Dataset for CDS classical BH3-containing proteins of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

19 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6TBD7_BIK-01       atgtctgaagacagacccctctccagcgacatcttgatggagactct---
A0A2K6S6C4_PMAIP1-      at------------------------------------------------
A0A2K6STD6_BBC3-02      atgaa-----------------atgt---------------ggcatgggg
A0A2K6TG62_BAD-02       atgtt-----------------ccag---------------atcccagag
A0A2K6TG62_BAD-01       atgtt-----------------ccag---------------atcccagag
A0A2K6TG62_BAD-03       atgtt-----------------ccag---------------atcccagag
A0A2K6TW86_BMF-02       atgg--------------------agccatc-------------tcagtg
A0A2K6TW86_BMF-01       atgg--------------------agccatc-------------tcagtg
A0A2K6TW86_BMF-03       atgg--------------------agccatc-------------tcagtg
A0A2K6TRZ5_BCL2L11      atggc-----------------aaagcaaccttccgatgtaagttctgag
A0A2K6TRZ5_BCL2L11      atggc-----------------aaagcaaccttccgatgtaagttctgag
A0A2K6TRZ5_BCL2L11      atggc-----------------aaagcaaccttccgatgtaagttctgag
A0A2K6TRZ5_BCL2L11      atggc-----------------aaagcaaccttccgatgtaagttctgag
A0A2K6TRZ5_BCL2L11      atggc-----------------aaagcaaccttccgatgtaagttctgag
A0A2K6TRZ5_BCL2L11      atggc-----------------aaagcaaccttccgatgtaagttctgag
A0A2K6TRZ5_BCL2L11      atggc-----------------aaagcaaccttccgatgtaagttctgag
A0A2K6TRZ5_BCL2L11      atggc-----------------aaagcaaccttccgatgtaagttctgag
A0A2K6TRZ5_BCL2L11      atggc-----------------aaagcaaccttccgatgtaagttctgag
A0A2K6TRZ5_BCL2L11      atggc-----------------aaagcaaccttccgatgtaagttctgag
                        **                                                

A0A2K6TBD7_BIK-01       -------------------cctgtgtgagcagtttgtggatcccctgacc
A0A2K6S6C4_PMAIP1-      -------------------gcctgggaagaaggcg-------------cg
A0A2K6STD6_BBC3-02      tctgcctgggcatgtccatgccaagtgcccag---g---gcttcttcctt
A0A2K6TG62_BAD-02       tttga--------------gccgagtgagcaggaag---actccagctct
A0A2K6TG62_BAD-01       tttga--------------gccgagtgagcaggaag---actccagctct
A0A2K6TG62_BAD-03       tttga--------------gccgagtgagcaggaag---actccagctct
A0A2K6TW86_BMF-02       tgtg---------------gaggagctggaggatgatgtgttccagc-ca
A0A2K6TW86_BMF-01       tgtg---------------gaggagctggaggatgatgtgttccagc-ca
A0A2K6TW86_BMF-03       tgtg---------------gaggagctggaggatgatgtgttccagc-ca
A0A2K6TRZ5_BCL2L11      tgtg---------------accgagaaggtagaca----gttgcagc-ct
A0A2K6TRZ5_BCL2L11      tgtg---------------accgagaaggtagaca----gttgcagc-ct
A0A2K6TRZ5_BCL2L11      tgtg---------------accgagaaggtagaca----gttgcagc-ct
A0A2K6TRZ5_BCL2L11      tgtg---------------accgagaaggtagaca----gttgcagc-ct
A0A2K6TRZ5_BCL2L11      tgtg---------------accgagaaggtagaca----gttgcagc-ct
A0A2K6TRZ5_BCL2L11      tgtg---------------accgagaaggtagaca----gttgcagc-ct
A0A2K6TRZ5_BCL2L11      tgtg---------------accgagaaggtagaca----gttgcagc-ct
A0A2K6TRZ5_BCL2L11      tgtg---------------accgagaaggtagaca----gttgcagc-ct
A0A2K6TRZ5_BCL2L11      tgtg---------------accgagaaggtagaca----gttgcagc-ct
A0A2K6TRZ5_BCL2L11      tgtg---------------accgagaaggtagaca----gttgcagc-ct
                                                *      *                  

