Dataset for CDS classical BH3-containing proteins of organism Scophthalmus maximus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2U9BAC9_BAD-01      atgg-cggcaaacttcacaatatcagacagtgagtcaga--------gcc
A0A2U9CJH3_BMF-01      atggacgatgaggaggatgatgt----ctttgagccagacccccactgct
                       **** **   *     *  ** *    *  **** ****        ** 

A0A2U9BAC9_BAD-01      atcggaggaggtggaggaaggagaagtgagccaaccgtggaccgggccag
A0A2U9CJH3_BMF-01      ggcgcaccacattcagggagataaagtg-------tgaagaccggggcac
                         ** *  *  *  *** **   *****        *  ******* ** 

A0A2U9BAC9_BAD-01      gggagcaggttcctccgcgccacaccctcgccct----------------
A0A2U9CJH3_BMF-01      acagaca-------cctggccctgccctggcactgaacaacggcatgctg
                            **       **  ***   **** ** **                

A0A2U9BAC9_BAD-01      ccct---gagctgc-gaatggcagcaaccggtcgaatccggctgaactcg
A0A2U9CJH3_BMF-01      ccctgtggagttgcagaggagcccagaccactcttctacggc--aacgcg
                       ****   *** *** **   **    ***  **   * ****  *** **

A0A2U9BAC9_BAD-01      gagtccaacgcttccactctctcacgagacgaggagctcct----gacca
A0A2U9CJH3_BMF-01      ggtttt--cgattgcact-tcccggcacactttgagctttttggggatca
                       *  *    ** ** **** ** *   * **   *****  *    ** **

A0A2U9BAC9_BAD-01      ggtgggacgaggaagccggtacgcccaccgacggagctccattccggggg
A0A2U9CJH3_BMF-01      ggaagtgaggggacacgagagcgaagaggagcgaagc---------ggga
                       **  *   * ***  *  *  **   *    ** ***         *** 

A0A2U9BAC9_BAD-01      aggtccaagt-------------cggctcctcctgcgctgtgggcggcca
A0A2U9CJH3_BMF-01      tggagcagctaccgcggcagcagcagcctgtggcgcacagcgtggaggcc
                        **  **  *             * **   *   ** * * * *  * * 

A0A2U9BAC9_BAD-01      tgaaatacggccagaagctccggcggatgagtgacgagtttgacag----
A0A2U9CJH3_BMF-01      tgcatt--ggccagaaactccagctgataggagaccagtttcaccgggaa
                       ** * *  ******** **** ** ***  * *** ***** ** *    

A0A2U9BAC9_BAD-01      --------------------------------------------------
A0A2U9CJH3_BMF-01      cacctacaactgtatcatcgaaaccaaaggaaccaggggccgctgtggtg
                                                                         

A0A2U9BAC9_BAD-01      ---------------------------cctgctagacaaaggg----gag
A0A2U9CJH3_BMF-01      gcgcctggccgcagctctgctcagccttctgtttgacagggggttccttg
                                                   *** * ****  ***      *

A0A2U9BAC9_BAD-01      atgaggaaggtgaagagcgccgggacggccagacagatgcaccactctca
A0A2U9CJH3_BMF-01      ctggaggaggtggag-----cgggacgg--aggcaggcgcaca-----ca
                        **  * ***** **     ********  ** ***  ****      **

A0A2U9BAC9_BAD-01      aagctggtggagctacctctttagtc-----accagg--agatggaagga
A0A2U9CJH3_BMF-01      aaacgcagggcgaaagcctccgggccgcagaaccgggccagttcagtgga
                       ** *    ** *  * *      * *     *** **  ** *    ***

A0A2U9BAC9_BAD-01      gaaaacaaccaccacgagaacca------------cact-----------
A0A2U9CJH3_BMF-01      gaggacggtccaggcgatgaccaaccagttcacctcactgccgcctcagc
                       **  **   *    ***  ****            ****           

A0A2U9BAC9_BAD-01      -------------------------------caacgcaacgagtag----
A0A2U9CJH3_BMF-01      agctgccacctccagccaacggtcggcttccctgcgcgctgattggctaa
                                                      *  ***   ** * *    

© 1998-2019