Dataset for CDS BAD of organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G3VRY4_BAD-02      atgttccagatatccgagtttgagcccagtgagcccggagaagacccttctgcctccact
G3VRY4_BAD-01      atgttccagatatccgagtttgagcccagtgagcccggagaagacccttctgcctccact

G3VRY4_BAD-02      gcccccagcctcgccccgctcaggccaggaccccgagcagcacctggagcccaccaccat
G3VRY4_BAD-01      gcccccagcctcgccccgctcaggccaggaccccgagcagcacctggagcccaccaccat

G3VRY4_BAD-02      gagaaggggggagcccagaagtcccagacccatgtctcaaaagagctcaaagcctctgct
G3VRY4_BAD-01      gagggcgccggcgcggggaggcctc--------gcct-----gatctcctaccccccgct
                   ***   *  ** **   ** * * *        * **     ** ***  * ** * ***

G3VRY4_BAD-02      agtcaagggagattaggaaaaggcagtttcgagggtagggagggctcccgggaggcgagc
G3VRY4_BAD-01      a-----------------------------------agggagggctcccgggaggcgagc
                   *                                   ************************

G3VRY4_BAD-02      cccgaagcggaggccgaggcagagcagtccgagggggaggaagagcgcggcctcttccgg
G3VRY4_BAD-01      cccgaagcggaggccgaggcagagcagtccgagggggaggaagagcgcggcctcttccgg

G3VRY4_BAD-02      ggccgctccagctcagcgccccctatcctctgggcggcgcggcattatggcagcgagctg
G3VRY4_BAD-01      ggccgctccagctcagcgccccctatcctctgggcggcgcggcattatggcagcgagctg

G3VRY4_BAD-02      cgcaggatgagcgacgagttccactgcaccttcaagggacttccccgcccgaagagcgca
G3VRY4_BAD-01      cgcaggatgagcgacgagttccactgcaccttcaagggacttccccgcccgaagagcgca

G3VRY4_BAD-02      ggcactgcgagccagatgcgtcggagccatggctggacccgcaccttccagtcttggttc
G3VRY4_BAD-01      ggcactgcgagccagatgcgtcggagccatggctggacccgcaccttccagtcttggttc

G3VRY4_BAD-02      gggcggaatttggggaaagggagcgtcggtccttcccactga
G3VRY4_BAD-01      gggcggaatttggggaaagggagcgtcggtccttcccactga

© 1998-2019