A0A2K6TBD7_BIK-01       atggaggttgtcggtgggagtgaccctgaag-------------------
A0A2K6S6C4_PMAIP1-      caagagcgcgcaaccgagccccg---cgcgggctccag------------
A0A2K6STD6_BBC3-02      gacgtgggtcccctgc----cagatgtgtggttctcagccctcgctctcg
A0A2K6TG62_BAD-02       gcagagag---------------------gggcctgagccc---------
A0A2K6TG62_BAD-01       gcagagag---------------------gggcctgagccc---------
A0A2K6TG62_BAD-03       gcagagag---------------------gggcctgagccc---------
A0A2K6TW86_BMF-02       gaggatggggagccagggacccaacccggga--gcttgctctctgctgac
A0A2K6TW86_BMF-01       gaggatggggagccagggacccaacccggga--gcttgctctctgctgac
A0A2K6TW86_BMF-03       gaggatggggagccagggacccaacccggga--gcttgctctctgctgac
A0A2K6TRZ5_BCL2L11      gcggagagacctccccagctcagacctggggcccctacctccctacaga-
A0A2K6TRZ5_BCL2L11      gcggagagacctccccagctcagacctggggcccctacctccctacaga-
A0A2K6TRZ5_BCL2L11      gcggagagacctccccagctcagacctggggcccctacctccctacaga-
A0A2K6TRZ5_BCL2L11      gcggagagacctccccagctcagacctggggcccctacctccctacaga-
A0A2K6TRZ5_BCL2L11      gcggagagacctccccagctcagacctggggcccctacctccctacaga-
A0A2K6TRZ5_BCL2L11      gcggagagacctccccagctcagacctggggcccctacctccctacaga-
A0A2K6TRZ5_BCL2L11      gcggagagacctccccagctcagacctggggcccctacctccctacaga-
A0A2K6TRZ5_BCL2L11      gcggagagacctccccagctcagacctggggcccctacctccctacaga-
A0A2K6TRZ5_BCL2L11      gcggagagacctccccagctcagacctggggcccctacctccctacaga-
A0A2K6TRZ5_BCL2L11      gcggagagacctccccagctcagacctggggcccctacctccctacaga-
                           *                                              

A0A2K6TBD7_BIK-01       ----------aggacccggact----------------------------
A0A2K6S6C4_PMAIP1-      ---------cagaccttgaagt----------------------------
A0A2K6STD6_BBC3-02      ctggcggagcagcacctggagt----------------------------
A0A2K6TG62_BAD-02       ---------cagcaccg---------------------------------
A0A2K6TG62_BAD-01       ---------cagcaccg---------------------------------
A0A2K6TG62_BAD-03       ---------cagcaccg---------------------------------
A0A2K6TW86_BMF-02       ctgtttgcccagagcc----------------------------------
A0A2K6TW86_BMF-01       ctgtttgcccagagcc----------------------------------
A0A2K6TW86_BMF-03       ctgtttgcccagagcc----------------------------------
A0A2K6TRZ5_BCL2L11      ---------cagagccaca-------------------------------
A0A2K6TRZ5_BCL2L11      ---------cagagccaca-------------------------------
A0A2K6TRZ5_BCL2L11      ---------cagagccacaaggtaatcccgaaggcaatcacggaggtgaa
A0A2K6TRZ5_BCL2L11      ---------cagagccacaaggtaatcccgaaggcaatcacggaggtgaa
A0A2K6TRZ5_BCL2L11      ---------cagagccacaaggtaatcccgaaggcaatcacggaggtgaa
A0A2K6TRZ5_BCL2L11      ---------cagagccacaaggtaatcccgaaggcaatcacggaggtgaa
A0A2K6TRZ5_BCL2L11      ---------cagagccacaaggtaatcccgaaggcaatcacggaggtgaa
A0A2K6TRZ5_BCL2L11      ---------cagagccaca-------------------------------
A0A2K6TRZ5_BCL2L11      ---------cagagccacaaggtaatcccgaaggcaatcacggaggtgaa
A0A2K6TRZ5_BCL2L11      ---------cagagccacaaggtaatcccgaaggcaatcacggaggtgaa
                                  **  *                                   

