Dataset for CDS BMF of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6TW86_BMF-01      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagcc
A0A2K6TW86_BMF-02      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagcc
A0A2K6TW86_BMF-03      atggagccatctcagtgtgtggaggagctggaggatgatgtgttccagcc
                       **************************************************

A0A2K6TW86_BMF-01      agaggatggggagccagggacccaacccgggagcttgctctctgctgacc
A0A2K6TW86_BMF-02      agaggatggggagccagggacccaacccgggagcttgctctctgctgacc
A0A2K6TW86_BMF-03      agaggatggggagccagggacccaacccgggagcttgctctctgctgacc
                       **************************************************

A0A2K6TW86_BMF-01      tgtttgcccagagcctactggactgccccctcagccggcttcagctcttc
A0A2K6TW86_BMF-02      tgtttgcccagagcctactggactgccccctcagccggcttcagctcttc
A0A2K6TW86_BMF-03      tgtttgcccagagcctactggactgccccctcagccggcttcagctcttc
                       **************************************************

A0A2K6TW86_BMF-01      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A2K6TW86_BMF-02      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
A0A2K6TW86_BMF-03      cctctcacccactgctgtggccctggccttcgacccaccagccaggaaga
                       **************************************************

A0A2K6TW86_BMF-01      caaggctacccagaccctcagcccagcctcccccagccaaggtgtcatgc
A0A2K6TW86_BMF-02      caaggctacccagaccctcagcccagcctcccccagccaaggtgtcatgc
A0A2K6TW86_BMF-03      caaggctacccagaccctcagcccagcctcccccagccaaggtgtcatgc
                       **************************************************

A0A2K6TW86_BMF-01      tgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgct
A0A2K6TW86_BMF-02      tgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgct
A0A2K6TW86_BMF-03      tgccttgtggggtgactgaggaaccccagcgactcttttatg--------
                       ******************************************        

A0A2K6TW86_BMF-01      ggctaccggcttcctctccctgccagtttcccggcagtcttgccccttgg
A0A2K6TW86_BMF-02      ggctaccggcttcctctccctgccagtttcccggcagtcttgccccttgg
A0A2K6TW86_BMF-03      --------------------------------------------------
                                                                         

A0A2K6TW86_BMF-01      ggagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
A0A2K6TW86_BMF-02      ggagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
A0A2K6TW86_BMF-03      --------------------------------------------------
                                                                         

A0A2K6TW86_BMF-01      cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcag
A0A2K6TW86_BMF-02      cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcag
A0A2K6TW86_BMF-03      --------------------------------------------------
                                                                         

A0A2K6TW86_BMF-01      caacaccagcagaaccgaaatcgtgtgtggtggcaggtcctcctcttcct
A0A2K6TW86_BMF-02      caacaccagcagaaccgaaatcgtgtgtggtggcaggtcctcctcttcct
A0A2K6TW86_BMF-03      ---caccagcagaaccgaaatcgtgtgtggtggcaggtcctcctcttcct
                          ***********************************************

A0A2K6TW86_BMF-01      gcacaacctggctttgaatggagaagaaaacaggaatggggcaggtccga
A0A2K6TW86_BMF-02      gcacaacctggctttgaatggagaagaaaacaggaatggggcaggtccga
A0A2K6TW86_BMF-03      gcacaacctggctttgaatggagaagaaaacaggaatggggcaggtccga
                       **************************************************

A0A2K6TW86_BMF-01      ggtga
A0A2K6TW86_BMF-02      ggtga
A0A2K6TW86_BMF-03      g----
                       *    

© 1998-2018