Dataset for CDS classical BH3-containing proteins of organism Seriola dumerili

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B4UNJ0_BMF-01       atggatgatgaggaggagga-------------------catgtcacagc
A0A3B4V919_BCL2L11      atgaaagcccaggctgacggtgccgctctattcatccaacagaccacaaa
A0A3B4U5H8_BMF-01       atggacgatgaggaggatgatgtgtt-------------tgagccagacc
A0A3B4VFC5_BAD-01       atggctg--------------------------------caaacttcacc
                        ***   *                                        *  

A0A3B4UNJ0_BMF-01       ccatctcgcacctctggggaacgtcctttagggacgtcaaatacgaagac
A0A3B4V919_BCL2L11      accggtccgatggctcgaccg---cagtaacggcaagaggggagagcgaa
A0A3B4U5H8_BMF-01       ccc--actgctggcgcacca----cattcagggagataaagtgtgaagac
A0A3B4VFC5_BAD-01       att--tcagacagtgagtcagagccatcggaggaggtagacgaaggagaa
                              *                 *      **              ** 

A0A3B4UNJ0_BMF-01       cgagccacaccgattgcag---ccggacaggcccttactgccgtcaccgc
A0A3B4V919_BCL2L11      ggggatccaccactcgtcggtgccg--ctggagc---c-----ccagcgc
A0A3B4U5H8_BMF-01       cggggcacacaaacacctggcccagccctggcac-tga-----acaacgg
A0A3B4VFC5_BAD-01       atgagccaatcactaactgggcaagagcaggagctttc-----tcaacgc
                                *         *     *  * **  *          ** ** 

A0A3B4UNJ0_BMF-01       tgctcctctcattctttttgtttggtgggttcctcattgggaactg----
A0A3B4V919_BCL2L11      aaaac---------------cccagt-------tcgaaagacagcggcga
A0A3B4U5H8_BMF-01       catgc-------------tgccctgtggagtcgcaaaggagcccagacca
A0A3B4VFC5_BAD-01       cacacc----------ctcaccttgcctgaactccgaggggcagcgaccg
                            *                   *                    *    

A0A3B4UNJ0_BMF-01       -----------------------tcccccagtacca----------aaat
A0A3B4V919_BCL2L11      ----------gcggagccttggccacctcggctccacc------------
A0A3B4U5H8_BMF-01       ctcttctacggc--aacgcaggtttt--cgattgcact---tcccggcac
A0A3B4VFC5_BAD-01       gtcgaacgaggctgaactcagagtcccacacttccactgtctccagagac
                                                    *     **              

A0A3B4UNJ0_BMF-01       gaatatgttaagattctcagagaatagg--------------------cc
A0A3B4V919_BCL2L11      ------------------ggagaaggagagcc----agactcgccgcccc
A0A3B4U5H8_BMF-01       ----attttgagcttgttggggatcaggaagcgaggcgacaaggaagcgg
A0A3B4VFC5_BAD-01       gaagagttccaggccaggggggaggaggaagc----cggcacgcccaccg
                                           * **    *                      

A0A3B4UNJ0_BMF-01       cgaggagc--------------------aggcagg---------------
A0A3B4V919_BCL2L11      ggtgcagaaccat---------------agccacctctcctgtcaacact
A0A3B4U5H8_BMF-01       agaggagc---------gaaacgggatggagcagctaccccggcagca--
A0A3B4VFC5_BAD-01       a-aggagctccattcaggggacggtccaagtcagctccccctgca-----
                           * **                        **                 

A0A3B4UNJ0_BMF-01       -------------ggtgagcgtcgaggcgcaaattggccgtaaacttcgg
A0A3B4V919_BCL2L11      tctctcgtcgctcgtccagtggatatttctccttcga-cagcgactc--g
A0A3B4U5H8_BMF-01       --gcctgtggcgcg--cagtgtggaggcctgcattggtcagaaactccag
A0A3B4VFC5_BAD-01       ----ctgtgg---g--cggccaagaaata-----cggccagaagctcaga
                                     *    *     *          *  *     **    

A0A3B4UNJ0_BMF-01       gagattggagacaag-ttccaacaggatcattt-----------------
A0A3B4V919_BCL2L11      ctaccgagctccccgctctccccgaggccagccacggttgaa----cgaa
A0A3B4U5H8_BMF-01       ctgataggagaccag-tttcaccgggaacacctacaactgtatcatcaaa
A0A3B4VFC5_BAD-01       aggatgagcgacgaa-tttgacag------cctg------------ctag
                               *   *    *                                 

A0A3B4UNJ0_BMF-01       -catgaggcaccagag------------acaaaacctgcctgcctggatg
A0A3B4V919_BCL2L11      ccacgcagaccccgagccccaccagccaggtgatgaaacacgccttgcag
A0A3B4U5H8_BMF-01       accaaaggaaccaggg------------gccgctg---------tggtgg
A0A3B4VFC5_BAD-01       acaaaggggagatgag------------gaaggtgaagagcg-ctgggac
                         *     *     * *                            * *   

A0A3B4UNJ0_BMF-01       cgccttacgatggccctgttt-------------ggctttctgtttccaa
A0A3B4V919_BCL2L11      cgcatggcggaggcgc--------acggcggaggagc-------------
A0A3B4U5H8_BMF-01       cgcctggccgtagctctgctc-------------agccttctgtttga--
A0A3B4VFC5_BAD-01       agccaaacagatgcaccactctaaaagctggtggagctacctctttagtc
                         **    *    ** *                   **             

A0A3B4UNJ0_BMF-01       gacaggctctcgtcccccgcctgag------------agga---------
A0A3B4V919_BCL2L11      --gaggat-------gcagcagcag--------cacggtgagctaaaacc
A0A3B4U5H8_BMF-01       --cagggggttaattgctggaggag------------gtgg---------
A0A3B4VFC5_BAD-01       accaggag-------acagaaggagaaaacaaccaccatga---------
                           ***          * *    **              *          

A0A3B4UNJ0_BMF-01       ---------------------------------gagcaga----------
A0A3B4V919_BCL2L11      tgcgcttctaaaacacactaagatgacttctcagtgctgccaaacccatt
A0A3B4U5H8_BMF-01       ---------a----------g----------caggacgga----------
A0A3B4VFC5_BAD-01       ---------aaaccacactca----------ccgcactga----------
                                                         *  * *           

A0A3B4UNJ0_BMF-01       ---gatga
A0A3B4V919_BCL2L11      tctgctga
A0A3B4U5H8_BMF-01       ---ggtga
A0A3B4VFC5_BAD-01       ---gtag-
                           *  * 

© 1998-2019