A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A2K6TW86_BMF-02       ------------------------------tactggactgccccctcagc
A0A2K6TW86_BMF-01       ------------------------------tactggactgccccctcagc
A0A2K6TW86_BMF-03       ------------------------------tactggactgccccctcagc
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ggggacagctgcccccacggcagccctcagggcccgctggccccaccggc
A0A2K6TRZ5_BCL2L11      ggggacagctgcccccacggcagccctcagggcccgctggccccaccggc
A0A2K6TRZ5_BCL2L11      ggggacagctgcccccacggcagccctcagggcccgctggccccaccggc
A0A2K6TRZ5_BCL2L11      ggggacagctgcccccacggcagccctcagggcccgctggccccaccggc
A0A2K6TRZ5_BCL2L11      ggggacagctgcccccacggcagccctcagggcccgctggccccaccggc
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ggggacagctgcccccacggcagccctcagggcccgctggccccaccggc
A0A2K6TRZ5_BCL2L11      ggggacagctgcccccacggcagccctcagggcccgctggccccaccggc
                                                                          

A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A2K6TW86_BMF-02       cggcttcagctcttcc----------------------------------
A0A2K6TW86_BMF-01       cggcttcagctcttcc----------------------------------
A0A2K6TW86_BMF-03       cggcttcagctcttcc----------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      cagccctggcccttttgctaccagatccccgcttttcatctttgtgagaa
A0A2K6TRZ5_BCL2L11      cagccctggcccttttgctaccagatccccgcttttcatctttgtgagaa
A0A2K6TRZ5_BCL2L11      cagccctggcccttttgctaccagatccccgcttttcatctttgtgagaa
A0A2K6TRZ5_BCL2L11      cagccctggcccttttgctaccagatccccgcttttcatctttgtgagaa
A0A2K6TRZ5_BCL2L11      cagccctggcccttttgctaccagatccccgcttttcatctttgtgagaa
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      cagccctggcccttttgctaccagatccccgcttttcatctttgtgagaa
A0A2K6TRZ5_BCL2L11      cagccctggcccttttgctaccagatccccgcttttcatctttgtgagaa
                                                                          

A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K6S6C4_PMAIP1-      -------------------------------------------------c
A0A2K6STD6_BBC3-02      -------------------------------------------------c
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A2K6TW86_BMF-02       -ctctcacccactgctgtggccct-------------------------g
A0A2K6TW86_BMF-01       -ctctcacccactgctgtggccct-------------------------g
A0A2K6TW86_BMF-03       -ctctcacccactgctgtggccct-------------------------g
A0A2K6TRZ5_BCL2L11      -------------------------------------------------a
A0A2K6TRZ5_BCL2L11      -------------------------------------------------a
A0A2K6TRZ5_BCL2L11      gatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacaca
A0A2K6TRZ5_BCL2L11      gatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacaca
A0A2K6TRZ5_BCL2L11      gatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacaca
A0A2K6TRZ5_BCL2L11      gatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacaca
A0A2K6TRZ5_BCL2L11      gatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacaca
A0A2K6TRZ5_BCL2L11      -------------------------------------------------a
A0A2K6TRZ5_BCL2L11      gatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacaca
A0A2K6TRZ5_BCL2L11      gatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacaca
                                                                          

A0A2K6TBD7_BIK-01       --ctgtggaggaccctttggaatgcatggagaacagtgacgcact--ggc
A0A2K6S6C4_PMAIP1-      gagtgtgccattcaactcaggagatttggaga---------------caa
A0A2K6STD6_BBC3-02      gcccgtgcccagcgccccgggggccctggcgggcggtcccacccaggcgg
A0A2K6TG62_BAD-02       --caggggacagcccccc--aggctctggcaagcatcgacgcc----agg
A0A2K6TG62_BAD-01       --caggggacagcccccc--aggctctggcaagcatcgacgcc----agg
A0A2K6TG62_BAD-03       --caggggacagcccccc--aggctctggcaagcatcgacgcc----agg
A0A2K6TW86_BMF-02       gccttcgacccaccagccaggaa----gacaa--ggctaccc-----aga
A0A2K6TW86_BMF-01       gccttcgacccaccagccaggaa----gacaa--ggctaccc-----aga
A0A2K6TW86_BMF-03       gccttcgacccaccagccaggaa----gacaa--ggctaccc-----aga
A0A2K6TRZ5_BCL2L11      gacaggagcccagcacccatgagttgtgacaa--atcaacac-----aaa
A0A2K6TRZ5_BCL2L11      gacaggagcccagcacccatgagttgtgacaa--atcaacac-----aaa
A0A2K6TRZ5_BCL2L11      gacaggagcccagcacccatgagttgtgacaa--atcaacac-----aaa
A0A2K6TRZ5_BCL2L11      gacaggagcccagcacccatgagttgtgacaa--atcaacac-----aaa
A0A2K6TRZ5_BCL2L11      gacaggagcccagcacccatgagttgtgacaa--atcaacac-----aaa
A0A2K6TRZ5_BCL2L11      gacaggagcccagcacccatgagttgtgacaa--atcaacac-----aaa
A0A2K6TRZ5_BCL2L11      gacaggagcccagcacccatgagttgtgacaa--atcaacac-----aaa
A0A2K6TRZ5_BCL2L11      gacaggagcccagcacccatgagttgtgacaa--atcaacac-----aaa
A0A2K6TRZ5_BCL2L11      gacaggagcccagcacccatgagttgtgacaa--atcaacac-----aaa
A0A2K6TRZ5_BCL2L11      gacaggagcccagcacccatgagttgtgacaa--atcaacac-----aaa
                                                   *                      

