Dataset for CDS BAD of organism Saimiri boliviensis boliviensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6TG62_BAD-02      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2K6TG62_BAD-01      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc
A0A2K6TG62_BAD-03      atgttccagatcccagagtttgagccgagtgagcaggaagactccagctc

A0A2K6TG62_BAD-02      tgcagagaggggcctgagccccagcaccgcaggggacagccccccaggct
A0A2K6TG62_BAD-01      tgcagagaggggcctgagccccagcaccgcaggggacagccccccaggct
A0A2K6TG62_BAD-03      tgcagagaggggcctgagccccagcaccgcaggggacagccccccaggct

A0A2K6TG62_BAD-02      ctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcac
A0A2K6TG62_BAD-01      ctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcac
A0A2K6TG62_BAD-03      ctggcaagcatcgacgccaggccccaggcctcccgggggacgccagtcac

A0A2K6TG62_BAD-02      cagcagggacagccaaccagcagcagccaccatggagggacttcctcgcc
A0A2K6TG62_BAD-01      cagcagggacagccaaccagcagcagccacca------------------
A0A2K6TG62_BAD-03      cagcagggacagccaaccagcagcagccaccatggagagaatcccagtgc

A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-01      --------------------------------------------------
A0A2K6TG62_BAD-03      aaagatgctctcgaaagcatcagcagggatgtctgccccagccactgact

A0A2K6TG62_BAD-02      ------------------------------cgaagagcgcgggcacagca
A0A2K6TG62_BAD-01      ------------------------------tggag-gcgctgg---agcc
A0A2K6TG62_BAD-03      cagaagcccaacacacagagaatgtaaagctggag-gcgctgg---agcc
                                                      * ** **** **   *** 

A0A2K6TG62_BAD-02      acgcagatgcggcaaagctccagctggacgcgagtcatccagtcctggtg
A0A2K6TG62_BAD-01      gtggagacacggagtcgccacagct-----cgtaccccgcagggacggag
A0A2K6TG62_BAD-03      gtggagacacggagtcgccacagct-----cgtaccccgcagggacggag
                         * ***  ***    **  *****     **   *   ***    ** *

A0A2K6TG62_BAD-02      ggatcggaacttgggcaggggaggctccgctccctcccagtgacctt---
A0A2K6TG62_BAD-01      ggggacgaa--gggatggaggaggagcccagcccttttcggggccgttcg
A0A2K6TG62_BAD-03      ggggacgaa--gggatggaggaggagcccagcccttttcggggccgttcg
                       **    ***   **   * *****  **   ****    * * ** *   

A0A2K6TG62_BAD-02      cgctccacatcccgaaactctacccgctcccatcgccctgggcggc-cat
A0A2K6TG62_BAD-01      cgctcggcaccccccaac-----------------ctctgggcagcacag
A0A2K6TG62_BAD-03      cgctcggcaccccccaac-----------------ctctgggcagcacag
                       *****  ** ***  ***                 * ****** ** ** 

A0A2K6TG62_BAD-02      cttggacatgggcggaagtgcttcctgcagggagggctga----------
A0A2K6TG62_BAD-01      c---gatatggccgcgagctcc---------ggaggatgagtgacgagtt
A0A2K6TG62_BAD-03      c---gatatggccgcgagctcc---------ggaggatga----------
                       *   ** **** **  **  *          *  ** ***          

A0A2K6TG62_BAD-02      cccagattcccttccggtgcgt----------------------------
A0A2K6TG62_BAD-01      tgtggactccttcaagggacttcctcgcccgaagagcgcgggcacagcaa
A0A2K6TG62_BAD-03      --------------------------------------------------

A0A2K6TG62_BAD-02      --------------------------------------------------
A0A2K6TG62_BAD-01      cgcagatgcggcaaagctccagctggacgcgagtcatccagtcctggtgg
A0A2K6TG62_BAD-03      --------------------------------------------------

A0A2K6TG62_BAD-02      --------------------------------------gtga
A0A2K6TG62_BAD-01      gatcggaacttgggcaggggaggctccgctccctcccagtga
A0A2K6TG62_BAD-03      ------------------------------------------

© 1998-2019