------ctgctggcgc-accacattcagggagataaagtgtgaagaccgg
A0A3B4XZH1_BCL2L11      accggtccgatggctcgaccgcagtaacggcaagaggggagagcgaaggg
                                *   *  * * *  *     **    *         **   *

A0A3B4W9T1_BAD-01       agccaatcactaactgg---------------------------------
A0A3B4WM88_BMF-01       ggcacacaaacacctggccc------agccctggcactga----------
A0A3B4XZH1_BCL2L11      gatccaccactcgtcggtgccgctggagccccggcgcaaaaccccagttc
                             *  *      **                                 

A0A3B4W9T1_BAD-01       -----gcaagagca------------------------------------
A0A3B4WM88_BMF-01       -----acaacggcatgct----------------------------gccc
A0A3B4XZH1_BCL2L11      gaaagacagcggcgagcggaaaccatagccacctctcctggcaacagcct
                              **   **                                     

A0A3B4W9T1_BAD-01       --------------------------------------------------
A0A3B4WM88_BMF-01       tgtggagtcgcaaaggagccc-----------------------------
A0A3B4XZH1_BCL2L11      aggcgtgtttcaaaagaggtctatattcagctaccctcgtcgctcgtcca
                                                                          

A0A3B4W9T1_BAD-01       --ggagctttct-------caacgccacaccctcaccttgcctgaactcc
A0A3B4WM88_BMF-01       --agaccactcttctacggcaacg-caggttttcga-----ttgcacttc
A0A3B4XZH1_BCL2L11      gtggatatttctccttcgacagcgactcgctaccgacctccccgctctcc
                           **    ***       ** ** *       *         *  ** *

A0A3B4W9T1_BAD-01       gaggggcagcgaccggtcgaacgaggctgaactcagagtcccacacttcc
A0A3B4WM88_BMF-01       ccg-------------------------------------gcacattttg
A0A3B4XZH1_BCL2L11      ccgaggccagccacggctgaacgaacc-----------acgcagaccccg
                          *                                      ** *     

A0A3B4W9T1_BAD-01       actgt------ctccag--agatgaggag-------ttccaggccagggg
A0A3B4WM88_BMF-01       agcttgttggggatcag-gaagcgaggcgacaag----gaagcgga----
A0A3B4XZH1_BCL2L11      agccc------caccagccaggtgatgaaacacgccttgcagcgcatggc
                        *             ***  *   ** *             **   *    

A0A3B4W9T1_BAD-01       ggaggaggaagccg-----gcacgcccaccgaaggagctccattcagggg
A0A3B4WM88_BMF-01       -gaggagcgaaacgggatggagcagctaccccggcagcagcctgtggcgc
A0A3B4XZH1_BCL2L11      ggaggcgcacggcggaggagcgaggatgcagcagcagcagcacggtgagc
                         **** *     **     *        *    * ***  *     * * 

A0A3B4W9T1_BAD-01       acgg----------tccaagtcagctccccctgcactgtgggcggcgaag
A0A3B4WM88_BMF-01       gcag----------tgtggag-------gcctgca---------------
A0A3B4XZH1_BCL2L11      acaggcactttgcatcagggg-------acatgca--------ggcggag
                         * *          *              * ****               

A0A3B4W9T1_BAD-01       aaatacggccagaagctcagaaggatgagcgatgaatttgacag------
A0A3B4WM88_BMF-01       ----ttggtcagaaactccagctgataggagaccagtttcaccgggaaca
A0A3B4XZH1_BCL2L11      gcagtcggacaagagctccgacgcatcggagacgactttaatagacttct
                              ** **  * ***      **  * **  * *** *  *      

A0A3B4W9T1_BAD-01       cctgcta------------gacaaaggggagatgaggaaggtgaagagcg
A0A3B4WM88_BMF-01       cctacaactgtatcatcaaaaccaaaggaac-cacgggccgctgtggtgg
A0A3B4XZH1_BCL2L11      cctgttaagggtcagtcatcacagatggtgtgtgtgtgtgtgtgtgtgtg
                        ***   *             **  * **       *         *   *

A0A3B4W9T1_BAD-01       ctgggacagccaaacagatgcaccactctaaaagctggtggagctacctc
A0A3B4WM88_BMF-01       c--gcctggccgcagctctgc-tcagccttc---tgtttgacagggggtt
A0A3B4XZH1_BCL2L11      t--gtgtgcgtgcgggtgtgtgtgtgcgtgcgggtgtgtgtgcgggtgtg
                           *              **        *         **        * 

A0A3B4W9T1_BAD-01       tttagtcaccaggagacagaaggagaaaacaaccaccatgaaaaccacac
A0A3B4WM88_BMF-01       aattgctg-gaggaggtggagcaggacgg---------------------
A0A3B4XZH1_BCL2L11      tgcgggtgtgtggtggtggagggggggta---------------------
                            *      ** *   **    *                         

A0A3B4W9T1_BAD-01       tcaccgcactgagtag
A0A3B4WM88_BMF-01       ----------aggtga
A0A3B4XZH1_BCL2L11      ----------gagtag
                                    **  

© 1998-2019