A0A2K6TBD7_BIK-01       cctgcagctggcctgcatcgcggaccagatggatgtgagcctcagggccc
A0A2K6S6C4_PMAIP1-      actgaa---------tttccggcaga-----------aacttctgaatct
A0A2K6STD6_BBC3-02      ccccgggag------tccgcggggaggaggagcagtgggctcgggagatc
A0A2K6TG62_BAD-02       ccccaggcc------tcccgggggacgc----cagtcaccagcagggaca
A0A2K6TG62_BAD-01       ccccaggcc------tcccgggggacgc----cagtcaccagcagggaca
A0A2K6TG62_BAD-03       ccccaggcc------tcccgggggacgc----cagtcaccagcagggaca
A0A2K6TW86_BMF-02       ccctcagcccagcctcccccagccaaggtgtcatgctgccttgtggggtg
A0A2K6TW86_BMF-01       ccctcagcccagcctcccccagccaaggtgtcatgctgccttgtggggtg
A0A2K6TW86_BMF-03       ccctcagcccagcctcccccagccaaggtgtcatgctgccttgtggggtg
A0A2K6TRZ5_BCL2L11      ccccaagtc------ctccttgccag-----------gcctt--------
A0A2K6TRZ5_BCL2L11      ccccaagtc------ctccttgccag-----------gcctt--------
A0A2K6TRZ5_BCL2L11      ccccaagtc------ctccttgccag-----------gcctt--------
A0A2K6TRZ5_BCL2L11      ccccaagtc------ctccttgccag-----------gcctt--------
A0A2K6TRZ5_BCL2L11      ccccaagtc------ctccttgccag-----------gcctt--------
A0A2K6TRZ5_BCL2L11      ccccaagtc------ctccttgccag-----------gcctt--------
A0A2K6TRZ5_BCL2L11      ccccaagtc------ctccttgccag-----------gcctt--------
A0A2K6TRZ5_BCL2L11      ccccaagtc------ctccttgccag-----------gcctt--------
A0A2K6TRZ5_BCL2L11      ccccaagtc------ctccttgccag-----------gcctt--------
A0A2K6TRZ5_BCL2L11      ccccaagtc------ctccttgccag-----------gcctt--------
                         *                   *                 *          

