Dataset for CDS BMF of organism Seriola dumerili

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B4U5H8_BMF-01      atggacgatgaggaggatgatgtgtttgagccagacccccactgctggcg
A0A3B4UNJ0_BMF-01      atggatgatgaggaggaggacatgtcacagcccatctcgcacctctgggg
                       ***** *********** **  ***   ****   * * ***  **** *

A0A3B4U5H8_BMF-01      caccacattcagggagataaagtgtgaagaccggggcacacaaa---cac
A0A3B4UNJ0_BMF-01      aacgtcctttagggacgtcaaatacgaagaccgagccacaccgattgcag
                        **  * ** *****  * ** *  ******** * *****  *   ** 

A0A3B4U5H8_BMF-01      ctggcccagccctggcactgaacaacggcatgctgccctgtggagtcgca
A0A3B4UNJ0_BMF-01      ccggacaggccct-----------------tactgccgt---------ca
                       * ** *  *****                 * ***** *         **

A0A3B4U5H8_BMF-01      aaggagcccagaccactcttctacggcaacgcaggttttcgattg-----
A0A3B4UNJ0_BMF-01      ccgctgctcctctcattctttt--tgtttggtgggttcctcattgggaac
                         *  ** *    ** **** *   *    *  ****    ****     

A0A3B4U5H8_BMF-01      cacttcccggcac----------attttgagcttgttggggatcaggaag
A0A3B4UNJ0_BMF-01      tgtcccccagtaccaaaatgaatatgttaagattctcagagaatagg---
                            *** * **          ** ** ** ** *  * **  ***   

A0A3B4U5H8_BMF-01      cgaggcgacaaggaagcggagaggagcgaaacgggatggagcagctaccc
A0A3B4UNJ0_BMF-01      -----------------------------------------------ccc
                                                                      ***

A0A3B4U5H8_BMF-01      cggcagcagcctgtggcgcgcagtgtggaggcctgcattggtcagaaact
A0A3B4UNJ0_BMF-01      gaggagcaggcaggggtg---agcgtcgaggcgcaaattggccgtaaact
                         * ***** * * ** *   ** ** *****    ***** *  *****

A0A3B4U5H8_BMF-01      ccagctgataggagaccagtttcaccgggaacacctacaactgtatcatc
A0A3B4UNJ0_BMF-01      tcgggagattggagacaagttccaacaggatca----------tttcatg
                        * *  *** ****** **** ** * *** **          * **** 

A0A3B4U5H8_BMF-01      aaa-accaaaggaaccaggggccgctgtggtggcgcctggccgtagctct
A0A3B4UNJ0_BMF-01      aggcaccagagacaaaacctgcctgcctggatgcgccttacgatggccct
                       *   **** **  *  *   ***    ***  ******  *  * ** **

A0A3B4U5H8_BMF-01      gctcagccttctgttt----gacagggggttaattgctggaggaggtgga
A0A3B4UNJ0_BMF-01      gtttggctttctgtttccaagacaggctctcgtcccccgcctga----ga
                       * *  ** ********    ******   *      * *   **    **

A0A3B4U5H8_BMF-01      gcaggacggaggtga
A0A3B4UNJ0_BMF-01      ggagagcagagatga
                       * **  * *** ***

© 1998-2019