Dataset for CDS BAD of organism Salmo salar

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

B5X1T1_BAD-01      atggaccacacacatgattgtgtggatgacaacccagaaaccatgaatgaacatgatgag
B5XEF1_BAD-01      atggactacacacatgattgtgtggatga-----------------------atg-tgag
                   ****** **********************                       *** ****

B5X1T1_BAD-01      tctgaccactcaggaaccacacactacccagaatttcagcgccattatgtctccactagg
B5XEF1_BAD-01      tctgatcactcaggaaccacacgcaactcagaattccagctcc---atgtctcaactaca
                   ***** **************** * ** ******* **** **   ******* ****  

B5X1T1_BAD-01      acgggcatcagaccacgaccaggtgggcgagtgcggctctactccgagtcccaggtgtgc
B5XEF1_BAD-01      atgagcaacagaccaagaccaggtgagcgagtccggctctactcagagtcccaggtgcgc
                   * * *** ******* ********* ****** *********** ************ **

B5X1T1_BAD-01      tcccaggttggcagaagggacaacacagagtttcaggatgtgatgactcctactgaggag
B5XEF1_BAD-01      tcccaggttggcaaaagggaagacacagagtttcaggatgtgatgactcctactgaggag
                   ************* ******  **************************************

B5X1T1_BAD-01      ggcggtggcgatggggctcctttccgaagccgatcacagtctgctcctcctacactgtgg
B5XEF1_BAD-01      ggtgggggtgatggggcttcattccgaggtcgatcacagtctgctcctcctgcactatgg
                   ** ** ** ********* * ****** * ********************* **** ***

B5X1T1_BAD-01      gctgcaaagaaatatggccgccagctgaggaggatgagtgatgaatttgacacctggctc
B5XEF1_BAD-01      gctgcaaagaaatatggctgccagctgaggaggatgagtgatgaatttgacacctggctc
                   ****************** *****************************************

B5X1T1_BAD-01      gacaaaggggaacccaagagagggataagcccaggaggggtcaagcaggaggtctcccga
B5XEF1_BAD-01      gacaaaggggtgcccaagagagggattatcccaagaggaggcaagcagaaagtctcccga
                   **********  ************** * **** **** * ******* * *********

B5X1T1_BAD-01      ggatggttctctttcctctggagtccaaaaaaggctgaaggcagggagtga
B5XEF1_BAD-01      ggatggttctctttcctctggagtccaaaggaggcggaaggcagggagtga
                   *****************************  **** ***************

© 1998-2018