A0A2K6TBD7_BIK-01       ggaggctggcc-cagct-ctacgaggtggccacgtacagcccgggtctcg
A0A2K6S6C4_PMAIP1-      gatatccaaactcttctgctc-----------------------------
A0A2K6STD6_BBC3-02      ggggcccagctgcggcggatggc----------ggacgacctc-------
A0A2K6TG62_BAD-02       gccaaccagcagcagccaccatg----------gagggacttcctcgcc-
A0A2K6TG62_BAD-01       gccaaccagcagcagccacca-----------------------------
A0A2K6TG62_BAD-03       gccaaccagcagcagccaccatg----------gagagaatcccagtgca
A0A2K6TW86_BMF-02       actgaggaaccccagcgactcttttatggcaatgctggctaccggcttcc
A0A2K6TW86_BMF-01       actgaggaaccccagcgactcttttatggcaatgctggctaccggcttcc
A0A2K6TW86_BMF-03       actgaggaaccccagcgactcttttatg----------------------
A0A2K6TRZ5_BCL2L11      ------------caaccactatctcagtgcaatggtagtcatccg-----
A0A2K6TRZ5_BCL2L11      ------------caaccactatctcagtgcaatgg-----atgag-----
A0A2K6TRZ5_BCL2L11      ------------caaccactatctcagtgcaatggtt-------------
A0A2K6TRZ5_BCL2L11      ------------caaccactatctcagtgcaatggc--------------
A0A2K6TRZ5_BCL2L11      ------------caaccactatctcagtgcaatggcttccatgag-----
A0A2K6TRZ5_BCL2L11      ------------caaccactatctcagtgcaatggcttccatgag-----
A0A2K6TRZ5_BCL2L11      ------------caaccactatctcagtgcaat-----------------
A0A2K6TRZ5_BCL2L11      ------------caaccactatctcagtgcaatggcttccatgag-----
A0A2K6TRZ5_BCL2L11      ------------caaccactatctcagtgcaatggcttccatgag-----
A0A2K6TRZ5_BCL2L11      ------------caaccactatctcagtgcaatggcttccatgag-----
                                    *  *                                  

A0A2K6TBD7_BIK-01       ctttcatccttgaccggaccgacatcagggatgttcttagcggtgtcgtg
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-01       --------------------------------------------------
A0A2K6TG62_BAD-03       aagatgctctcgaaagcatcagcagggatgtctgccccagccactgactc
A0A2K6TW86_BMF-02       tctccctgccagtttcccggcagtcttgccccttggggagcagccccctg
A0A2K6TW86_BMF-01       tctccctgccagtttcccggcagtcttgccccttggggagcagccccctg
A0A2K6TW86_BMF-03       --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ---------------------------------------aatggatatag
A0A2K6TRZ5_BCL2L11      ---------------------------------------gccactggatc
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ---------------------------------------gcaatctcagg
A0A2K6TRZ5_BCL2L11      ---------------------------------------gcaatctcagg
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ---------------------------------------gcaatctcagg
A0A2K6TRZ5_BCL2L11      ---------------------------------------gcaatctcagg
A0A2K6TRZ5_BCL2L11      ---------------------------------------gcaatctcagg
                                                                          

A0A2K6TBD7_BIK-01       gatgttttcgctgacttccaggaggacatagtgaggctctggagatccct
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------aacgcgcagtac------
A0A2K6TG62_BAD-02       -----------------------------cgaagagcgcgggca------
A0A2K6TG62_BAD-01       -----------------------------tggag-gcgctgg--------
A0A2K6TG62_BAD-03       agaagcccaacacacagagaatgtaaagctggag-gcgctgg--------
A0A2K6TW86_BMF-02       aagggcagtggcaacatcgagcagaggtacagattgcccgaaag------
A0A2K6TW86_BMF-01       aagggcagtggcaacatcgagcagaggtacagattgcccgaaag------
A0A2K6TW86_BMF-03       --------------------------------------------------
A0A2K6TRZ5_BCL2L11      gtgatatttcattgtggtttaggtttatatttaccttctttgat------
A0A2K6TRZ5_BCL2L11      ct----cccttgcccttcgtagggaggttcagtgcccacttgag------
A0A2K6TRZ5_BCL2L11      ----------------------agagaaataga------ggaag------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ctgaacctgcaggtatgcgcccggagatatggatcgcccaagag------
A0A2K6TRZ5_BCL2L11      ctgaacctgcaggtatgcgcccggagatatggatcgcccaagag------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ctgaacctgcaggtatgcgcccggagatatggatcgcccaagag------
A0A2K6TRZ5_BCL2L11      ctgaacctgcaggtatgcgcccggagatatggatcgcccaagag------
A0A2K6TRZ5_BCL2L11      ctgaacctgcaggtatgcgcccggagatatggatcgcccaagag------
                                                                          

A0A2K6TBD7_BIK-01       gagctctgggtcctgggtgtccggcaaacaggccgtgctgctggcgctcc
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6STD6_BBC3-02      -------gagcggcggagacaagaagagcagccgcaaca----ccgcccc
A0A2K6TG62_BAD-02       -------cagcaacgcagatgcg--gcaaagctccagctggacgcgagtc
A0A2K6TG62_BAD-01       --------agccgtggagacacg--gagtcgccacagct-----cgtacc
A0A2K6TG62_BAD-03       --------agccgtggagacacg--gagtcgccacagct-----cgtacc
A0A2K6TW86_BMF-02       -------cttcagtgcattgcagaccagttccaccggct----tcatgtg
A0A2K6TW86_BMF-01       -------cttcagtgcattgcagaccagttccaccggct----tcatgtg
A0A2K6TW86_BMF-03       --------------------------------------------------
A0A2K6TRZ5_BCL2L11      -------ttgtatggc----------------------------------
A0A2K6TRZ5_BCL2L11      -------tggt---------------------------------------
A0A2K6TRZ5_BCL2L11      -------ttgtcgtg-----------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      -------ttgcggcg-----------------------------------
A0A2K6TRZ5_BCL2L11      -------ttgcggcg-----------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      -------ttgcggcg-----------------------------------
A0A2K6TRZ5_BCL2L11      -------ttgcggcg-----------------------------------
A0A2K6TRZ5_BCL2L11      -------ttgcggcg-----------------------------------
                                                                          

A0A2K6TBD7_BIK-01       tggcgctgctgctgg----------cgatgttcagcgggggtctgcgcct
A0A2K6S6C4_PMAIP1-      ------------aggaacctga----------------------------
A0A2K6STD6_BBC3-02      tcac---cctggagggtcctgtacaatctcatcatgggactcctgccctt
A0A2K6TG62_BAD-02       atccagtcctggtgggatcggaacttgggcaggggaggctccgctccctc
A0A2K6TG62_BAD-01       ccgcagggacggagggggacgaa--gggatggaggaggagcccagccctt
A0A2K6TG62_BAD-03       ccgcagggacggagggggacgaa--gggatggaggaggagcccagccctt
A0A2K6TW86_BMF-02       cagcaacaccagcagaaccgaaatcgtgtgtggtggcaggtcctcctctt
A0A2K6TW86_BMF-01       cagcaacaccagcagaaccgaaatcgtgtgtggtggcaggtcctcctctt
A0A2K6TW86_BMF-03       ------caccagcagaaccgaaatcgtgtgtggtggcaggtcctcctctt
A0A2K6TRZ5_BCL2L11      ------taccaccacagtcaa------------------ggtacagaaca
A0A2K6TRZ5_BCL2L11      ---------tagcaaaatcaa------------------gctga------
A0A2K6TRZ5_BCL2L11      ---------tag--------------------------------------
A0A2K6TRZ5_BCL2L11      ---------tgactgggacta------------------g----------
A0A2K6TRZ5_BCL2L11      ---------tatcggagacga------------------gtttaacgctt
A0A2K6TRZ5_BCL2L11      ---------tatcggagacga------------------gtttaacgctt
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ---------tatcggagacga------------------gtttaacgctt
A0A2K6TRZ5_BCL2L11      ---------tatcggagacga------------------gtttaacgctt
A0A2K6TRZ5_BCL2L11      ---------tatcggagacga------------------gtttaacgctt
                                                                          

A0A2K6TBD7_BIK-01       gc------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6STD6_BBC3-02      tc-----------------------------------------------c
A0A2K6TG62_BAD-02       ccagtgacctt---cgctccacatcccgaaactctacccgctcccatcgc
A0A2K6TG62_BAD-01       ttcggggccgttcgcgctcggcaccccccaac-----------------c
A0A2K6TG62_BAD-03       ttcggggccgttcgcgctcggcaccccccaac-----------------c
A0A2K6TW86_BMF-02       cc------------------------------------------------
A0A2K6TW86_BMF-01       cc------------------------------------------------
A0A2K6TW86_BMF-03       cc------------------------------------------------
A0A2K6TRZ5_BCL2L11      ac------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      at------------------------------------------------
A0A2K6TRZ5_BCL2L11      at------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      at------------------------------------------------
A0A2K6TRZ5_BCL2L11      at------------------------------------------------
A0A2K6TRZ5_BCL2L11      at------------------------------------------------
                                                                          

A0A2K6TBD7_BIK-01       -------tgctcaagtga--------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6STD6_BBC3-02      caggggccacagagc----------cccagagat-----------ggagc
A0A2K6TG62_BAD-02       cctgggcggc-catcttggacatgggcggaagtgcttcctgcagggaggg
A0A2K6TG62_BAD-01       tctgggcagcacagc---gatatggccgcgagctcc---------ggagg
A0A2K6TG62_BAD-03       tctgggcagcacagc---gatatggccgcgagctcc---------ggagg
A0A2K6TW86_BMF-02       -------tgcacaacctggctttgaatggagaagaaaacaggaatggggc
A0A2K6TW86_BMF-01       -------tgcacaacctggctttgaatggagaagaaaacaggaatggggc
A0A2K6TW86_BMF-03       -------tgcacaacctggctttgaatggagaagaaaacaggaatggggc
A0A2K6TRZ5_BCL2L11      -------tccaccacaagtatgtctcatga--------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      -------tatccaaggaggatatctct-----------------------
A0A2K6TRZ5_BCL2L11      -------tatccaaggaggtta-----gagaaatag--------------
A0A2K6TRZ5_BCL2L11      -----------------gggtatttttgaataa-----------------
A0A2K6TRZ5_BCL2L11      -------tatccaaggagggtatttttgaataattaccaagcagccgaag
A0A2K6TRZ5_BCL2L11      -------tatccaaggagggtatttttgaataattaccaagcagccgaag
A0A2K6TRZ5_BCL2L11      -------tatccaaggagggtatttttgaataattaccaagcagccgaag
                                                                          

A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6STD6_BBC3-02      ccaa----------------------------------------------
A0A2K6TG62_BAD-02       ctga----------cccagattcccttccggtgcgt--------------
A0A2K6TG62_BAD-01       atgagtgacgagtttgtggactccttcaagggacttcctcgcccgaagag
A0A2K6TG62_BAD-03       atga----------------------------------------------
A0A2K6TW86_BMF-02       aggtccgaggtga-------------------------------------
A0A2K6TW86_BMF-01       aggtccgaggtga-------------------------------------
A0A2K6TW86_BMF-03       aggtccgag-----------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      ------------------------------------------tccacctg
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      accacccgcacatggttatcttacgactgttacgttacattgtccgcctg
A0A2K6TRZ5_BCL2L11      accacccgcacatggttatcttacgactgttacgttacattgtccgcctg
A0A2K6TRZ5_BCL2L11      accacccgcacatggttatcttacgactgttacgttacattgtccgcctg
                                                                          

A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-01       cgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtca
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      -------------attga--------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      gtgtggagaatgcattga--------------------------------
A0A2K6TRZ5_BCL2L11      gtgtggagaatgcattga--------------------------------
A0A2K6TRZ5_BCL2L11      gtgtggagaatgcattga--------------------------------
                                                                          

A0A2K6TBD7_BIK-01       --------------------------------------------------
A0A2K6S6C4_PMAIP1-      --------------------------------------------------
A0A2K6STD6_BBC3-02      --------------------------------------------------
A0A2K6TG62_BAD-02       --------------------------------------------------
A0A2K6TG62_BAD-01       tccagtcctggtgggatcggaacttgggcaggggaggctccgctccctcc
A0A2K6TG62_BAD-03       --------------------------------------------------
A0A2K6TW86_BMF-02       --------------------------------------------------
A0A2K6TW86_BMF-01       --------------------------------------------------
A0A2K6TW86_BMF-03       --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
A0A2K6TRZ5_BCL2L11      --------------------------------------------------
                                                                          

A0A2K6TBD7_BIK-01       ------
A0A2K6S6C4_PMAIP1-      ------
A0A2K6STD6_BBC3-02      --ttag
A0A2K6TG62_BAD-02       --gtga
A0A2K6TG62_BAD-01       cagtga
A0A2K6TG62_BAD-03       ------
A0A2K6TW86_BMF-02       ------
A0A2K6TW86_BMF-01       ------
A0A2K6TW86_BMF-03       ------
A0A2K6TRZ5_BCL2L11      ------
A0A2K6TRZ5_BCL2L11      ------
A0A2K6TRZ5_BCL2L11      ------
A0A2K6TRZ5_BCL2L11      ------
A0A2K6TRZ5_BCL2L11      ------
A0A2K6TRZ5_BCL2L11      ------
A0A2K6TRZ5_BCL2L11      ------
A0A2K6TRZ5_BCL2L11      ------
A0A2K6TRZ5_BCL2L11      ------
A0A2K6TRZ5_BCL2L11      ------
                              

© 1998-2019